Detección de transcripciones de ARN de proteína antisentido (VIH-1) de proteína antisentido (VIH-1) en pacientes por RT-PCR específico de Hebra

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Las horquillas y bucles de ARN pueden funcionar como imprimaciones para la transcripción inversa (RT) en ausencia de imprimaciones específicas de secuencia, interfiriendo con el estudio de transcripciones antisentido superpuestas. Hemos desarrollado una técnica capaz de identificar el ARN específico de las hebras, y lo hemos utilizado para estudiar la proteína antisentido VIH-1 ASP.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Mancarella, A., Procopio, F. A., Achsel, T., De Crignis, E., Foley, B. T., Corradin, G., Bagni, C., Pantaleo, G., Graziosi, C. Detection of Human Immunodeficiency Virus Type 1 (HIV-1) Antisense Protein (ASP) RNA Transcripts in Patients by Strand-Specific RT-PCR. J. Vis. Exp. (153), e60511, doi:10.3791/60511 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

En retrovirus, la transcripción del antisentido se ha descrito tanto en el virus de inmunodeficiencia humana tipo 1 (VIH-1) como en el virus t-linfotrópico humano 1 (HTLV-1). En HIV-1, el gen ASP de proteína antisentido se encuentra en la cadena negativa de env, en el marco de lectura -2, que abarca la unión gp120/gp41. En la orientación del sentido, el extremo de 3' del marco de lectura abierto ASP se superpone con las regiones hipervariables gp120 V4 y V5. El estudio del ARN ASP se ha visto frustrado por un fenómeno conocido como RT-autocebado, por el que las estructuras secundarias de ARN tienen la capacidad de primar RT en ausencia de la imprimación específica, generando cDNAs no específicos. El uso combinado de alta desnaturalización de ARN con imprimaciones inversas biotiniadas en la reacción RT, junto con la purificación de afinidad del ADNc sobre cuentas magnéticas recubiertas de estreptavidina, nos ha permitido amplificar selectivamente el ARN ASP en células T CD4+ derivadas de individuos infectados con VIH-1. Nuestro método es relativamente bajo costo, fácil de realizar, altamente confiable y fácilmente reproducible. En este sentido, representa una poderosa herramienta para el estudio de la transcripción antisentido no sólo en el VIH-1, sino también en otros sistemas biológicos.

Introduction

El gen de la proteína antisentido (ASP) es un marco de lectura abierto (ORF) situado en la cadena negativa del gen de sobre de virus de inmunodeficiencia humana tipo 1 (VIH-1), que abarca la unión gp120/gp411. En los últimos 30 años, varios informes han demostrado que el gen del VIH ASP es de hecho transcrito y traducido2,3,4,5,6,7,8,9. Aunque las transcripciones antisentido ASP se han caracterizado completamente in vitro,hasta hace poco faltaba información sobre la producción real de ARN ASP en pacientes.

La secuencia de ASP es inversa y complementaria a env. Esto representa un obstáculo importante al intentar detectar transcripciones para ASP. Los métodos estándar de reacción en cadena de transcripción inversa-polimerasa (RT-PCR) utilizan imprimaciones antisentidos específicas genéticas para sintetizar los ADN complementarios (CNNAs) de la polaridad derecha. Este enfoque, sin embargo, no permite determinar la orientación (sentido o antisentido) de la plantilla inicial de ARN, ya que las horquillas o bucles de ARN pueden preparar RT en ambas direcciones en ausencia de imprimaciones10,un fenómeno conocido como autocebado RT. La mayoría de los investigadores de ASP desvían el problema de la autocebación RT utilizando imprimaciones etiquetadas con secuencias que no están relacionadas con HIV-111,12. Esta estrategia, sin embargo, no elimina la ocurrencia del fenómeno, y puede conducir a la posible prórroga de los CDNa no específicos en el PCR11.

Recientemente hemos desarrollado un nuevo ensayo RT-PCR específico de hebra para el estudio del ARN antisentido y lo hemos utilizado para la detección de ARN ASP en una cohorte de seis pacientes infectados por el VIH, como se muestra en la Tabla 1. El procedimiento descrito a continuación ha sido publicado previamente por Antonio Mancarella et al.13. En nuestro protocolo, evitamos la producción de CDNA no específicos mediante un enfoque dual. En primer lugar, eliminamos las estructuras secundarias de ARN desnaturalizando el ARN a alta temperatura (94 oC) y, en segundo lugar, invertimos el ARN ASP mediante una imprimación biotinilada específica de ASP y purificamos la afinidad del ADNC resultante. Con este enfoque, somos capaces de amplificar sólo nuestro ADNc objetivo, ya que se impide que otros productos RT no específicos se generen (desnaturalización a alta temperatura del ARN) o se eliminen antes de la PCR (purificación de afinidad).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Este estudio fue aprobado por la Junta de Revisión Institucional del Centro Hospitalario Universitario Vaudois (CHUV).

1. Infección de células mononucleares de sangre periférica (PPBCM) con cepaVIH-1 HXB2

  1. Día 1: ESTIMULACION DE PBMCs
    1. Aísle los PBL de un abrigo buffy de donante saludable.
    2. Contar y resuspender pbMUCs a una concentración de 1x106/ml en el medio completo Roswell Park Memorial Institute (RPMI) 1640 que contiene 10% de suero bovino fetal (FBS) y 1% de penicilina/estreptomicina (R-10), con adición de 50 U/ml de interleucina-2 (IL-2) y 3-g/mL fitohahina(PHAglutin).
    3. Pipet hacia arriba y hacia abajo y divida las células en dos placas de seis pocillos (3 ml de suspensión/pozo de la célula).
    4. Incubar durante 3 días a 37oC y 5% CO2.
  2. Día 3: INFECCIÓN POR PBMCs
    NOTA: Utilice una de las dos placas como en el paso 1.1.3 como control negativo (no infecte estas células).
    ADVERTENCIA: Realizar todo el procedimiento en un laboratorio de nivel III de bioseguridad (P3).
    1. Piscina PBMCs de una placa en un tubo de halcón de 50 ml y centrífuga a 300 x g durante 10 min.
    2. Deseche el sobrenadante y resuspenda las células en 2,2 ml de R-10 que contengan 20 U/ml de IL-2 y 2 g/ml de polibreno.
    3. Viales de descongelación que contengan el virusVIH-1 HXB2 y añada 1,8 ml de suspensión viral (0,376 ng/L) a las células.
    4. Incubar las células durante 2 h a 37 oC, girando suavemente el tubo cada 30 minutos.
    5. Centrifugar las células a 300 x g durante 10 min.
    6. Deseche el sobrenadante y resuspenda las células a 1x106/mL en R-10 que contiene IL-2 (50 U/mL).
    7. Transfiera la suspensión celular a una placa de 24 pocillos a una concentración de 1 ml/pozo e incubar durante 5 días a 37oC y 5%CO2.
    8. Cosecha 1 pozo cada día y transfiere las células al tubo de 1,5 ml (etiquetado con el día de la infección).
      NOTA: Antes de la centrifugación, transfiera 150 ml de suspensión celular a un tubo de citometría de flujo para el control de calidad de la infección por PMAC (ver paso 1.3)
    9. Centrifugar los tubos a 400 x g durante 10 min y desechar el sobrenadante.
    10. Congele los gránulos celulares a -80 oC hasta su uso.
  3. Infección por PBMCs: control de calidad
    1. Para cada día de infección, recoja 150 ml de PHC infectados y transfiéralos a un tubo de citometría de flujo.
    2. Añadir 1 ml de solución salina con fosfato (PBS) y centrífuga a 400 x g durante 5 min.
    3. Deseche el sobrenadante y agregue 50 ml de PBS que contenga 1 l de tinte vivo/muerto Aqua (previamente diluido 1:10 con PBS).
    4. Incubar a 4oC durante 15 min.
    5. Añadir 1 ml de PBS, centrífuga a 400 x g durante 5 min, y desechar el sobrenadante.
    6. Añadir 250 s de solución de fijación/permeabilización e incubar durante 20 minutos a temperatura ambiente en la oscuridad.
    7. Añadir 1 ml de 1x Tampón Perm/Lavado (10x solución en stock que contenga FBS y saponina diluida 1:10) y centrifugar a 400 x g durante 5 min.
    8. Deseche el sobrenadante y agregue 50 l de PBS que contenga el anticuerpo conjugado conistiocianato de fluoresceína (FITC) conoceinato (FITC) conocuente de HIV Gag p24.
    9. Incubar durante 20 min a temperatura ambiente en la oscuridad.
    10. Añadir 1 ml de PBS, centrífuga a 400 x g durante 5 min, y desechar el sobrenadante.
    11. Añadir 150 l de x CellFIX (solución de stock 10x que contiene 10% formaldehído, 3,55% metanol, 0,93% azida sódica diluida 1:10) y analizar las células por citometría de flujo.

2. Estimulación de células T CD4+ humanas con anticuerpos anti-CD3/CD28

  1. Aísle los glóbulos T CD4+ de los PPC de pacientes infectados por el VIH-1 y donantes sanos.
  2. Preparar la mezcla de anticuerpos humanos anti-CD3/CD28 diluyendo anti-CD3 (1:100) y anti-CD28 (1:50) en PBS.
  3. Recubrir una placa de 48 pocillos añadiendo 200 ml de mezcla de anticuerpos por pocto a un número adecuado de pozos e incubar a 37 oC durante 2 horas.
  4. Aspirar la solución de anticuerpos y añadir 1 ml de células CD4+T a 1x106/mL a los pozos recubiertos con anticuerpos anti-CD3/CD28.
    NOTA: Estimule las células T CD4+ hasta 5 días.

3. Transcripción inversa

NOTA: Para obtener imprimaciones específicas del paciente, el ADN proviral aislado de las células CD4+T de cada paciente se amplificabó utilizando imprimaciones VIH-1HXB2 Pan ASP. Las imprimaciones específicas del paciente se diseñaron utilizando la secuencia proviral interna de las imprimaciones Pan ASP. Todas las imprimaciones y sondas utilizadas en este estudio se enumeran en la Tabla 2.

  1. Aislar el ARN total de las células
    1. Cuantifique el ARN y elimine la contaminación del ADN mediante el tratamiento de muestras con DNase.
    2. Realizar reacciones RT en un volumen de 50 l. Transfiera 0,1-1 ág de ARN total a un número apropiado de pozos de una placa PCR de 96 pocillos. Prepare la mezcla de ARN añadiendo los siguientes componentes al ARN:
      5 l de imprimación inversa ASP biotinylatada (20 m)
      2,5 l de trifosfatos de desoxinucleótido (dNTP) (10 mM)
      25 l de agua destilada tratada con dietlpirpirinato (DEPC) (dH2O).
      Preparar los controles ENDógenos de RT añadiendo 5 l de agua libre de nucleasas en lugar de la imprimación inversa ASP biotinilada.
    3. Coloque la placa PCR de 96 pocillos en un termociclador y caliente la mezcla de ARN a 94 oC durante 5 min.
    4. Enfriar inmediatamente la mezcla de ARN en agua helada durante al menos 1 min.
    5. Prepare la mezcla de reacción añadiendo los siguientes componentes a un tubo de 1,5 ml (calcule el número total de muestras más 1):
      10 l de búfer RT de 5x
      2,5 l de 0,1 M de 1,4 ditiothreitol (TDT)
      2,5 l de RNase (40 unidades/L)
      2,5 l de enzima RT (200 unidades/L)
    6. Transfiera 17,5 l de esta mezcla a cada uno de los pozos que contienen ARN. Prepare los controles RT-menos reemplazando la transcriptasa inversa por 2,5 l de agua libre de nucleasas.
    7. Mezcle suavemente e incubar la placa a 55 oC durante 60 minutos utilizando un termociclador.
    8. Inactivar las reacciones calentando a 70oC durante 15 min.

4. Purificación de afinidad de ADNC biotinilado ASP

NOTA: No purifique las reacciones RT menos.

  1. Preparar 1 L de 2tampón de lavado/unión que contenga 10 mM Tris-HCl (pH 7.5), 1 mM de ácido etilendiaminetetraacético (EDTA) y 2 M NaCl. Filtre la solución.
    1. Prepare 50 ml de 1 búfer de lavado/unión con agua de grado PCR.
    2. Para cada reacción, utilice 10 ml de perlas magnéticas conjugadas con estreptavidina. En función del número de reacciones, transfiera un volumen adecuado de perlas a un tubo de 1,5 ml.
    3. Lave las perlas añadiendo un volumen igual de 2x tampón de lavado/unión y vórtice durante 15 s.
    4. Coloque el tubo en un estante de separación magnética e incubar durante 3 minutos a temperatura ambiente.
    5. Retire con cuidado el sobrenadante sin alterar las perlas y agregue el mismo volumen de lavado/unión 2x tampón que el volumen inicial de cuentas.
    6. Vortex para 30 s y transferir 10 l de la suspensión de perlas a un número adecuado de tubos de 1,5 ml.
    7. Coloque los tubos en un estante de separación magnética e incubar durante 3 minutos a temperatura ambiente.
    8. Deseche el sobrenadante y agregue 50 s de tampón 2x de lavado/unión.
    9. Añadir 50 l de ADNc biotinilado a los tubos correspondientes que contengan las perlas.
    10. Incubar durante 30 minutos a temperatura ambiente girando suavemente.
    11. Separe las perlas del sobrenadante por un estante de separación de imán durante 3 minutos a temperatura ambiente.
    12. Lave las perlas añadiendo 200 s de 1 tampón de lavado/unión. Coloque los tubos en un estante de separación de imanes durante 3 minutos a temperatura ambiente y deseche el sobrenadante. Repita dos veces.
    13. Resuspenda las perlas en 10 l de agua de grado PCR.

5. PCR estándar

NOTA: El objetivo de la PCR estándar es amplificar todo el ORF del gen ASP. A continuación, los productos de amplificación se clonan en plásmido pCR2.1 para desarrollar curvas estándar para la cuantificación de ARN ASP mediante PCR en tiempo real (véase el párrafo PCR en tiempo real).

  1. Realizar PCR estándar en un volumen total de 50 l. Preparar un volumen apropiado de mezcla maestra de PCR (número de muestras más 1). Para cada muestra, añada los siguientes componentes a un tubo de 1,5 ml:
    1 l de imprimaciones ASP de 10 m (adelante y atrás)
    1 L de 10 mM de dNtPs
    Cloruro de magnesio (MgCl2) (la concentración depende de las imprimaciones utilizadas)
    dH2O a un volumen final de 49 l
    1. Mezcle bien, gire rápidamente el contenido y transfiera 49 l/bien de la mezcla maestra de PCR a una placa PCR de 96 pocillos.
    2. Vórtice cuidadosamente los tubos que contienen las perlas utilizadas para la purificación de afinidad ASP cDNA para 15 s.
    3. Añadir 1 l de perlas en los pozos correspondientes y ejecutar la PCR utilizando el siguiente programa: 95 oC durante 2 min, 40 ciclos de 95 oC para 30 s, 55 oC para 30 s, y 68 oC para 40 s, luego 68 oC durante 7 min.
    4. Separe los productos pcR en un gel de agarosa del 1 %, corte las bandas y clone los productos amplificados en plásmido pCR2.1.
    5. Secuenciar y analizar las secuencias de cada clon.

6. PCR cuantitativo en tiempo real (qPCR)

NOTA: Desarrolle imprimaciones y sondas específicas para cada paciente utilizando el enfoque descrito en el paso 3 "Transcripción inversa". Para qPCR incluir diluciones de plásmido ASP para curvas estándar. Los plásmidos que contienen plaquitas específicas para el paciente se desarrollan como se menciona en la nota al comienzo del paso 5 "PCR estándar".

  1. Prepare la curva estándar utilizando diluciones seriales de plásmido 1:10 ASP a partir de 3 x 106 copias/ l hasta 3 copias/ L.
    1. PCR de primera ronda (preamplificador). Realizar reacciones en un volumen total de 25 l. Preparar un volumen adecuado de mezcla maestra de PCR (número de muestras más 1). Para cada muestra, añada los siguientes componentes a un tubo de 1,5 ml:
      0,5 l de mezcla de imprimación DE ASP o env (concentración final de 0,2 m cada una) (adelante y atrás)
      0,5 l de mezcla de dNTP (concentración final 0,2 mM cada uno)
      MgCl2 (la concentración depende de los pares de imprimación)
      dH2O a un volumen final de 24 l
    2. Transfiera 24 l de mezcla maestra de PCR a un número adecuado de pozos de una placa PCR de 96 pocillos.
    3. Reórse cuidadosamente los tubos que contienen las perlas con el ADNc durante 15 s.
    4. Añadir 1 l de perlas a los pozos correspondientes. Haga lo mismo con las diluciones de plásmido.
    5. Ejecute el PCR utilizando el siguiente algoritmo: desnaturalización durante 2 min a 95 oC ; 30 s a 95oC, 30 s a 55oC, 40 s a 68oC para 18 ciclos; extensión a 68 oC durante 7 min.
    6. Diluir las reacciones de los PRIMEROS PCR 1:5 con agua de grado PCR.
    7. Segunda ronda qPCR. Realizar reacciones en un volumen total de 20 l. Preparar un volumen adecuado de mezcla maestra de PCR (número de muestras más 1). Para cada muestra, añada los siguientes componentes a un tubo de 1,5 ml:
      1.8 imprimaciones de 1,8 M 10 m (adelante y atrás)
      1 l de sonda de 5 m
      6,2 l de dH2O
    8. Transfiera 19 l de mezcla maestra qPCR a un número apropiado de pozos de una placa qPCR de 96 pocillos y agregue 1 l de las reacciones de PCR de primera ronda diluidas a los pozos correspondientes. Haga lo mismo con las diluciones de plásmido.
    9. Ejecuta el qPCR con el siguiente algoritmo: desnaturalización durante 10 min a 95 oC; 15 s a 95oC, 1 min a 60oC durante 40 ciclos.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

La desnaturalización del ARN a alta temperatura acoplada a la purificación de afinidad de ADNc biotintilado evita la amplificación de productos ASP no específicos durante la PCR en PPBPc infectados in vitro y en células T CD4+ aisladas de pacientes. Se ha demostrado que el autocebado RT se produce durante la transcripción inversa de los ARN antisentido10,14,15,16,17. Para prevenir este fenómeno, desarrollamos un enfoque novedoso utilizando la técnica descrita originalmente por Heist et al.10. Nuestro procedimiento implica la desnaturalización a alta temperatura del ARN antes de RT y el uso de imprimaciones biotinyladas para realizar RT, seguida según la purificación de afinidad de los CDNa biotinilados en perlas magnéticas recubiertas con estreptavidina13. Los cDNA obtenidos por este método se pueden utilizar para aplicaciones posteriores, incluyendo PCR estándar o qPCR.

Las condiciones experimentales para la transcripción antisentido se probaron por primera vez en pBB de un donante sano infectado in vitro con VIH-1HXB2,la secuencia de referencia para vih-1 subtipo B (todos nuestros pacientes están infectados con aislados de este subtipo). La Tabla 2 muestra las secuencias de imprimaciones y sondas utilizadas en este estudio. Nuestras reacciones iniciales de RT se realizaron utilizando una imprimación antisentido regular, no biotinilada (ASP R1) y resultaron en la amplificación exitosa de ASP (par de imprimación ASP F1-R1)(Figura 1A,Carriles 1 - 3). Sin embargo, con este enfoque, también amplificamos una banda del mismo peso molecular en los controles de reacciones de imprimación menos RT (Carriles 4 - 6). La falta total de señal en nuestros controles negativos (carriles 7 - 8) indicaba que la plantilla no específica provenía de la reacción RT y no de la contaminación cruzada de muestras.

Para evitar el problema creado por RT autocebado, decidimos utilizar un método descrito previamente por Haist et al.10, en el que la imprimación antisentido específica está etiquetada con biotina para que el ADNC biotintado resultante correspondiente a la orientación antisentido pueda purificarse antes de la PCR y amplificarse selectivamente. Mediante este enfoque, pudimos amplificar la secuencia ASP(Figura 1B,Carriles 1 - 3) con una contaminación muy reducida del ADNc no específico en los controles de imprimación menos(Figura 1B,Carriles 4-6).

La optimización de este método se logró mediante la desnaturalización completa del ARN antes de RT a 94 oC, seguida de un enfriamiento inmediato sobre el agua helada. Como se muestra en la Figura 2A,B, la banda ASP se amplifica eficazmente, mientras que los productos no específicos han desaparecido.

El ARN ASP se detecta en células T CD4+ de pacientes con viremia detectable y en ausencia de tratamiento, tras la estimulación con anti-CD3/CD28. El ARN ASP era indetectable en PBL no fraccionados o en células T CD4+ no estimuladas aisladas de pacientes con VIH (datos no mostrados). Sin embargo, podría detectarse fácilmente en células CD4 aisladas de tres sujetos VIH positivos, MP135, MP140 y MP148(Tabla 1),siguiendo la estimulación con anti-CD3/CD28. La cinética de la expresión de ARN ASP medida por qPCR en estos tres pacientes se muestra en la Figura 3.

Las células CD4 aisladas de pacientes sometidos a TAR y con viremia no detectable, pueden producir pequeñas cantidades de ARN ASP cuando se estimulan con anti-CD3/CD28. La cuantificación de los niveles de ARN ASP en dos de estos pacientes (MP071, MP146) por qPCR muestra que en estas condiciones el ARN ASP se detecta en niveles bajos (10-15 copias/millones de células T CD4+) a los 3-5 días posteriores a la estimulación(Figura 4). En un paciente, sin embargo (MP069), no se pudo detectar ARN ASP en ningún momento (datos no mostrados).

Los ARN ASP y env tienen patrones de expresión similares en un paciente no tratado con viremia detectable (MP140). Se analizaron dos pacientes, uno no tratado (MP140) y otro tratado (MP146). En MP140 pudimos detectar tanto ASP como env. Aunque sus niveles de transcripción eran diferentes(Figura 5A),la curva de expresión de estos dos genes a lo largo del tiempo era idéntica, que se puede visualizar trazando datos en una escala logarítmica(Figura 5B). En el paciente MP146, que fue tratado y cuya viremia estaba por debajo de los niveles de detección, ASP y env apenas fueron detectables y sólo después de varios días de estimulación(Figura 5C).

Figure 1
Figura 1: Expresión de ARN ASP en PMAC de un individuo VIH negativo infectado in vitro con VIH-1HXB2 por RT-PCR estándar y modificado. (A) Detección de ARN ASP utilizando RT-PCR estándar. ASP se amplifica a partir de cDNA sintetizado en presencia de la no biotinicada ASP-específica antisentido primer ASP R1 (Carriles 1–3). La misma banda también se encuentra en los controles RT de imprimación menos (Carriles 4–6). (B) Visualización del ARN ASP mediante biotinylación de la imprimación antisentido y la purificación del ADNc (carriles 1-3). Todavía se detecta una banda de intensidad disminuida en los controles de imprimación menos (carriles 4–6). No hay bandas presentes en los controles negativos. Publicado anteriormente en el artículo "Detection of antisense protein (ASP) RNA transcripts in individuales infectados con virus de inmunodeficiencia humana tipo 1 (VIH-1)", por Mancarella et al.13 (J Gen Virol 100(5):863-876. doi: 10.1099/jgv.0.001244). Haga clic aquí para ver una versión más grande de esta figura.

Figure 2
Figura 2: El ARN ASP se expresa en pMBCs de un individuo VIH negativo después de la infección por VIH-1HXB2. (A) La banda ASP es arna fácilmente detectado que ha sido completamente desnaturalizado y transcrito inversamente utilizando la imprimación RT biotinilada (ASP R1) (carriles 1–3) pero no en el ADNC purificado de los controles de imprimación menos (carriles 4–6). (B) No se detecta ninguna señal correspondiente a ASP en los controles RT-menos de ARN de pBL infectados, PBL no infectados o agua, aunque una banda clara es visible en el control positivo de la mordaza de las células ACH-2. Publicado anteriormente en el artículo "Detection of antisense protein (ASP) RNA transcripts in individuales infectados con virus de inmunodeficiencia humana tipo 1 (VIH-1)", por Mancarella et al.13 (J Gen Virol 100(5):863-876. doi: 10.1099/jgv.0.001244). Haga clic aquí para ver una versión más grande de esta figura.

Figure 3
Figura 3: En células T CD4+ estimuladas por el anti-CD3/CD28 aisladas de tres pacientes no tratados, la producción de ARN ASP es fácilmente detectable y alcanza picos entre los días 2 y 4 después de la estimulación. En MP135 y MP140, la expresión de ASP alcanzó su punto máximo en el día 4 después de la estimulación, mientras que en MP148 alcanzó su punto máximo en el día 2. Los niveles de ASP se expresan como copias de ARN/millones de células T CD4+. Los puntos en el curso de tiempo corresponden al valor medio de las reacciones pcR triplicados. Publicado anteriormente en el artículo "Detection of antisense protein (ASP) RNA transcripts in individuales infectados con virus de inmunodeficiencia humana tipo 1 (VIH-1)", por Mancarella et al.13 (J Gen Virol 100(5):863-876. doi: 10.1099/jgv.0.001244). Haga clic aquí para ver una versión más grande de esta figura.

Figure 4
Figura 4: En dos pacientes aviares sometidos a TAR, la ASP apenas es detectable después de unos días de estimulación. En ambos pacientes, ASP no se pudo detectar en el día 0. En el paciente MP071, se podían detectar niveles bajos de ASP en el día 3, mientras que en el paciente MP146, tuvimos que esperar hasta el día 5 para ver algunos niveles de ARN. Los niveles de ASP se expresan como copias de ARN/millones de células T CD4+. Los puntos en el curso de tiempo corresponden al valor medio de las reacciones pcR triplicados. Publicado anteriormente en el artículo "Detection of antisense protein (ASP) RNA transcripts in individuales infectados con virus de inmunodeficiencia humana tipo 1 (VIH-1)", por Mancarella et al.13 (J Gen Virol 100(5):863-876. doi: 10.1099/jgv.0.001244). Haga clic aquí para ver una versión más grande de esta figura.

Figure 5
Figura 5: Expresión de ASP y env en células T CD4+ estimuladas por el CD4+anti-CD3/CD28 en pacientes tratados (MP146) y no tratados (MP140). (A) En el paciente no tratado (MP140), el env se expresa en niveles más altos que asp; (B) Los mismos datos trazados en una escala logarítmica muestran que la expresión ASP y env se caracterizan por un perfil similar a tiempo; (C) Cinética de expresión de ASP y env en un paciente con viremia indetectable y sometido a ART (MP146). Publicado anteriormente en el artículo "Detection of antisense protein (ASP) RNA transcripts in individuales infectados con virus de inmunodeficiencia humana tipo 1 (VIH-1)", por Mancarella et al.13 (J Gen Virol 100(5):863-876. doi: 10.1099/jgv.0.001244). Haga clic aquí para ver una versión más grande de esta figura.

Identificación del paciente Edad Sexo Etapa de la infección por el VIH Clade Carga viral (copias/ml) Recuento de CD4 (células/l) Estado ART
MP135 44 M C3 B 1.6x105 176 Untreated
MP140 23 M A2 B 3.6x104 427 Untreated
MP148 37 M A1 B 2.0x104 717 Untreated
MP069 42 M A1 B <20 1309 Tratado
MP071 47 M C3 B <20 167 Tratado
MP146 59 M C3 B <20 385 Tratado

Tabla 1: Características de los pacientes. Publicado anteriormente en el artículo "Detection of antisense protein (ASP) RNA transcripts in individuales infectados con virus de inmunodeficiencia humana tipo 1 (VIH-1)", por Mancarella et al.13 (J Gen Virol 100(5):863-876. doi: 10.1099/jgv.0.001244).

Nombre de la primera/sonda Secuencia de imprimación (5' a 3')
ASP F1 TTAGGAGTAGCACCCACCAA
ASP R1 GAACCCAAGGAACaAAGCTC
PAN ASP F ACCAAGCCTCCCTACTATCATTATG
PAN ASP R GCACATTGTAACATTAGTAGAGCA
ASP MP135, 146, 071 F CCCAAGAACCCAAGGAACATAG
ASP MP135, 146, 071 R CATTAGGAATAGCACCCACCAA
ASP MP135, 146, 071 Sonda FAM/TAMRA TCTCTCTGCACCCTCTCTCTTTTGCC
ASP MP140 F CCCATAGTGCTTCCTGCTATTC
ASP MP140 R AGAAGAGTGGTGCAGAGAGA
Sonda ASP MP140 FAM/TAMRA AGCTCCTATTGTTCCCACTGCTCT
ASP MP148 F CTCTCTCTGCACCCTCTTCTTTTT
ASP MP148 R AGACCTGGAGGAGGAGATATG
Sonda ASP MP148 FAM/TAMRA TGGTGGGTGCTACTCCTAATGGTT
ENV MP140 F AGAAGAGTGGTGCAGAGAGA
ENV MP140 R CCCATAGTGCTTCCTGCTATTC
Sonda ENV MP140 FAM/TAMRA AGCTCCTATTGTTCCCACTGCTCT
ENV MP146 F CATTAGGAATAGCACCCACCAA
ENV MP146 R CCCAAGAACCCAAGGAACATAG
Sonda ENV MP146 FAM/TAMRA TCTCTCTGCACCCTCTCTCTTTTGCC

Tabla 2: Imprimaciones y sondas RT-PCR

Subscription Required. Please recommend JoVE to your librarian.

Discussion

En este informe describimos un ensayo RT específico de hebra aplicado a la detección de ARN ASP en células T CD4+ aisladas de individuos infectados con VIH-1. La aparición de cebado no específico durante RT dificulta la detección de transcripciones de ARN con la polaridad derecha, lo que lleva a una interpretación errónea de los resultados. Grupos anteriores han desarrollado varias estrategias destinadas a prevenir la síntesis de ADNc independiente de imprimación durante la reacción RT. Etiquetar la imprimación inversa en el extremo 3' con secuencias no relacionadas con el VIH ha demostrado ser eficaz para lograr la amplificación específica de las hebras6,8,9. Sin embargo, este enfoque sólo permite hacer que el ADNC falsamente cebado sea indetectable en lugar de evitarlo, con el riesgo de que se filtre en la reacción de PCR, causando amplificación de productos de ADN no específicos (es decir, env en lugar de ASP).

Nuestros intentos iniciales de RT-PCR para detectar el ARN ASP se realizaron utilizando una imprimación antisentido estándar. Las amplificaciones fueron exitosas, ya que obtuvimos bandas del peso molecular adecuado, pero las bandas del mismo tamaño también estaban presentes en nuestros controles de imprimación menos. Basándonos en estos resultados, utilizamos un enfoque diferente, realizando RT con una imprimación antisentido específica biotinylated, como se describe en Haist et al.10. Aunque nuestros experimentos preliminares dieron lugar a una drástica disminución del autocebado RT, no pudimos eliminar completamente productos específicos de amplificación. Haist y compañeros de trabajo eliminan productos de ADNc no específicos lavando las cuentas en condiciones de alta rigel10. En nuestro método, eliminamos completamente la fuente de autocebado en forma de estructuras secundarias de ARN utilizando altas temperaturas de desnaturalización para linealizar completamente la plantilla de ARN.

Demostramos que el ARN ASP se expresa en linfocitos T CD4+ estimulados por cd3/CD28. La detección de ASP, sin embargo, no se puede lograr en las células en ausencia de estimulación. Nuestros datos son algo diferentes de los de Zapata y sus compañeros de trabajo, que han notificado la expresión de bajos niveles de ASP en células CD4+ en reposo aisladas de pacientes sometidos a ART9. Sobre la base de estos resultados, proponen que el ARN ASP pueda desempeñar un papel en la regulación de la latencia del VIH. Nuestro hallazgo de que en el mismo individuo la cinética de expresión de ASP y env se caracterizan por el mismo perfil no es consistente con el modelo9de Zapata. De hecho, si realmente ASP participó en la regulación de la latencia, su perfil de expresión debe ser opuesto al observado para env18.

También observamos que los niveles de transcripción de env son más de 2 registros más altos que los de ASP, al menos en pacientes en ausencia de terapia. Estos datos están de acuerdo con los estudios de Laverdure et al.8 que muestran que en las células CD4+ primarias infectadas in vitro, la transcripción antisentido LTR de 3' es mucho menor (hasta 1000 veces) que la transcripción de sentido de 5'. Nuestros resultados indican que la ASP se expresa en linfocitos CD4 infectados independientemente de la etapa de la enfermedad, siempre y cuando las células se estimulen adecuadamente. Además, nuestros datos demuestran que la ASP se expresa en células de pacientes sometidos a tratamiento antirretroático, aunque el nivel de expresión en estas células es menor que en las células de los pacientes en ausencia de tratamiento.

En resumen, sugerimos un ensayo RT específico de la hebra fiable destinado a prevenir la síntesis de ADNc independiente de la imprimación. ASP y env son dos genes que se superponen entre sí en orientación opuesta, una característica que hace que su estudio sea muy difícil. Nuestro enfoque, que permite capturar selectivamente cDNAs retrotranscritos del ARN con polaridad negativa y positiva, representa una herramienta óptima y eficaz para el estudio de estos dos genes en particular, y los genes que se superponen en su antisentido orientación en general.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores declaran que no hay conflictos de intereses.

Acknowledgments

Agradecemos a Patrizia Amelio, Alessandra Noto, Craig Fenwick y Matthieu Perreau por estar siempre disponibles para discutir nuestro trabajo y todas las personas en el Laboratorio de Inmunopatógenos del SIDA por su valiosa asistencia técnica. También nos gustaría dar las gracias a John y Aaron Weddle de VSB Associated Inc. que contribuyeron con excelentes obras de arte. Por último, muchas gracias especiales a todos los pacientes, sin los cuales este trabajo no habría sido posible. Este trabajo no recibió ninguna subvención específica de ninguna agencia de financiación.

Materials

Name Company Catalog Number Comments
BD LSR II Becton Dickinson
BigDye Terminator v1.1 Cycle Sequencing Kit Applied Biosystem, Thermo Fisher Scientific 4337450
dNTP Set (100 mM) Invitrogen, Thermo Fisher Scientific 10297018
Dynabeads M-280 Streptavidin Invitrogen, Thermo Fisher Scientific 11205D
EasySep Human CD4+ T Cell Isolation Kit Stemcell Technologies 19052
Fetal Bovine Serum Biowest S1010-500
Fixation/Permeabilization Solution Kit Becton Dickinson 554714
HIV Gag p24 flow cytometry antibody - Kc57-FITC Beckman Coulter 6604665
Human IL-2 Miltenyi Biotec 130-097-743
Lectin from Phaseolus vulgaris (PHA) Sigma-Aldrich 61764-1MG
LIVE/DEAD Fixable Yellow Dead Cell Stain Kit, for 405 nm excitation Invitrogen, Thermo Fisher Scientific L34967
Mouse Anti-Human CD28 Becton Dickinson 55725
Mouse Anti-Human CD3 Becton Dickinson 55329
Primers and Probes Integrated DNA Technologies (IDT)
Penicillin-Streptomycin BioConcept 4-01F00-H
Platinum Taq DNA Polymerase High Fidelity Invitrogen, Thermo Fisher Scientific 11304011
Polybrene Infection / Transfection Reagent Sigma-Aldrich TR-1003-G
RNeasy Mini Kit Qiagen 74104
Roswell Park Memorial Institute (RPMI) 1640 Medium Gibco, Thermo Fisher Scientific 11875093
StepOnePlus Real-Time PCR System Applied Biosystem, Thermo Fisher Scientific 4376600
SuperScript III Reverse Transcriptase Invitrogen, Thermo Fisher Scientific 18080044
TaqMan Gene Expression Master Mix Applied Biosystem, Thermo Fisher Scientific 4369016
TOPO TA Cloning Kit for Subcloning, with One Shot TOP10 chemically competent E. coli cells Invitrogen, Thermo Fisher Scientific K450001
TURBO DNase (2 U/µL) Invitrogen, Thermo Fisher Scientific AM2238
Veriti Thermal Cycler Applied Biosystem, Thermo Fisher Scientific 4375786

DOWNLOAD MATERIALS LIST

References

  1. Miller, R. H. Human immunodeficiency virus may encode a novel protein on the genomic DNA plus strand. Science. 239, (4846), 1420-1422 (1988).
  2. Vanheebrossollet, C., et al. A Natural Antisense Rna Derived from the Hiv-1 Env Gene Encodes a Protein Which Is Recognized by Circulating Antibodies of Hiv+ Individuals. Virology. 206, (1), 196-202 (1995).
  3. Briquet, S., Vaquero, C. Immunolocalization studies of an antisense protein in HIV-1-infected cells and viral particles. Virology. 292, (2), 177-184 (2002).
  4. Clerc, I., et al. Polarized expression of the membrane ASP protein derived from HIV-1 antisense transcription in T cells. Retrovirology. 8, 74 (2011).
  5. Landry, S., et al. Detection, characterization and regulation of antisense transcripts in HIV-1. Retrovirology. 4, 71 (2007).
  6. Kobayashi-Ishihara, M., et al. HIV-1-encoded antisense RNA suppresses viral replication for a prolonged period. Retrovirology. 9, 38 (2012).
  7. Barbagallo, M. S., Birch, K. E., Deacon, N. J., Mosse, J. A. Potential control of human immunodeficiency virus type 1 asp expression by alternative splicing in the upstream untranslated region. DNA Cell Biol. 31, (7), 1303-1313 (2012).
  8. Laverdure, S., et al. HIV-1 Antisense Transcription Is Preferentially Activated in Primary Monocyte-Derived Cells. Journal of Virology. 86, (24), 13785-13789 (2012).
  9. Zapata, J. C., et al. The Human Immunodeficiency Virus 1 ASP RNA promotes viral latency by recruiting the Polycomb Repressor Complex 2 and promoting nucleosome assembly. Virology. 506, 34-44 (2017).
  10. Haist, K., Ziegler, C., Botten, J. Strand-Specific Quantitative Reverse Transcription-Polymerase Chain Reaction Assay for Measurement of Arenavirus Genomic and Antigenomic RNAs. PLoS One. 10, (5), 0120043 (2015).
  11. Lerat, H., et al. Specific detection of hepatitis C virus minus strand RNA in hematopoietic cells. The Journal of Clinical Investigation. 97, (3), 845-851 (1996).
  12. Tuiskunen, A., et al. Self-priming of reverse transcriptase impairs strand-specific detection of dengue virus RNA. J Gen Virol. 91, Pt 4 1019-1027 (2010).
  13. Mancarella, A., et al. Detection of antisense protein (ASP) RNA transcripts in individuals infected with human immunodeficiency virus type 1 (HIV-1). Journal of General Virology. (2019).
  14. Peyrefitte, C. N., Pastorino, B., Bessaud, M., Tolou, H. J., Couissinier-Paris, P. Evidence for in vitro falsely-primed cDNAs that prevent specific detection of virus negative strand RNAs in dengue-infected cells: improvement by tagged RT-PCR. J Virol Methods. 113, (1), 19-28 (2003).
  15. Boncristiani, H. F., Di Prisco, G., Pettis, J. S., Hamilton, M., Chen, Y. P. Molecular approaches to the analysis of deformed wing virus replication and pathogenesis in the honey bee, Apis mellifera. Virol J. 6, 221 (2009).
  16. Boncristiani, H. F., Rossi, R. D., Criado, M. F., Furtado, F. M., Arruda, E. Magnetic purification of biotinylated cDNA removes false priming and ensures strand-specificity of RT-PCR for enteroviral RNAs. J Virol Methods. 161, (1), 147-153 (2009).
  17. Craggs, J. K., Ball, J. K., Thomson, B. J., Irving, W. L., Grabowska, A. M. Development of a strand-specific RT-PCR based assay to detect the replicative form of hepatitis C virus RNA. J Virol Methods. 94, (1-2), 111-120 (2001).
  18. Barbeau, B., Mesnard, J. M. Making sense out of antisense transcription in human T-cell lymphotropic viruses (HTLVs). Viruses. 3, (5), 456-468 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics