Detectie van humaan immunodeficiëntie virus type 1 (HIV-1) antisense protein (ASP) RNA transcripten bij patiënten door onderdeel-specifieke RT-PCR

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

RNA haarspelden en lussen kunnen fungeren als primers voor reverse transcriptie (RT) bij afwezigheid van sequentie-specifieke primers, interfereren met de studie van overlappende antisense transcripten. We hebben een techniek ontwikkeld die in staat is om streng-specifiek RNA te identificeren, en we hebben het gebruikt om HIV-1 antisense Protein ASP te bestuderen.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Mancarella, A., Procopio, F. A., Achsel, T., De Crignis, E., Foley, B. T., Corradin, G., Bagni, C., Pantaleo, G., Graziosi, C. Detection of Human Immunodeficiency Virus Type 1 (HIV-1) Antisense Protein (ASP) RNA Transcripts in Patients by Strand-Specific RT-PCR. J. Vis. Exp. (153), e60511, doi:10.3791/60511 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Bij retrovirussen is antisense transcriptie beschreven in zowel humaan immunodeficiëntie virus type 1 (HIV-1) als humaan T-lymphotropic virus 1 (HTLV-1). In HIV-1 bevindt het antisense Protein ASP-gen zich op de negatieve streng van env, in het Lees frame-2, dat de kruising gp120/gp41 beslaat. In de zin oriëntatie overlapt het 3 ' einde van het open Lees frame van ASP met gp120 hypervariable-regio's v4 en V5. De studie van ASP-RNA is gedwarslanteerd door een fenomeen dat bekend staat als RT-Self-priming, waarbij RNA-secundaire structuren de mogelijkheid hebben om RT bij afwezigheid van de specifieke primer te prime, waardoor niet-specifieke Cdna's worden gegenereerd. Het gecombineerde gebruik van hoge RNA-denaturatie met biotinyleerd reverse primers in de RT-reactie, samen met affiniteits zuivering van de cDNA op streptavidin gecoate magnetische kralen, heeft ons toegestaan om selectief te versterken ASP-RNA in CD4 + T cellen afgeleid van individuen geïnfecteerd met HIV-1. Onze methode is relatief voordelig, eenvoudig uit te voeren, zeer betrouwbaar en gemakkelijk reproduceerbaar. In dit opzicht vertegenwoordigt het een krachtig hulpmiddel voor de studie van antisense transcriptie, niet alleen in HIV-1, maar ook in andere biologische systemen.

Introduction

Het antisense protein (ASP)-gen is een open Lees frame (ORF) dat zich bevindt op de negatieve streng van het humaan immunodeficiëntie virus type 1 (HIV-1) envelop (env)-gen, dat de kruising gp120/gp411beslaat. In de afgelopen dertig jaar hebben verschillende rapporten aangetoond dat het HIV ASP-gen inderdaad is getranscribeerd en vertaald2,3,4,5,6,7,8,9. Hoewel ASP antisense transcripten volledig in vitrozijn gekarakteriseerd, was tot voor kort nog informatie over de werkelijke productie van ASP-RNA bij patiënten verdwenen.

De opeenvolging van ASP is omgekeerd en complementair aan env. Dit vormt een belangrijk obstakel wanneer u transcripten voor ASP probeert te detecteren. Standaard reverse transcriptie-polymerase chain reaction (RT-PCR) methoden gebruiken genspecifieke antisense primers om complementaire Dna's (Cdna's) van de juiste polariteit te synthetiseren. Deze aanpak staat echter niet toe om de oriëntatie (zin of antisense) van de initiële RNA-template te bepalen, aangezien RNA-haarspelden of lussen in beide richtingen kunnen worden priem bij afwezigheid van primers10, een fenomeen dat bekend staat als RT Self-priming. De meeste ASP-onderzoekers gaan het probleem van RT Self-priming aan met behulp van primers gelabeld met sequenties die niet gerelateerd zijn aan HIV-111,12. Deze strategie elimineert echter niet het optreden van het fenomeen en kan leiden tot een mogelijke overname van niet-specifieke Cdna's in de PCR11.

We hebben onlangs een nieuwe strand-specifieke RT-PCR-test ontwikkeld voor de studie van antisense RNA en we hebben het gebruikt voor ASP-RNA-detectie in een cohort van zes HIV-geïnfecteerde patiënten, zoals weergegeven in tabel 1. De hieronder beschreven procedure is eerder gepubliceerd door Antonio Mancarella et al.13. In ons protocol vermijden we de productie van niet-specifieke Cdna's door een dubbele aanpak. Ten eerste elimineren we RNA-secundaire structuren door denaturerende RNA op hoge temperatuur (94 ° c), en ten tweede, we reverse transcriberen ASP RNA met behulp van een biotinyleerd ASP-specifieke primer en affiniteit-zuiveren van de resulterende cDNA. Door deze aanpak kunnen we alleen onze doel-cDNA versterken, omdat andere niet-specifieke RT-producten worden verhinderd om te worden gegenereerd (denaturatie van hoge temperaturen van RNA) of geëlimineerd vóór PCR (affiniteits zuivering).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Deze studie werd goedgekeurd door de institutioneel beoordelings Raad van het Centre Hospitalier Universitaire Vaudois (CHUV).

1. infectie van perifere bloed mononucleaire cellen (PBMCs) met HIV-1HXB2 stam

  1. Dag 1: PBMCs STIMULATIE
    1. Isoleer PBMCs van een gezonde donateurs Buffy vacht.
    2. Tellen en respenderen PBMCs in een concentratie van 1x106/ml in het complete Roswell Park Memorial Institute (rpmi) 1640 medium dat 10% foetaal runderserum (FBS) en 1% penicillaire/streptomycine (R-10) bevat; met toevoeging van 50 U/ml Interleukine-2 (Il-2) en 3 μg/ml Phytohemagglutinine (PHA).
    3. Pipet op en neer en Splits de cellen in 2 6-well plates (3 mL celsuspensie/well).
    4. Incuberen gedurende 3 dagen bij 37 °C en 5% CO2.
  2. Dag 3: PBMCs-infectie
    Opmerking: gebruik een van de twee platen zoals in stap 1.1.3 als negatieve controle (deze cellen niet infecteren).
    Let op: Voer de gehele procedure uit in een laboratorium voor bioveiligheid niveau III (P3).
    1. Pool PBMCs van de ene plaat in een 50 mL Falcon Tube en centrifugeer bij 300 x g gedurende 10 min.
    2. Gooi het supernatant weg en regeer de cellen in 2,2 mL R-10 bevattende 20 e/mL IL-2 en 2 μg/mL polybrene.
    3. Ontdooien injectieflacons met het HIV-1HXB2 virus en voeg 1,8 ml virale suspensie (0,376 ng/μL) toe aan de cellen.
    4. Inbroed de cellen voor 2 uur bij 37 °C, zachtjes zwenkende de buis elke 30 minuten.
    5. Centrifugeer de cellen gedurende 10 minuten bij 300 x g .
    6. Gooi de supernatant weg en regeer de cellen op 1x106/ml in R-10 met Il-2 (50 U/ml).
    7. Breng de celsuspensie over naar een 24-put-plaat met een concentratie van 1 mL/goed en inbroed gedurende 5 dagen bij 37 °C en 5% CO2.
    8. Oogst elke dag 1 goed en breng de cellen over naar 1,5 mL Tube (gelabeld met de dag van de infectie).
      Opmerking: Breng vóór het centrifugeren 150 μL celsuspensie over naar een Flowcytometrie buis voor PBMCs infectie kwaliteitscontrole (zie stap 1,3)
    9. Centrifugeer de buisjes op 400 x g gedurende 10 minuten en gooi het supernatant weg.
    10. Vries de celpellets bij-80 °C tot gebruik.
  3. PBMCs-infectie: kwaliteitscontrole
    1. Verzamel voor elke dag van besmetting 150 μL geïnfecteerde PBMCs en breng ze over in een Flowcytometrie buis.
    2. Voeg 1 mL fosfaatgebufferde zoutoplossing (PBS) toe en Centrifugeer gedurende 5 minuten bij 400 x g .
    3. Gooi het supernatant weg en voeg 50 μL PBS met 1 μL Aqua Live/Dead Dye (voorheen verdund 1:10 met PBS) toe.
    4. Incuberen bij 4 °C gedurende 15 minuten.
    5. Voeg 1 mL PBS toe, centrifugeer bij 400 x g gedurende 5 minuten en gooi het supernatant weg.
    6. Voeg 250 μL fixatie/Permeabilization oplossing toe en incuberen gedurende 20 minuten bij kamertemperatuur in het donker.
    7. Voeg 1 mL 1x Perm/Wash buffer toe (10x stockoplossing met zowel FBS en saponine verdund 1:10) en centrifugeer bij 400 x g gedurende 5 min.
    8. Gooi het supernatant weg en voeg 50 μL PBS met HIV Gag p24 fluoresceïne isothiocyanaat (FITC)-geconjugeerd antilichaam (verdund 1:10) toe.
    9. Inincuberen gedurende 20 minuten bij kamertemperatuur in het donker.
    10. Voeg 1 mL PBS toe, centrifugeer bij 400 x g gedurende 5 minuten en gooi het supernatant weg.
    11. Voeg 150 μL x CellFIX toe (10x stockoplossing met 10% formaldehyde, 3,55% methanol, 0,93% natrium-natriumazide-verdund 1:10) en analyseer cellen door Flowcytometrie.

2. stimulatie van humane CD4 + T-cellen met anti-CD3/CD28-antilichamen

  1. Isoleer CD4 + T-cellen van PBMCs van zowel HIV-1 geïnfecteerde patiënten als gezonde donoren.
  2. Bereid de humane anti-CD3/CD28 antilichaammix door het verdunen van anti-CD3 (1:100) en anti-CD28 (1:50) in PBS.
  3. Mantel een 48-Wells plaat door toevoeging van 200 μL antilichaammix per putje aan een passend aantal putjes en inincuberen bij 37 °C gedurende 2 uur.
  4. Aspireren de antilichaam oplossing en voeg 1 mL CD4 + T-cellen toe op 1x106/ml aan de anti-CD3/CD28-antilichaam-gecoate putjes.
    Opmerking: stimuleren van CD4 + T-cellen tot 5 dagen.

3. omgekeerde transcriptie

Opmerking: om patiënt-specifieke primers te verkrijgen, werd proviral DNA geïsoleerd uit CD4 + T-cellen van elke patiënt versterkt met behulp van HIV-1HXB2 pan ASP-primers. Patiënt specifieke primers werden ontworpen met behulp van de proviral sequentie intern aan de pan ASP primers. Alle primers en sondes die in deze studie worden gebruikt, staan vermeld in tabel 2.

  1. Isoleren van totaal RNA uit cellen
    1. Kwantiseer RNA en Elimineer DNA-besmetting door monsters te behandelen met DNase.
    2. RT-reacties uitvoeren in een volume van 50 μL. Breng 0,1-1 μg totaal RNA over in een passend aantal putjes van een 96-well PCR-plaat. Bereid het RNA-mengsel door de volgende componenten aan het RNA toe te voegen:
      5 μL biotinyleerd ASP reverse primer (20 μM)
      2,5 μL deoxynucleotide-trifosfaten (Dntp's) (10 mM)
      25 μL diethylpyrocarbonaat (DEPC)-behandeld gedistilleerd water (dH2O).
      Bereid de endogene RT-controles voor door 5 μL Nuclease vrij water toe te voegen in plaats van de biotinyleerd ASP reverse primer.
    3. Plaats de 96 goed PCR-plaat in een thermocycler en verwarm het RNA-mengsel tot 94 °C gedurende 5 minuten.
    4. Onmiddellijk afkoelen van het RNA mengsel in ijskoud water voor ten minste 1 min.
    5. Bereid het reactiemengsel door de volgende componenten toe te voegen aan een tube van 1,5 mL (Bereken het totale aantal monsters plus 1):
      10 μL 5x RT buffer
      2,5 μL 0,1 M, 1,4-dithiothreitol (DTT)
      2,5 μL RNase-uit (40 eenheden/μL)
      2,5 μL RT-enzym (200 eenheden/μL)
    6. Breng 17,5 μL van dit mengsel over in elk van de RNA-bevattende putjes. Bereid de RT-minus Controls ter vervanging van reverse transcriptase met 2,5 μL Nuclease vrij water.
    7. Meng zachtjes en inincuberen de plaat bij 55 °C gedurende 60 minuten met behulp van een Thermocycler.
    8. Inactiveren van de reacties door verwarmen bij 70 °C gedurende 15 minuten.

4. affiniteits zuivering van ASP biotinyleerd cDNA

Opmerking: Reinig de RT-minus reacties niet.

  1. Bereid 1 L 2x was-/bindings buffer met 10 mM tris-HCl (pH 7,5), 1 mM ethyleendiaminetetraazijnzuur (EDTA) en 2 M NaCl. Filter de oplossing.
    1. Bereid 50 mL 1x was-/bindings buffer voor met PCR-grade water.
    2. Gebruik voor elke reactie 10 μL streptavidine-geconjugeerde magnetische kralen. Op basis van het aantal reacties, breng een geschikte hoeveelheid kralen over naar een tube van 1,5 mL.
    3. Was de parels door het toevoegen van een gelijk volume van 2x was/bindende buffer en Vortex voor 15 s.
    4. Plaats de buis in een magnetisch scheidings rek en incuberen gedurende 3 minuten bij kamertemperatuur.
    5. Verwijder voorzichtig de supernatant zonder de kralen te storen en voeg hetzelfde volume wassen/binden 2x buffer als het aanvankelijke volume van kralen.
    6. Vortex voor 30 s en breng 10 μL van de kralen suspensie over naar een geschikt aantal 1,5 mL tubes.
    7. Plaats de buisjes in een magnetisch scheidings rek en inbroed gedurende 3 minuten bij kamertemperatuur.
    8. Gooi het supernatant weg en voeg 50 μL wassen/binden 2x buffer toe.
    9. Voeg 50 μL biotinyleerd cDNA toe aan de overeenkomstige buisjes met de parels.
    10. Inincuberen gedurende 30 minuten bij kamertemperatuur die zachtjes draait.
    11. Scheid de parels van de supernatant door een magneet scheidings rek gedurende 3 minuten bij kamertemperatuur.
    12. Was de parels door toevoeging van 200 μL 1x was-/bindings buffer. Plaats de buisjes in een magneet scheidings rek gedurende 3 minuten bij kamertemperatuur en gooi het supernatant weg. Herhaal dit twee keer.
    13. Rebreng de parels in 10 μL PCR-klasse water.

5. standaard PCR-

NB: het doel van de standaard PCR is de volledige ORF van het ASP-gen te versterken. De versterkings producten worden vervolgens gekloond in pCR 2.1 plasmide om standaard curves te ontwikkelen voor ASP-RNA-kwantificering door real-time PCR (zie paragraaf real time PCR).

  1. Voer standaard PCRs uit in een totaal volume van 50 μL. bereid een geschikt volume PCR Master mix voor (aantal samples plus 1). Voeg voor elk monster de volgende componenten toe aan een tube van 1,5 mL:
    1 μL van 10 μM ASP-primers (vooruit en achteruit)
    1 μL van 10 mM Dntp's
    Magnesium chloride (MgCl2) (concentratie is afhankelijk van de gebruikte primers)
    dH2O tot een eindvolume van 49 μL
    1. Meng goed, draai de inhoud snel af en breng de 49 μL/put van de PCR-Master mix over naar een 96-well PCR-plaat.
    2. Draai de buizen met de kralen die worden gebruikt voor ASP cDNA-affiniteits zuivering voor 15 sec. zorgvuldig om.
    3. Voeg 1 μL kralen toe aan de overeenkomstige putjes en voer de PCR uit met het volgende programma: 95 °C gedurende 2 min, 40 cycli van 95 °C gedurende 30 s, 55 °C gedurende 30 sec. en 68 °C voor 40 s, dan 68 °C gedurende 7 min.
    4. Scheid de PCR-producten op 1% agarose gel, snijd de banden en kloon de versterkte producten in pCR 2.1 plasmide.
    5. Volgorde en analyseer de sequenties van elke kloon.

6. real-time kwantitatieve PCR (qPCR)

Opmerking: ontwikkel patiënt-specifieke primers en probes met behulp van de aanpak beschreven in stap 3 "reverse transcriptie". Voor qPCR zijn ASP-plasmide verdunningen voor standaard curven. Plasmiden die patiëntspecifieke wisselplaten bevatten, worden ontwikkeld zoals vermeld in de notitie aan het begin van stap 5 "standaard PCR".

  1. Bereid de standaard curve met 1:10 ASP plasmide seriële verdunningen vanaf 3 x 106 kopieën/μl tot 3 kopieën/μl.
    1. Eerste ronde PCR (pre-amp). Voer reacties uit in een totaal volume van 25 μL. bereid een geschikt volume PCR Master mix voor (aantal samples plus 1). Voeg voor elk monster de volgende componenten toe aan een tube van 1,5 mL:
      0,5 μL ASP-of env primer mix (eindconcentratie 0,2 μM per stuk) (vooruit en achteruit)
      0,5 μL dNTPs mix (eindconcentratie 0,2 mM per stuk)
      MgCl2 (concentratie hangt af van de primer paren)
      dH2O tot een eindvolume van 24 μL
    2. Breng 24 μL PCR-Master mix over naar een geschikt aantal putjes van een 96-well PCR-plaat.
    3. Draai de buisjes met de parels voorzichtig om met de cDNA voor 15 sec.
    4. Voeg 1 μL kralen toe aan de bijbehorende putjes. Doe hetzelfde voor plasmide verdunningen.
    5. Voer de PCR uit met het volgende algoritme: denaturatie gedurende 2 min bij 95 °C; 30 s bij 95 °C, 30 s bij 55 °C, 40 s bij 68 °C gedurende 18 cycli; verlenging bij 68 °C gedurende 7 minuten.
    6. Verdun de eerste ronde PCRs-Reacties 1:5 met PCR-grade water.
    7. Tweede ronde qPCR. Voer reacties uit in een totaal volume van 20 μL. bereid een geschikt volume PCR Master mix voor (aantal samples plus 1). Voeg voor elk monster de volgende componenten toe aan een tube van 1,5 mL:
      1,8 μL 10 μM primers (vooruit en achteruit)
      1 μL van 5 μM sonde
      6,2 μL dH2O
    8. Breng 19 μL qPCR Master mix over in een passend aantal putjes van een 96-well qPCR-plaat en voeg 1 μL van de verdunde eerste ronde PCR-reacties toe aan de corresponderende putjes. Doe hetzelfde voor de plasmide verdunningen.
    9. Voer de qPCR uit met het volgende algoritme: denaturatie gedurende 10 min bij 95 °C; 15 s bij 95 °C, 1 minuut bij 60 °C voor 40 cycli.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Hoge temperatuur RNA denaturatie gekoppeld aan affiniteit zuivering van biotinyleerd cDNA voorkomt versterking van niet-specifieke ASP-producten tijdens PCR in PBMCs geïnfecteerd in vitro en in CD4 + T-cellen geïsoleerd van patiënten. RT zelfaanzuigend is aangetoond tijdens omgekeerde transcriptie van antisense RNAS10,14,15,16,17. Om dit fenomeen te voorkomen, ontwikkelden we een nieuwe aanpak met de techniek die oorspronkelijk beschreven werd door Heist et al.10. Onze procedure omvat een hoge temperatuur denaturatie van het RNA vóór RT en het gebruik van biotinyleerd primers om RT uit te voeren, gevolgd door affiniteit-zuivering van de biotinyleerd cDNAs op streptavidin-gecoate magnetische kralen13. De door deze methode verkregen Cdna's kunnen worden gebruikt voor downstreamtoepassingen, waaronder standaard PCR of qPCR.

De experimentele condities voor antisense-transcriptie werden voor het eerst getest in PBMCs van één gezonde donor die in vitro besmet was met HIV-1HXB2, de referentie sequentie voor HIV-1 subtype B (al onze patiënten zijn geïnfecteerd met isolaten van dit subtype). Tabel 2 toont de sequenties van primers en sondes die in deze studie worden gebruikt. Onze initiële RT-reacties werden gedaan met behulp van een reguliere, niet-biotinylated antisense primer (ASP R1) en resulteerden in de succesvolle versterking van ASP (ASP F1-R1 primer pair) (Figuur 1a, Lanes 1-3). Door deze aanpak hebben we echter ook een band met hetzelfde molecuulgewicht versterkt in primer-minus RT reacties controles (Lanes 4-6). Het volledige gebrek aan signaal in onze negatieve controles (Lanes 7-8) gaf aan dat het niet-specifieke sjabloon afkomstig was van de RT-reactie en niet van kruisbesmetting van monsters.

Om het door RT zelf aanzuigende probleem te omzeilen, hebben we besloten een methode te gebruiken die eerder werd beschreven door haist et al.10, waarbij de specifieke antisense primer wordt geëtiketteerd met biotine, zodat de resulterende biotinyleerd cDNA die overeenkomt met de antisense-oriëntatie vóór PCR kan worden gezuiverd en selectief wordt versterkt. Door deze benadering konden we de ASP-sequentie versterken (Figuur 1b, Lanes 1-3) met sterk gereduceerde vervuiling van de niet-specifieke cDNA in de primer-minus-besturingselementen (Figuur 1b, Lanes 4-6).

Optimalisatie van deze methode werd bereikt door volledige denaturatie van het RNA vóór RT bij 94 °C, gevolgd door onmiddellijke koeling op ijskoud water. Zoals weergegeven in Figuur 2A, B, wordt de ASP-band effectief versterkt, terwijl de niet-specifieke producten zijn verdwenen.

ASP-RNA wordt aangetroffen in CD4 + T-cellen van patiënten met detecteerbare viremie en bij afwezigheid van therapie, na stimulatie met anti-CD3/CD28. ASP-RNA was niet detecteerbaar in ongefractioneerde PBMCs of ongestimuleerde CD4 + T-cellen geïsoleerd van HIV-patiënten (gegevens niet weergegeven). Echter, het kan gemakkelijk worden gedetecteerd in CD4 cellen geïsoleerd van drie HIV-positieve onderwerpen, MP135, MP140, en MP148 (tabel 1), na stimulatie met anti-CD3/CD28. De kinetiek van de ASP-RNA-expressie, gemeten door qPCR bij deze drie patiënten, wordt weergegeven in Figuur 3.

CD4 cellen geïsoleerd van patiënten die kunst ondergaan en met niet-detecteerbare viremie, kunnen kleine hoeveelheden ASP-RNA produceren wanneer ze worden gestimuleerd met anti-CD3/CD28. Kwantificering van ASP-RNA-niveaus bij twee van deze patiënten (MP071, MP146) door qPCR toont aan dat in deze omstandigheden ASP-RNA wordt gedetecteerd in lage concentraties (10-15 kopieën/miljoen CD4 + T-cellen) bij 3-5 dagen na stimulatie (Figuur 4). Bij één patiënt (MP069) kan echter op geen enkel moment een ASP-RNA worden gedetecteerd (gegevens worden niet weergegeven).

ASP en env Rna's hebben vergelijkbare expressie patronen in één onbehandelde patiënt met detecteerbaar viremie (MP140). Twee patiënten werden geanalyseerd, één onbehandeld (MP140) en één behandeld (MP146). In MP140 konden we zowel ASP als env detecteren. Hoewel hun transcriptie niveaus onvergelijkbaar waren (figuur 5a), was de uitdrukkings curve van deze twee genen in de loop van de tijd identiek, wat de plot gegevens op een logaritmische schaal kan visualiseren (Figuur 5b). Bij patiënt MP146, die werd behandeld en wiens viremie onder de detectieniveaus lag, waren ASP en env nauwelijks detecteerbaar en pas na enkele dagen van stimulatie (figuur 5c).

Figure 1
Figuur 1: expressie van ASP-RNA in PBMCs van één HIV-negatief persoon die in vitro is GEÏNFECTEERD met HIV-1HXB2 door standaard en gemodificeerde RT-PCR. A) detectie van ASP-RNA met behulp van standaard RT-PCR. ASP wordt versterkt door cDNA gesynthetiseerd in de aanwezigheid van de niet-biotinylated ASP-specifieke antisense primer ASP R1 (Lanes 1 – 3). Dezelfde band is ook te vinden in primer-minus RT Controls (Lanes 4 – 6). B) visualisatie van ASP-RNA door biotinylatie van de antisense primer en de zuivering van cDNA (Lanes 1-3). Een band van verminderde intensiteit wordt nog steeds gedetecteerd in primer-minus Controls (Lanes 4 – 6). Er zijn geen bands aanwezig in negatieve controles. Eerder gepubliceerd in het artikel "detectie van antisense eiwit (ASP) RNA transcripten bij personen geïnfecteerd met humaan immunodeficiëntie virus type 1 (HIV-1)", door Mancarella et al.13 (J gen virol 100 (5): 863-876. Doi: 10.1099/JGV. 0.001244). Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 2
Figuur 2: ASP-RNA wordt uitgedrukt in PMBCs van één HIV-negatief individu na infectie met HIV-1HXB2. (A) de ASP-band is gemakkelijk te detecteren RNA dat volledig gedenatureerd en omgekeerd getranscribeerd is met behulp van de biotinyleerd RT primer (ASP R1) (Lanes 1 – 3) maar niet in gezuiverde cDNA van primer-minus Controls (rijstroken 4 – 6). B) er wordt geen signaal dat overeenkomt met ASP gedetecteerd in RT-minus controles van RNA van geïnfecteerde PBMCs, niet-geïnfecteerde PBMCs of water, hoewel een duidelijke band zichtbaar is in de gag positieve controle van ach-2 cellen. Eerder gepubliceerd in het artikel "detectie van antisense eiwit (ASP) RNA transcripten bij personen geïnfecteerd met humaan immunodeficiëntie virus type 1 (HIV-1)", door Mancarella et al.13 (J gen virol 100 (5): 863-876. Doi: 10.1099/JGV. 0.001244). Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 3
Figuur 3: in anti-CD3/CD28-GESTIMULEERDE CD4 + T-cellen, geïsoleerd van drie onbehandelde patiënten, is de productie van ASP-RNA gemakkelijk detecteerbaar en pieken tussen dag 2 en 4 na stimulatie. In MP135 en MP140 piekte de expressie van ASP op dag 4 na de stimulatie, terwijl MP148 het op dag 2 bereikte. ASP-niveaus worden uitgedrukt als RNA-kopieën/miljoen CD4 + T-cellen. Punten in de tijdsduur komen overeen met de gemiddelde waarde van drievlaatpcr-reacties. Eerder gepubliceerd in het artikel "detectie van antisense eiwit (ASP) RNA transcripten bij personen geïnfecteerd met humaan immunodeficiëntie virus type 1 (HIV-1)", door Mancarella et al.13 (J gen virol 100 (5): 863-876. Doi: 10.1099/JGV. 0.001244). Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 4
Figuur 4: in twee aviremic-patiënten die kunst ondergaan, is ASP nauwelijks detecteerbaar na een paar dagen van stimulatie. Bij beide patiënten kon ASP niet worden gedetecteerd op dag 0. Bij patiënt MP071 konden lage niveaus van ASP worden gedetecteerd op dag 3, terwijl bij de patiënt MP146, we moesten wachten tot dag 5 om sommige niveaus van RNA te zien. ASP-niveaus worden uitgedrukt als RNA-kopieën/miljoen CD4 + T-cellen. Punten in de tijdsduur komen overeen met de gemiddelde waarde van drievlaatpcr-reacties. Eerder gepubliceerd in het artikel "detectie van antisense eiwit (ASP) RNA transcripten bij personen geïnfecteerd met humaan immunodeficiëntie virus type 1 (HIV-1)", door Mancarella et al.13 (J gen virol 100 (5): 863-876. Doi: 10.1099/JGV. 0.001244). Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 5
Figuur 5: expressie van ASP en env in anti-CD3/CD28-gestimuleerde CD4 + T-cellen bij behandelde (MP146) en onbehandelde (MP140) patiënten. A) bij de onbehandelde patiënt (MP140) wordt env uitgedrukt in een hoger niveau dan ASP; B) dezelfde gegevens die op een logaritmische schaal worden uitgezet, tonen aan dat ASP-en env-expressie worden gekenmerkt door een gelijksoortig profiel in de tijd; C) expressie kinetiek van ASP en env bij één patiënt met niet-detecteerbare viremie en kunst die wordt ondergaan (MP146). Eerder gepubliceerd in het artikel "detectie van antisense eiwit (ASP) RNA transcripten bij personen geïnfecteerd met humaan immunodeficiëntie virus type 1 (HIV-1)", door Mancarella et al.13 (J gen virol 100 (5): 863-876. Doi: 10.1099/JGV. 0.001244). Klik hier om een grotere versie van dit cijfer te bekijken.

Patiënt-ID Leeftijd Sex Stadium van HIV-infectie Clade Virale belasting (kopieën/ml) CD4 telling (cellen/μl) KUNST status
MP135 44 M C3 B 1.6 x105 176 Onbehandeld
MP140 23 M A2 B 3.6 x104 427 Onbehandeld
MP148 37 M A1 B 2.0 x104 717 Onbehandeld
MP069 42 M A1 B < 20 1309 Behandeld
MP071 47 M C3 B < 20 167 Behandeld
MP146 59 M C3 B < 20 385 Behandeld

Tabel 1: functies van patiënten. Eerder gepubliceerd in het artikel "detectie van antisense eiwit (ASP) RNA transcripten bij personen geïnfecteerd met humaan immunodeficiëntie virus type 1 (HIV-1)", door Mancarella et al.13 (J gen virol 100 (5): 863-876. Doi: 10.1099/JGV. 0.001244).

Naam van de primer/sonde Volgorde van de primer (5 ' tot 3 ')
ASP F1 TTAGGAGTAGCACCCACCAA
ASP R1 GAACCCAAGGAACAAAGCTC
PAN ASP F Een van de meest GEKKEN
PAN ASP R GCACATTGTAACATTAGTAGAGCA
ASP MP135, 146, 071 F Een van de meest creatieve
ASP MP135, 146, 071 R GEAGLDE,
ASP MP135, 146, 071 probe FAM/TAMRA TCTCTGCACCACTCTTCTCTTTGCC
ASP MP140 F CCCATAGTGCTTCCTGCTATTC
ASP MP140 R EEN van de meest
ASP MP140 probe FAM/TAMRA AGCTCCTATTGTTCCCACTGCTCT
ASP MP148 F CTCTCTGCACCACTCTTCTTT
ASP MP148 R Een van de meest GEKKEN
ASP MP148 probe FAM/TAMRA TGGTGGGTGCTACTCCTAATGGTT
ENV MP140 F EEN van de meest
ENV MP140 R CCCATAGTGCTTCCTGCTATTC
ENV MP140 probe FAM/TAMRA AGCTCCTATTGTTCCCACTGCTCT
ENV MP146 F GEAGLDE,
ENV MP146 R Een van de meest creatieve
ENV MP146 probe FAM/TAMRA TCTCTGCACCACTCTTCTCTTTGCC

Tabel 2: RT-PCR-primers en-sondes

Subscription Required. Please recommend JoVE to your librarian.

Discussion

In dit rapport beschrijven we een streng-specifieke RT assay toegepast op de detectie van ASP-RNA in CD4 + T-cellen geïsoleerd van personen geïnfecteerd met HIV-1. Het optreden van niet-specifieke priming tijdens RT belemmert de detectie van RNA-transcripten met de juiste polariteit, wat leidt tot een verkeerde interpretatie van de resultaten. Eerdere groepen hebben verschillende strategieën ontwikkeld die gericht zijn op het voorkomen van primer-onafhankelijke cDNA-synthese tijdens de RT-reactie. Het taggen van de omgekeerde primer aan de 3 ' einde met sequenties die niet gerelateerd zijn aan HIV is effectief gebleken in het bereiken van streng-specifieke amplificatie6,8,9. Deze aanpak maakt het echter alleen mogelijk om de valselijk klaar cDNA niet detecteerbaar te maken in plaats van het te vermijden, met het risico dat het in de PCR-reactie lekt, waardoor de amplificatie van niet-specifieke DNA-producten (d.w.z. env in plaats van ASP) wordt veroorzaakt.

Onze initiële RT-PCR-pogingen bij het opsporen van ASP-RNA werden uitgevoerd met behulp van een standaard antisense primer. De amplificaties waren succesvol, omdat we bands van het juiste molecuulgewicht kregen, maar ook bands van dezelfde grootte waren aanwezig in onze primer-minus Controls. Op basis van deze resultaten gebruikten we een andere aanpak, waarbij RT werd uitgevoerd met een biotinyleerd specifieke antisense primer, zoals beschreven door haist et al.10. Hoewel onze voorbereidende experimenten resulteerden in een drastische afname van de RT Self-priming, konden we niet-specifieke producten van amplificatie niet volledig verwijderen. Haist en collega's elimineren niet-specifieke cDNA-producten door de kralen te wassen in omstandigheden met hoge stringentie10. In onze werkwijze hebben we de bron van zelfaanzuiging volledig verwijderd in de vorm van RNA secundaire structuren die hoge denaturerings temperaturen gebruiken om het RNA-template volledig te linealiseren.

We tonen aan dat ASP-RNA wordt uitgedrukt in anti-CD3/CD28-gestimuleerde CD4 + T-lymfocyten. Detectie van ASP kan echter niet worden bereikt in cellen die geen stimulatie hebben. Onze gegevens zijn enigszins onvergelijkbaar met die van Zapata en collega's, die uitdrukking hebben gegeven aan lage niveaus van ASP in rust CD4 +-cellen die zijn geïsoleerd van patiënten die ART9ondergaan. Op basis van deze resultaten stellen zij voor dat ASP-RNA een rol kan spelen bij het reguleren van de HIV-latentie. Onze bevinding dat in dezelfde persoon de kinetiek van expressie van ASP en env wordt gekenmerkt door hetzelfde profiel is niet consistent met het model9van Zapata. In feite, als echt ASP was betrokken bij de regulering van de latentie, het profiel van de expressie moet worden tegengesteld aan de waargenomen voor env18.

We hebben ook geconstateerd dat env transcriptie niveaus meer dan 2 logs hoger zijn dan die van ASP, althans bij patiënten die geen therapie hebben. Deze gegevens zijn in overeenstemming met studies door Laverdure et al.8 waaruit blijkt dat in de primaire CD4 + cellen geïnfecteerd in vitro, 3 ' LTR antisense transcriptie is veel lager (tot 1000-fold) dan 5 ' sense transcriptie. Onze resultaten geven aan dat ASP wordt uitgedrukt in geïnfecteerde CD4 lymfocyten, ongeacht het stadium van de ziekte, zolang cellen goed worden gestimuleerd. Daarnaast tonen onze gegevens aan dat ASP wordt uitgedrukt in cellen van patiënten die een kunst behandeling ondergaan, hoewel het niveau van expressie in deze cellen lager is dan in cellen van patiënten die geen therapie hebben.

Kortom, we stellen een betrouwbare streng-specifieke RT-assay voor die gericht is op het voorkomen van primer-onafhankelijke cDNA-synthese. ASP en env zijn twee genen die elkaar overlappen in tegengestelde richting, een functie die hun studie zeer uitdagend maakt. Onze aanpak, die het mogelijk maakt selectief cDNAs-getranscribeerd van RNA met zowel negatieve als positieve polariteit te vangen, vertegenwoordigt een optimaal en effectief instrument voor de studie van deze twee genen in het bijzonder, en genen die elkaar overlappen in hun antisense oriëntatie in het algemeen.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs verklaren dat er geen belangenconflicten zijn.

Acknowledgments

We danken Patrizia Amelio, Alessandra Noto, Craig Fenwick en Matthieu Perreau om altijd beschikbaar te zijn om ons werk en alle mensen in het laboratorium voor AIDS-immunopathogenese te bespreken voor hun kostbare technische hulp. We willen ook John en Aaron Weddle van VSB Associated Inc. bedanken die hebben bijgedragen aan uitstekende kunstwerken. Tot slot, veel speciale dank aan alle patiënten, zonder wie dit werk niet mogelijk zou zijn geweest. Dit werk ontving geen specifieke subsidie van een financierings instantie.

Materials

Name Company Catalog Number Comments
BD LSR II Becton Dickinson
BigDye Terminator v1.1 Cycle Sequencing Kit Applied Biosystem, Thermo Fisher Scientific 4337450
dNTP Set (100 mM) Invitrogen, Thermo Fisher Scientific 10297018
Dynabeads M-280 Streptavidin Invitrogen, Thermo Fisher Scientific 11205D
EasySep Human CD4+ T Cell Isolation Kit Stemcell Technologies 19052
Fetal Bovine Serum Biowest S1010-500
Fixation/Permeabilization Solution Kit Becton Dickinson 554714
HIV Gag p24 flow cytometry antibody - Kc57-FITC Beckman Coulter 6604665
Human IL-2 Miltenyi Biotec 130-097-743
Lectin from Phaseolus vulgaris (PHA) Sigma-Aldrich 61764-1MG
LIVE/DEAD Fixable Yellow Dead Cell Stain Kit, for 405 nm excitation Invitrogen, Thermo Fisher Scientific L34967
Mouse Anti-Human CD28 Becton Dickinson 55725
Mouse Anti-Human CD3 Becton Dickinson 55329
Primers and Probes Integrated DNA Technologies (IDT)
Penicillin-Streptomycin BioConcept 4-01F00-H
Platinum Taq DNA Polymerase High Fidelity Invitrogen, Thermo Fisher Scientific 11304011
Polybrene Infection / Transfection Reagent Sigma-Aldrich TR-1003-G
RNeasy Mini Kit Qiagen 74104
Roswell Park Memorial Institute (RPMI) 1640 Medium Gibco, Thermo Fisher Scientific 11875093
StepOnePlus Real-Time PCR System Applied Biosystem, Thermo Fisher Scientific 4376600
SuperScript III Reverse Transcriptase Invitrogen, Thermo Fisher Scientific 18080044
TaqMan Gene Expression Master Mix Applied Biosystem, Thermo Fisher Scientific 4369016
TOPO TA Cloning Kit for Subcloning, with One Shot TOP10 chemically competent E. coli cells Invitrogen, Thermo Fisher Scientific K450001
TURBO DNase (2 U/µL) Invitrogen, Thermo Fisher Scientific AM2238
Veriti Thermal Cycler Applied Biosystem, Thermo Fisher Scientific 4375786

DOWNLOAD MATERIALS LIST

References

  1. Miller, R. H. Human immunodeficiency virus may encode a novel protein on the genomic DNA plus strand. Science. 239, (4846), 1420-1422 (1988).
  2. Vanheebrossollet, C., et al. A Natural Antisense Rna Derived from the Hiv-1 Env Gene Encodes a Protein Which Is Recognized by Circulating Antibodies of Hiv+ Individuals. Virology. 206, (1), 196-202 (1995).
  3. Briquet, S., Vaquero, C. Immunolocalization studies of an antisense protein in HIV-1-infected cells and viral particles. Virology. 292, (2), 177-184 (2002).
  4. Clerc, I., et al. Polarized expression of the membrane ASP protein derived from HIV-1 antisense transcription in T cells. Retrovirology. 8, 74 (2011).
  5. Landry, S., et al. Detection, characterization and regulation of antisense transcripts in HIV-1. Retrovirology. 4, 71 (2007).
  6. Kobayashi-Ishihara, M., et al. HIV-1-encoded antisense RNA suppresses viral replication for a prolonged period. Retrovirology. 9, 38 (2012).
  7. Barbagallo, M. S., Birch, K. E., Deacon, N. J., Mosse, J. A. Potential control of human immunodeficiency virus type 1 asp expression by alternative splicing in the upstream untranslated region. DNA Cell Biol. 31, (7), 1303-1313 (2012).
  8. Laverdure, S., et al. HIV-1 Antisense Transcription Is Preferentially Activated in Primary Monocyte-Derived Cells. Journal of Virology. 86, (24), 13785-13789 (2012).
  9. Zapata, J. C., et al. The Human Immunodeficiency Virus 1 ASP RNA promotes viral latency by recruiting the Polycomb Repressor Complex 2 and promoting nucleosome assembly. Virology. 506, 34-44 (2017).
  10. Haist, K., Ziegler, C., Botten, J. Strand-Specific Quantitative Reverse Transcription-Polymerase Chain Reaction Assay for Measurement of Arenavirus Genomic and Antigenomic RNAs. PLoS One. 10, (5), 0120043 (2015).
  11. Lerat, H., et al. Specific detection of hepatitis C virus minus strand RNA in hematopoietic cells. The Journal of Clinical Investigation. 97, (3), 845-851 (1996).
  12. Tuiskunen, A., et al. Self-priming of reverse transcriptase impairs strand-specific detection of dengue virus RNA. J Gen Virol. 91, Pt 4 1019-1027 (2010).
  13. Mancarella, A., et al. Detection of antisense protein (ASP) RNA transcripts in individuals infected with human immunodeficiency virus type 1 (HIV-1). Journal of General Virology. (2019).
  14. Peyrefitte, C. N., Pastorino, B., Bessaud, M., Tolou, H. J., Couissinier-Paris, P. Evidence for in vitro falsely-primed cDNAs that prevent specific detection of virus negative strand RNAs in dengue-infected cells: improvement by tagged RT-PCR. J Virol Methods. 113, (1), 19-28 (2003).
  15. Boncristiani, H. F., Di Prisco, G., Pettis, J. S., Hamilton, M., Chen, Y. P. Molecular approaches to the analysis of deformed wing virus replication and pathogenesis in the honey bee, Apis mellifera. Virol J. 6, 221 (2009).
  16. Boncristiani, H. F., Rossi, R. D., Criado, M. F., Furtado, F. M., Arruda, E. Magnetic purification of biotinylated cDNA removes false priming and ensures strand-specificity of RT-PCR for enteroviral RNAs. J Virol Methods. 161, (1), 147-153 (2009).
  17. Craggs, J. K., Ball, J. K., Thomson, B. J., Irving, W. L., Grabowska, A. M. Development of a strand-specific RT-PCR based assay to detect the replicative form of hepatitis C virus RNA. J Virol Methods. 94, (1-2), 111-120 (2001).
  18. Barbeau, B., Mesnard, J. M. Making sense out of antisense transcription in human T-cell lymphotropic viruses (HTLVs). Viruses. 3, (5), 456-468 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics