Обнаружение вируса иммунодефицита человека типа 1 (ВИЧ-1) Антисмысление белка (ASP) РНК Стенограммы у пациентов Strand-специфический RT-PCR

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

РНК шпильки и петли могут функционировать в качестве праймеров для обратной транскрипции (RT) в отсутствие последовательности конкретных грунтовки, вмешиваясь в изучение перекрывающихся антисмысловых стенограмм. Мы разработали метод, способный выявлять РНК, специфичную для прядей, и мы использовали ее для изучения антисмыслового белка ВИЧ-1 ASP.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Mancarella, A., Procopio, F. A., Achsel, T., De Crignis, E., Foley, B. T., Corradin, G., Bagni, C., Pantaleo, G., Graziosi, C. Detection of Human Immunodeficiency Virus Type 1 (HIV-1) Antisense Protein (ASP) RNA Transcripts in Patients by Strand-Specific RT-PCR. J. Vis. Exp. (153), e60511, doi:10.3791/60511 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

В ретровирусах антисмысловая транскрипция была описана как в вирусе иммунодефицита человека 1 (ВИЧ-1), так и в Т-лимфотропном вирусе человека 1 (HTLV-1). В ВИЧ-1, антисмыслового белка ASP ген расположен на отрицательной нити env, в кадре чтения -2, охватывающих соединение gp120/gp41. В смысле ориентации, 3' конец ASP открытой рамки чтения перекрывается с gp120 гиперпеременных регионов V4 и V5. Изучение АСП РНК было сорвано явление, известное как RT-само-первичности, в котором РНК вторичных структур имеют возможность премьер RT в отсутствие конкретных грунтовки, генерации неспецифических cDNAs. Комбинированное использование высокой денатурации РНК с биотинизатированными обратными грунтовками в реакции RT, а также очищение кДНК на стрептавидин-покрытие магнитных бусинов, позволило нам селективно усилить АСП РНК в CD4 "T-клеток, полученных от лиц, инфицированных ВИЧ-1. Наш метод относительно недорогой, простой в исполнении, очень надежный и легко воспроизводимый. В этом отношении он представляет собой мощный инструмент для изучения антисмысловой транскрипции не только в ВИЧ-1, но и в других биологических системах.

Introduction

Антисмыслового белка (ASP) ген астровая рамка чтения (ORF) расположена на отрицательной нити вируса иммунодефицита человека типа 1 (ВИЧ-1) конверт (env) ген, охватывающий соединение gp120/gp411. За последние 30 лет, несколько докладов показали, что ген ВИЧ ASP действительно транскрибируется и переводится2,3,4,5,6,7,8,9. Хотя ASP антисмысл стенограммы были полностью охарактеризованы в пробирке, до недавнего времени информация о фактическом производстве ASP РНК у пациентов по-прежнему отсутствует.

Последовательность ASP обратная и дополняет env. Это представляет собой серьезное препятствие при попытке обнаружить транскрипты для ASP. Стандартные методы обратной транскрипции-полимеразы цепной реакции (RT-PCR) используют генно-специфические антисмысловые праймеры для синтеза дополнительных ДНС (cDNA) правильной полярности. Этот подход, однако, не позволяет определить ориентацию (чувство или антисмысл) первоначального шаблона РНК, так как РНК шпильки или петли могут премьер RT в обоих направлениях в отсутствие праймеров10, явление, известное как RT само-priming. Большинство следователей ASP обойти проблему RT самопремьера с помощью грунтовки помечены последовательностей, которые не связаны с ВИЧ-111,12. Эта стратегия, однако, не устраняет возникновение этого явления, и может привести к потенциальному переносу неспецифических CDNA в ПЦР11.

Недавно мы разработали новый strand-специфический RT-PCR исследование для изучения антисмысловой РНК, и мы использовали его для обнаружения ASP РНК в когорте из шести ВИЧ-инфицированных пациентов, как показано в таблице 1. Процедура, описанная ниже, была ранее опубликована Антонио Mancarella и др.13. В нашем протоколе мы избегаем производства неспецифических КДНС с помощью двойного подхода. Во-первых, мы устраняем РНК вторичных структур путем денатурации РНК при высокой температуре (94 градусов по Цельсию), а во-вторых, мы вспять транскрибирования АСП РНК с помощью биотиниляции ASP-специфической грунтовки и сродство-очистить результирующую кДНК. При таком подходе мы можем усилить только нашу целевую кДНК, так как другие неспецифические продукты RT либо предотвращаются от генерирования (высокая денатурация РНК), либо устраняются до ПЦР (очистка сродства).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Это исследование было одобрено Институциональным наблюдательным советом Центра Госпитальер Университета Vaudois (CHUV).

1. Заражение периферических клеток крови (ПБМК) штаммом ВИЧ-1HXB2

  1. День 1: ПБМЦ СТИМУЛЯЦИЯ
    1. Изолировать PBMCs от здорового донора баффи пальто.
    2. Подсчитайте и resuspend PBMCs наконцентрации 1x10 6/mL в полном Roswell Park Мемориальный институт (RPMI) 1640 среда, содержащая 10% сыворотки крупного рогатого скота плода (FBS) и 1% пенициллин/стрептомицин (R-10), с добавлением 50 U/mL интерлейкина-2 (IL-2) и 3 мкг/мл фитогемагглютинина (PHA).
    3. Pipet вверх и вниз и разделить клетки в двух шестиколодцных пластин (3 мл клеточной подвески / хорошо).
    4. Инкубировать в течение 3 дней при 37 градусах По цельсии и 5% CO2.
  2. День 3: ПБМЦ ИНФЕКЦИЯ
    ПРИМЕЧАНИЕ: Используйте одну из двух пластин, как в шаге 1.1.3 в качестве отрицательного контроля (не заражайте эти клетки).
    ВНИМАНИЕ: Выполните всю процедуру в лаборатории уровня биобезопасности III (P3).
    1. Бассейн PBMCs из одной пластины в 50 мл сокола трубки и центрифуги на 300 х г в течение 10 минут.
    2. Откажитесь от супернатанта и повторно отрепримите клетки в 2,2 мл R-10, содержащий 20 U/mL Ил-2 и 2 мкг/мл полибрена.
    3. Оттепель флаконы, содержащие вирус ВИЧ-1HXB2 и добавить 1,8 мл вирусной суспензии (0,376 нг / Л) в клетках.
    4. Инкубировать клетки в течение 2 ч при 37 градусах Цельсия, аккуратно закрученного трубки каждые 30 минут.
    5. Центрифуги клетки на 300 х г в течение 10 мин.
    6. Отбросьте супернатант и повторно отрепретируйте клетки при 1x106/млв R-10, содержащем IL-2 (50 U/mL).
    7. Перенесите суспензию клетки в 24-новартятину в концентрации 1 мл/колодец и инкубировать в течение 5 дней при 37 градусах Цельсия и 5% CO2.
    8. Урожай 1 хорошо каждый день и передать клетки 1,5 мл трубки (помечены с днем заражения).
      ПРИМЕЧАНИЕ: Перед центрифугией, передача 150 Л клеточной подвески в трубку цитометрии потока для контроля качества инфекции PBMCs (см. шаг 1.3)
    9. Центрифуга труб на 400 х г в течение 10 минут и отбросить супернатант.
    10. Заморозить клеточные гранулы при -80 градусов до использования.
  3. Инфекция ПБМК: контроль качества
    1. Для каждого дня инфекции, собирать 150 л инфицированных ПБМК и передать их в поток цитометрии трубки.
    2. Добавьте 1 мл фосфатно-буферного собела (PBS) и центрифугу при 400 х г в течение 5 мин.
    3. Откажитесь от супернатанта и добавьте 50 л PBS, содержащего 1 зл и цвет живой/мертвый краситель Aqua (ранее разбавленный 1:10 с PBS).
    4. Инкубировать при 4 градусах по Цельсию в течение 15 мин.
    5. Добавьте 1 мл PBS, центрифугу при 400 х г в течение 5 мин, и отбросить супернатант.
    6. Добавьте 250 л раствора фиксации/пермяки и инкубацию в течение 20 минут при комнатной температуре в темное время суток.
    7. Добавьте 1 мл 1x Perm/Wash Buffer (10x стоковый раствор, содержащий как FBS, так и сапонин, разбавленный 1:10) и центрифугу на 400 х г в течение 5 мин.
    8. Откажитесь от супернатанта и добавьте 50 кЛ PBS, содержащий Фторесцен изотиокяна (FITC)-спряженные антитела (разбавленные 1:10).
    9. Инкубировать в течение 20 минут при комнатной температуре в темноте.
    10. Добавьте 1 мл PBS, центрифугу при 400 х г в течение 5 мин, и отбросить супернатант.
    11. Добавьте 150 кЛ х CellFIX (10x стоковый раствор, содержащий 10% формальдегид, 3,55% метанола, 0,93% азидеда натрия, разбавленного 1:10) и анализируйте клетки с помощью цитометрии потока.

2. Стимулирование человеческих CD4 'Т-клеток с анти-CD3/CD28 антител

  1. Изолировать CD4 " Т-клетки от ПБМК как ВИЧ-1 инфицированных пациентов и здоровых доноров.
  2. Подготовка человека анти-CD3/CD28 смесь антител путем разбавления анти-CD3 (1:100) и анти-CD28 (1:50) в PBS.
  3. Пальто 48-колодец пластины, добавив 200 л смеси антител на хорошо соответствующее количество скважин и инкубировать при 37 градусов по Цельсию на 2 ч.
  4. Аспирировать раствор антител и добавить 1 мл клеток CD4'T на 1x106/мл в анти-CD3/CD28 антитела покрытием скважин.
    ПРИМЕЧАНИЕ: Стимулировать CD4 "Т-клетки до 5 дней.

3. Обратная транскрипция

ПРИМЕЧАНИЕ: Для получения конкретных для пациентов грунтовки, провирусная ДНК, выделенная из клеток CD4'T от каждого пациента, была усилена с помощью праймеров ВИЧ-1HXB2 Pan ASP. Пациент конкретных грунтовки были разработаны с использованием провирусной последовательности внутренней Pan ASP грунтовки. Все грунтовки и зонды, используемые в этом исследовании, перечислены в таблице 2.

  1. Изолировать общую РНК из клеток
    1. Количественно РНК и устранить загрязнение ДНК путем обработки образцов с DNase.
    2. Выполните реакции RT в объеме 50 Л. Передача 0,1-1 мкг общей РНК в соответствующее количество скважин 96-колодской пластины ПЦР. Подготовка РНК смеси, добавив следующие компоненты в РНК:
      5 зЛ биотинители ASP реверсная грунтовка (20 мкм)
      2,5 л дезоксинуклеотидных трифосфатов (дНТП) (10 мМ)
      25 зл диэтилпирокарбоната (DEPC) обработанной дистиллированной воды (dH2O).
      Подготовьте эндогенные управления RT, добавив 5 кЛ безнужной воды вместо биотиниляции РЕверсивной грунтовки ASP.
    3. Поместите 96 хорошо ПЦР пластины в термоциклор и тепла РНК смеси до 94 градусов по Цельсию в течение 5 минут.
    4. Немедленно охладить РНК смесь в ледяную воду, по крайней мере 1 мин.
    5. Подготовка реакционной смеси, добавив следующие компоненты в трубку 1,5 мл (вычислить общее количество образцов плюс 1):
      10 злиц 5x буфера RT
      2,5 л 0,1 М из 1,4-дитиотрейтол (DTT)
      2,5 л Из RNase из (40 единиц / Л)
      2,5 л фермента РТ (200 единиц/л)
    6. Перенесите 17,5 л этой смеси на каждую из РНК-содержащих скважин. Подготовьте контроль RT-minus, заменяющий обратную транскриптазу на 2,5 л без нуклеазной воды.
    7. Смешайте аккуратно и инкубировать пластину при 55 градусах По Цельсию в течение 60 минут с помощью термоциклора.
    8. Инактивируйте реакции при нагревании при 70 градусах по Цельсию в течение 15 мин.

4. Очистка аффинити аСП биотинилатированных кДНК

ПРИМЕЧАНИЕ: Не очищайте реакции RT-минус.

  1. Приготовьте 1 l 2x стирального/связывающего буфера, содержащего 10 мм Tris-HCl (pH 7.5), 1 мМ этилендениаминтететацетическая кислота (ЭДТА) и 2 M NaCl. Отфильтровать решение.
    1. Приготовьте 50 мл 1x стирального/связывающего буфера с использованием воды класса ПЦР.
    2. Для каждой реакции используйте 10 л стрептавидино-конъюгированных магнитных бусин. В зависимости от количества реакций, перенесите соответствующий объем бисера на трубку 1,5 мл.
    3. Вымойте бусины, добавив равный объем 2x стиральной / связывающей буфер и вихрь для 15 с.
    4. Поместите трубку в магнитную стойку разделения и инкубировать в течение 3 минут при комнатной температуре.
    5. Тщательно удалите супернатант, не нарушая бисера и добавить тот же объем стирки / связывания 2x буфера, как первоначальный объем бисера.
    6. Вихрь на 30 с и передача 10 л подвески бисера на соответствующее количество 1,5 мл труб.
    7. Поместите трубки в магнитной стойке разделения и инкубировать в течение 3 минут при комнатной температуре.
    8. Откажитесь от супернатанта и добавьте 50 зл стирки/связывающий 2x буфер.
    9. Добавьте 50 зл биотининатированных кДНК в соответствующие трубки, содержащие бусы.
    10. Инкубировать в течение 30 минут при комнатной температуре, вращающейся мягко.
    11. Отделить бусы от супернатанта магнитом сепаратной стойки в течение 3 мин при комнатной температуре.
    12. Вымойте бусины, добавив 200 л 1x стиральной / связывающей буфер. Поместите трубки в стойку разделения магнита в течение 3 минут при комнатной температуре и отбросьте супернатант. Повторите дважды.
    13. Притязание бисера в 10 л воды класса ПЦР.

5. Стандартный ПЦР

ПРИМЕЧАНИЕ: Цель стандартного ПЦР состоит в том, чтобы усилить весь ORF гена ASP. Продукты усиления затем клонируются в плазмид pCR2.1 для разработки стандартных кривых для количественной оценки АСП РНК в режиме реального времени PCR (см. пункт в реальном времени PCR).

  1. Выполняйте стандартные ПЦР в общем объеме 50 ЗЛ. Подготовьте соответствующий объем мастер-микса ПЦР (количество образцов плюс 1). Для каждого образца добавьте следующие компоненты в трубку 1,5 мл:
    1 зл от 10 праймеров ASP (вперед и обратно)
    1 кл/л 10 мМ dNTPs
    Хлорид магния (MgCl2)(концентрация зависит от используемых грунтовок)
    dH2O до окончательного тома 49 Зл
    1. Хорошо перемешайте, быстро сверните содержимое и перенесите 49 Л/хорошо мастерской смеси ПЦР на 96-колодую пластину ПЦР.
    2. Тщательно вихрь трубки, содержащие бусы, используемые для ASP cDNA сродство очистки в течение 15 с.
    3. Добавьте в соответствующие скважины 1 градус шарика и запустите ПЦР с помощью следующей программы: 95 градусов по Цельсию в течение 2 мин, 40 циклов 95 градусов по Цельсию на 30 с, 55 градусов по Цельсию за 30 с и 68 градусов по Цельсию на 40 с, затем 68 градусов по Цельсию в течение 7 мин.
    4. Разделите продукты ПЦР на 1% агарозного геля, разрежьте полосы и клоните усиленные продукты на плазмид pCR2.1.
    5. Секвенируйте и проанализируйте последовательности каждого клона.

6. В реальном времени количественный ПЦР (qPCR)

ПРИМЕЧАНИЕ: Разработка конкретных для пациентов грунтовок и зондов с использованием подхода, описанного в шаге 3 "Обратная транскрипция". Для qPCR включите asP плазмидные разбавления для стандартных кривых. Плазмиды, содержащие вставки для конкретных пациентов, разрабатываются, как указано в примечании в начале шага 5 "Стандарт ПЦР".

  1. Подготовьте стандартную кривую с помощью 1:10 ASP плазмидных серийных разбавлений, начиная с 3 х 106 копий/КЛ до 3 копий/ЗЛ.
    1. Первый раунд ПЦР (предусилитель). Выполните реакции в общем объеме 25 ЗЛ. Подготовьте соответствующий объем мастер-микса ПЦР (количество образцов плюс 1). Для каждого образца добавьте следующие компоненты в трубку 1,5 мл:
      0,5 зл" смеси ASP или env primer (окончательная концентрация 0,2 мкм каждый) (вперед и наоборот)
      Смесь dNTPs 0,5 л (окончательная концентрация 0,2 мМ каждая)
      MgCl2 (концентрация зависит от пар грунтовки)
      dH2O до окончательного тома 24 Зл
    2. Передача 24 ЗЛ мастерской смеси ПЦР в соответствующее количество скважин 96-колодецной пластины ПЦР.
    3. Тщательно вихрь трубки, содержащие бусы с кДНК для 15 с.
    4. Добавьте в соответствующие скважины 1 л бусинок. Сделайте то же самое для плазмидных разбавлений.
    5. Выполнить ПЦР с помощью следующего алгоритма: денатурация в течение 2 мин при 95 градусах Цельсия; 30 с при 95 градусах Цельсия, 30 с при 55 градусах Цельсия, 40 с при 68 градусах по Цельсию в течение 18 циклов; расширение при 68 градусах по Цельсию в течение 7 мин.
    6. Разбавить реакции первого раунда ПЦП 1:5 водой класса ПЦР.
    7. Второй тур qPCR. Выполните реакции в общем объеме 20 ЗЛ. Подготовьте соответствующий объем мастер-микса ПЦР (количество образцов плюс 1). Для каждого образца добавьте следующие компоненты в трубку 1,5 мл:
      1,8 л 10 мкм праймеров (вперед и обратно)
      1 л из 5 зонда ММ
      6,2 л dH2O
    8. Передача 19 qPCR мастер-миксву в соответствующее количество скважин пластины qPCR 96 скважин и добавьте 1 зл и 1 л разбавленных реакций ПЦР первого раунда к соответствующим скважинам. Сделайте то же самое для плазмидных разбавлений.
    9. Выполнить qPCR со следующим алгоритмом: денатурация в течение 10 мин при 95 градусах Цельсия; 15 с при 95 градусах По кв.м,1 мин при 60 градусах по Цельсию в течение 40 циклов.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Высокая температура ДНК-денатурации в сочетании с очищением сродства биотинизатной кДНК предотвращает усиление неспецифических продуктов ASP во время ПЦР в ПБМК, инфицированных в пробирке и в клетках CD4 'T, изолированных от пациентов. Было показано, что самоприящеество RT происходит во время обратной транскрипции антисмысловых РНК10,14,15,16,17. Для того, чтобы предотвратить это явление, мы разработали новый подход, используя технику, первоначально описанную Heist et al.10. Наша процедура включает в себя высокую температуру денатурации РНК до РТ и использование биотинилатированных грунтовки для выполнения RT, а затем сродство-очищение биотиниляции cDNAs на стрептавидин покрытием магнитных бусин13. CDNAs, полученные этим методом, могут быть использованы для приложений ниже по течению, включая стандартные ПЦР или qPCR.

Экспериментальные условия для транскрипции антисмыслов были впервые протестированы в ПБМК от одного здорового донора, инфицированного in vitro с ВИЧ-1HXB2, эталонной последовательности для ВИЧ-1 Подтипа В (все наши пациенты инфицированы изолятами этого подтипа). В таблице 2 показаны последовательности грунтовок и зондов, используемых в данном исследовании. Наши первоначальные реакции RT были сделаны с использованием регулярного, не биотининатилированного антисмыслового грунта (ASP R1) и привели к успешному усилению ASP (ASP F1-R1 грунтовая пара)(Рисунок 1A, переулки 1 - 3). Тем не менее, при таком подходе, мы также усилили полосу того же молекулярного веса в грунт-минус RT реакции управления (Lanes 4 - 6). Полное отсутствие сигнала в наших отрицательных контроля (Lanes 7 - 8) указывает на то, что неспецифический шаблон исходит от реакции RT, а не от перекрестного загрязнения образцов.

Чтобы обойти проблему, созданную RT самоцвет, мы решили использовать метод, ранее описанный Haist et al.10, в котором специфический антисмысл грунтовка маркируется биотином так, что в результате биотинилатированной кДНК, соответствующей антисмысловой ориентации, может быть очищена до ПЦР и выборочно усилена. При таком подходе мы смогли усилить последовательность ASP(рисунок 1B,переулки 1 - 3) с значительно уменьшенным загрязнением от неспецифической кДНК в элементах управления праймериз(рисунок 1B,полосы 4-6).

Оптимизация этого метода была достигнута путем полного денатурации РНК до РТ при 94 градусах Цельсия, а затем немедленного охлаждения на ледяную воду. Как показано на рисунке 2A,B, полоса ASP эффективно усиливается, в то время как неспецифические продукты исчезли.

АСП РНК обнаруживается в CD4 "Т-клеток у пациентов с обнаруживаемой виремии и в отсутствие терапии, после стимуляции с анти-CD3/CD28. ASP РНК была обнаружить либо в нефракционированных ПБМК или нестимулированных CD4 "Т-клеток, изолированных от ВИЧ-инфицированных пациентов (данные не показаны). Тем не менее, он может быть легко обнаружен в клетках CD4, изолированных от трех ВИЧ-позитивных субъектов, MP135, MP140 и MP148 (Таблица 1), после стимуляции с анти-CD3/CD28. Кинетика экспрессии АСП РНК, измеренная qPCR у этих трех пациентов, показана на рисунке 3.

Клетки CD4, изолированные от пациентов, проходящих АРТ и с необнаруживаемой виремией, могут производить небольшое количество РНК АСП при стимуляции с помощью анти-CD3/CD28. Количественная оценка уровня АСП РНК у двух из этих пациентов (MP071, MP146) по qPCR показывает, что в этих условиях АСП РНК обнаруживается в низких уровнях (10-15 копий /миллион CD4 "T клеток) на 3-5 дней после стимуляции(рисунок 4). В одном пациенте однако (MP069), никакая РНК ASP не смогла быть обнаружена в любой момент времени (данные не показаны).

ASP и env РНК имеют сходные модели выражения у одного необработанного пациента с обнаруживаемой виремией (MP140). Были проанализированы два пациента, один необработанный (MP140) и один лечат (MP146). В MP140 мы могли обнаружить как ASP, так и env. Хотя их уровни транскрипции были разными(Рисунок 5A), кривая выражения этих двух генов с течением времени была идентичной, которая может быть визуализирована графикданных данных по логарифмической шкале(рисунок 5B). У пациента MP146, который лечился и чья виремия была ниже уровней обнаружения, ASP и env были едва обнаруживаемы и только после нескольких дней стимуляции(рисунок 5C).

Figure 1
Рисунок 1: Выражение РНК ASP в ПБМК от одного ВИЧ-отрицательного человека, инфицированного в пробирке с ВИЧ-1HXB2 стандартным и модифицированным RT-PCR. (A) Обнаружение РНК ASP с использованием стандартного RT-PCR. ASP усиливается из кДНК, синтезированной в присутствии небиотинилатированного ASP-специфического антисмыслового грунтовщика ASP R1 (Lanes 1-3). Та же полоса встречается и в праймериз-минус RT управления (Lanes 4-6). (B) Визуализация РНК ASP путем биотинилаза антисмысловой грунтовки и очистки кДНК (Lanes 1-3). Диапазон пониженной интенсивности по-прежнему обнаруживается в элементах управления грунтовым и минусом (Lanes 4-6). Нет полос присутствуют в отрицательных элементов управления. Ранее опубликовано в статье "Обнаружение антисмысленового белка (ASP) РНК стенограммы у лиц, инфицированных вирусом иммунодефицита человека типа 1 (ВИЧ-1)", Mancarella et al.13 (J Gen Virol 100 (5):863-876. doi: 10.1099/jgv.0.00124). Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 2
Рисунок 2: АСП РНК выражается в ПМБК одного ВИЧ-отрицательного человека после инфицирования ВИЧ-1HXB2. (A) Полоса ASP легко обнаруживается РНК, которая была полностью денатурирована и перекрадена с помощью биотининатированного праймера RT (ASP R1) (Lanes 1-3), но не в очищенной кДНК от контроля праймер-минус (Lanes 4-6). (B) Нет сигнала, соответствующего ASP обнаруживается в RT-минус управления РНК от инфицированных ПБМК, неинфицированных ПБМК или воды, хотя четкая полоса видна в кляп положительный контроль от ACH-2 клеток. Ранее опубликовано в статье "Обнаружение антисмысленового белка (ASP) РНК стенограммы у лиц, инфицированных вирусом иммунодефицита человека типа 1 (ВИЧ-1)", Mancarella et al.13 (J Gen Virol 100 (5):863-876. doi: 10.1099/jgv.0.00124). Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 3
Рисунок 3: В анти-CD3/CD28-стимулировали CD4 "Т-клеток, изолированных от трех необработанных пациентов, производство РНК ASP легко обнаружить и пики между днем 2 и 4 после стимуляции. В MP135 и MP140, выражение ASP достигло пика на 4-й день после стимуляции, в то время как в MP148 он достиг пика на второй день. Уровни ASP выражаются как РНК-копии/миллион CD4"T-клетки. Очки в курсе времени соответствуют среднему значению тройной реакции ПЦР. Ранее опубликовано в статье "Обнаружение антисмысленового белка (ASP) РНК стенограммы у лиц, инфицированных вирусом иммунодефицита человека типа 1 (ВИЧ-1)", Mancarella et al.13 (J Gen Virol 100 (5):863-876. doi: 10.1099/jgv.0.00124). Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 4
Рисунок 4: У двух авремических пациентов, проходящих АРТ, ASP едва обнаруживается только после нескольких дней стимуляции. У обоих наших пациентов, ASP не может быть обнаружен в день 0. В пациентMP071, низкие уровни ASP могут быть обнаружены в день 3, в то время как в пациента MP146, мы должны были ждать до дня 5, чтобы увидеть некоторые уровни РНК. Уровни ASP выражаются как РНК-копии/миллион CD4"T-клетки. Очки в курсе времени соответствуют среднему значению тройной реакции ПЦР. Ранее опубликовано в статье "Обнаружение антисмысленового белка (ASP) РНК стенограммы у лиц, инфицированных вирусом иммунодефицита человека типа 1 (ВИЧ-1)", Mancarella et al.13 (J Gen Virol 100 (5):863-876. doi: 10.1099/jgv.0.00124). Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 5
Рисунок 5: Выражение ASP и env в анти-CD3/CD28-стимулировали CD4 "Т-клетки в обработанных (MP146) и необработанных (MP140) пациентов. (A) У необработанного пациента (MP140), env выражается на более высоких уровнях, чем ASP; (B) Те же данные, отображаемые на логарифмической шкале, показывают, что ASP и env выражение характеризуются аналогичным профилем сверхурочно; (C) Выражение кинетики ASP и env в одном пациенте с необнаруживаемой виремии и проходит АРТ (MP146). Ранее опубликовано в статье "Обнаружение антисмысленового белка (ASP) РНК стенограммы у лиц, инфицированных вирусом иммунодефицита человека типа 1 (ВИЧ-1)", Mancarella et al.13 (J Gen Virol 100 (5):863-876. doi: 10.1099/jgv.0.00124). Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Идентификатор пациента Возраст Секс Стадия ВИЧ-инфекции Кладе Вирусная нагрузка (копии/мл) Cd4 Граф (клетки/зл) Статус АРТ
MP135 44 М C3 B 1.6x105 176 Необработанной
MP140 23 М A2 B 3.6x104 427 Необработанной
MP148 37 М A1 B 2.0x104 717 Необработанной
MP069 42 М A1 B Злт;20 1309 Обработаны
MP071 47 М C3 B Злт;20 167 Обработаны
MP146 59 М C3 B Злт;20 385 Обработаны

Таблица 1: Особенности пациентов. Ранее опубликовано в статье "Обнаружение антисмысленового белка (ASP) РНК стенограммы у лиц, инфицированных вирусом иммунодефицита человека типа 1 (ВИЧ-1)", Mancarella et al.13 (J Gen Virol 100 (5):863-876. doi: 10.1099/jgv.0.00124).

Имя праймер/Зонд Последовательность праймер (5' к 3')
ASP F1 ТТАГАГАГаГКАЧКАККАКАЦИЯ
ASP R1 ГААКККААГААГААААААААГККТК
PAN ASP F ACCAAGCCTACTACTATCATATG
PAN ASP R ГКАКАТТАТАААТТАГАГАГГАГГАГАГАГАГАГАГАГАГА
ASP MP135, 146, 071 F CCCAAGAACCCAAGGAACACACACATAGTAG
ASP MP135, 146, 071 R КАТАГГААТАККАККАККАКАЦИЯ
ASP MP135, 146, 071 Зонд FAM/TAMRA ТКЦбККАККАКТКТКТТТТГТККК
ASP MP140 F CCCATAGTGCTCCTTTTTTTC
ASP MP140 R АГААГАГТГКГАГАГАГА
ASP MP140 зонд FAM/TAMRA АГКТТАТТТЦКККККТКТКТКТКТККТККТККТККТККТККТКТ
ASP MP148 F КККТККАККАКТКТТТТТТТТ
ASP MP148 R АГААККТГАГАГАГАГАГААТГГ
ASP MP148 Зонд FAM/TAMRA TGGTGGGTGTACTACTTAATGGTT
ENV MP140 F АГААГАГТГКГАГАГАГА
ENV MP140 R CCCATAGTGCTCCTTTTTTTC
ЗОНД ENV MP140 FAM/TAMRA АГКТТАТТТЦКККККТКТКТКТКТККТККТККТККТККТККТКТ
ENV MP146 F КАТАГГААТАККАККАККАКАЦИЯ
ENV MP146 R CCCAAGAACCCAAGGAACACACACATAGTAG
ЗОНД ENV MP146 FAM/TAMRA ТКЦбККАККАКТКТКТТТТГТККК

Таблица 2: ПРАЙМЕРЫ и зонды RT-PCR

Subscription Required. Please recommend JoVE to your librarian.

Discussion

В этом отчете мы описываем специфический rt-расса, применяемый к обнаружению АСП РНК в клетках CD4', изолированных от людей, инфицированных ВИЧ-1. Появление неспецифических грунтовок во время RT препятствует обнаружению РНК стенограммы с правом полярности, что приводит к неправильной интерпретации результатов. Предыдущие группы разработали несколько стратегий, направленных на предотвращение праймер-независимых синтез кДНК во время реакции RT. Пометка обратной грунтовки в конце 3's с последовательностями, не связанными с ВИЧ, доказала свою эффективность в достижении усиления6,8,9. Тем не менее, этот подход позволяет только сделать ложно загрунтованных cDNA обнаружить, а не избегать его, с риском его утечки в реакцию ПЦР, вызывая усиление неспецифических продуктов ДНК (т.е., env вместо ASP).

Наши первоначальные попытки RT-PCR обнаружить РНК ASP были выполнены с использованием стандартного антисмыслового грунтовки. Усиления были успешными, так как мы получили полосы правильного молекулярного веса, но полосы такого же размера также присутствовали в нашем элементе управления праймер-минус. Основываясь на этих результатах, мы использовали другой подход, выполняя RT с биотинилатной конкретной антисмысловой грунтовки, как описано Haist и др.10. Несмотря на то, что наши предварительные эксперименты привели к резкому снижению самопомощи RT, мы не смогли полностью удалить неспецифические продукты усиления. Haist и коллеги устранить неспецифические продукты cDNA путем мытья бисера в условиях высокой строгости10. В нашем методе мы полностью удалили источник самоцвета в виде вторичных структур РНК, используя высокие температуры денатурации для полной линейной линии шаблона РНК.

Мы показываем, что АСП РНК выражается в анти-CD3/CD28-стимулировали CD4 "T лимфоцитов. Обнаружение ASP, однако, не может быть достигнуто в клетках при отсутствии стимуляции. Наши данные несколько отличаются от тех, Сапата и коллеги, которые сообщили выражение низких уровней ASP в отдыхах CD4 "клеток, изолированных от пациентов, проходящих АРТ9. Основываясь на этих результатах, они предполагают, что РНК ASP может играть определенную роль в регулировании задержки ВИЧ. Наш вывод о том, что в том же человеке кинетика выражения ASP и env характеризуются тем же профилем не согласуется с моделью Сапаты9. В самом деле, если действительно ASP был вовлечен в регулирование задержки, его выражение профиля должна быть противоположной той, наблюдается для env18.

Мы также отметили, что уровни транскрипции env более чем на 2 журнала выше, чем у ASP, по крайней мере у пациентов в отсутствие терапии. Эти данные согласуются с исследованиями Laverdure et al.8, показывающими, что в первичных клетках CD4, инфицированных in vitro, транскрипция антисмыслов LTR LTR значительно ниже (до 1000 раз), чем 5'sense транскрипции. Наши результаты показывают, что ASP выражается в инфицированных ЛИмфоцитов CD4 независимо от стадии заболевания до тех пор, как клетки должным образом стимулировали. Кроме того, наши данные показывают, что ASP выражается в клетках от пациентов, проходящих арт-лечение, хотя уровень экспрессии в этих клетках ниже, чем в клетках от пациентов в отсутствие терапии.

Таким образом, мы предлагаем надежный нити конкретных RT анализ, направленный на предотвращение праймер-независимых синтезки cDNA. ASP и env являются двумя генами, которые перекрываются друг с другом в противоположной ориентации, особенность, которая делает их изучение очень сложным. Наш подход, который позволяет выборочно захватывать cDNAs ретротрансранцированный из РНК как с отрицательной, так и положительной полярностью, представляет собой оптимальный и эффективный инструмент для изучения этих двух генов, в частности, и генов, перекрывающихся в их антисмысле ориентации в целом.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторы заявляют, что конфликта интересов нет.

Acknowledgments

Мы благодарим Патрицию Амелио, Алессандру Ното, Крейга Фенвика и Матье Перро за то, что они всегда были доступны для обсуждения нашей работы и всех людей в Лаборатории иммунопатогенеза СПИДа за их драгоценную техническую помощь. Мы также хотели бы поблагодарить Джона и Аарона Уэддла из VSB Associated Inc., которые внесли свой вклад с отличными произведениями искусства. Наконец, большое спасибо всем пациентам, без которых эта работа была бы невозможна. Эта работа не получила никаких конкретных субсидий от какого-либо финансируемого учреждения.

Materials

Name Company Catalog Number Comments
BD LSR II Becton Dickinson
BigDye Terminator v1.1 Cycle Sequencing Kit Applied Biosystem, Thermo Fisher Scientific 4337450
dNTP Set (100 mM) Invitrogen, Thermo Fisher Scientific 10297018
Dynabeads M-280 Streptavidin Invitrogen, Thermo Fisher Scientific 11205D
EasySep Human CD4+ T Cell Isolation Kit Stemcell Technologies 19052
Fetal Bovine Serum Biowest S1010-500
Fixation/Permeabilization Solution Kit Becton Dickinson 554714
HIV Gag p24 flow cytometry antibody - Kc57-FITC Beckman Coulter 6604665
Human IL-2 Miltenyi Biotec 130-097-743
Lectin from Phaseolus vulgaris (PHA) Sigma-Aldrich 61764-1MG
LIVE/DEAD Fixable Yellow Dead Cell Stain Kit, for 405 nm excitation Invitrogen, Thermo Fisher Scientific L34967
Mouse Anti-Human CD28 Becton Dickinson 55725
Mouse Anti-Human CD3 Becton Dickinson 55329
Primers and Probes Integrated DNA Technologies (IDT)
Penicillin-Streptomycin BioConcept 4-01F00-H
Platinum Taq DNA Polymerase High Fidelity Invitrogen, Thermo Fisher Scientific 11304011
Polybrene Infection / Transfection Reagent Sigma-Aldrich TR-1003-G
RNeasy Mini Kit Qiagen 74104
Roswell Park Memorial Institute (RPMI) 1640 Medium Gibco, Thermo Fisher Scientific 11875093
StepOnePlus Real-Time PCR System Applied Biosystem, Thermo Fisher Scientific 4376600
SuperScript III Reverse Transcriptase Invitrogen, Thermo Fisher Scientific 18080044
TaqMan Gene Expression Master Mix Applied Biosystem, Thermo Fisher Scientific 4369016
TOPO TA Cloning Kit for Subcloning, with One Shot TOP10 chemically competent E. coli cells Invitrogen, Thermo Fisher Scientific K450001
TURBO DNase (2 U/µL) Invitrogen, Thermo Fisher Scientific AM2238
Veriti Thermal Cycler Applied Biosystem, Thermo Fisher Scientific 4375786

DOWNLOAD MATERIALS LIST

References

  1. Miller, R. H. Human immunodeficiency virus may encode a novel protein on the genomic DNA plus strand. Science. 239, (4846), 1420-1422 (1988).
  2. Vanheebrossollet, C., et al. A Natural Antisense Rna Derived from the Hiv-1 Env Gene Encodes a Protein Which Is Recognized by Circulating Antibodies of Hiv+ Individuals. Virology. 206, (1), 196-202 (1995).
  3. Briquet, S., Vaquero, C. Immunolocalization studies of an antisense protein in HIV-1-infected cells and viral particles. Virology. 292, (2), 177-184 (2002).
  4. Clerc, I., et al. Polarized expression of the membrane ASP protein derived from HIV-1 antisense transcription in T cells. Retrovirology. 8, 74 (2011).
  5. Landry, S., et al. Detection, characterization and regulation of antisense transcripts in HIV-1. Retrovirology. 4, 71 (2007).
  6. Kobayashi-Ishihara, M., et al. HIV-1-encoded antisense RNA suppresses viral replication for a prolonged period. Retrovirology. 9, 38 (2012).
  7. Barbagallo, M. S., Birch, K. E., Deacon, N. J., Mosse, J. A. Potential control of human immunodeficiency virus type 1 asp expression by alternative splicing in the upstream untranslated region. DNA Cell Biol. 31, (7), 1303-1313 (2012).
  8. Laverdure, S., et al. HIV-1 Antisense Transcription Is Preferentially Activated in Primary Monocyte-Derived Cells. Journal of Virology. 86, (24), 13785-13789 (2012).
  9. Zapata, J. C., et al. The Human Immunodeficiency Virus 1 ASP RNA promotes viral latency by recruiting the Polycomb Repressor Complex 2 and promoting nucleosome assembly. Virology. 506, 34-44 (2017).
  10. Haist, K., Ziegler, C., Botten, J. Strand-Specific Quantitative Reverse Transcription-Polymerase Chain Reaction Assay for Measurement of Arenavirus Genomic and Antigenomic RNAs. PLoS One. 10, (5), 0120043 (2015).
  11. Lerat, H., et al. Specific detection of hepatitis C virus minus strand RNA in hematopoietic cells. The Journal of Clinical Investigation. 97, (3), 845-851 (1996).
  12. Tuiskunen, A., et al. Self-priming of reverse transcriptase impairs strand-specific detection of dengue virus RNA. J Gen Virol. 91, Pt 4 1019-1027 (2010).
  13. Mancarella, A., et al. Detection of antisense protein (ASP) RNA transcripts in individuals infected with human immunodeficiency virus type 1 (HIV-1). Journal of General Virology. (2019).
  14. Peyrefitte, C. N., Pastorino, B., Bessaud, M., Tolou, H. J., Couissinier-Paris, P. Evidence for in vitro falsely-primed cDNAs that prevent specific detection of virus negative strand RNAs in dengue-infected cells: improvement by tagged RT-PCR. J Virol Methods. 113, (1), 19-28 (2003).
  15. Boncristiani, H. F., Di Prisco, G., Pettis, J. S., Hamilton, M., Chen, Y. P. Molecular approaches to the analysis of deformed wing virus replication and pathogenesis in the honey bee, Apis mellifera. Virol J. 6, 221 (2009).
  16. Boncristiani, H. F., Rossi, R. D., Criado, M. F., Furtado, F. M., Arruda, E. Magnetic purification of biotinylated cDNA removes false priming and ensures strand-specificity of RT-PCR for enteroviral RNAs. J Virol Methods. 161, (1), 147-153 (2009).
  17. Craggs, J. K., Ball, J. K., Thomson, B. J., Irving, W. L., Grabowska, A. M. Development of a strand-specific RT-PCR based assay to detect the replicative form of hepatitis C virus RNA. J Virol Methods. 94, (1-2), 111-120 (2001).
  18. Barbeau, B., Mesnard, J. M. Making sense out of antisense transcription in human T-cell lymphotropic viruses (HTLVs). Viruses. 3, (5), 456-468 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics