Transcrições de RNA do vírus da imunodeficiência humana tipo 1 (HIV-1) Antisense Protein (ASP) em pacientes por RT-PCR específico

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Grampos de cabelo rna e loops podem funcionar como primers para transcrição reversa (RT) na ausência de primers específicos da seqüência, interferindo com o estudo de transcrições antisense sobrepostas. Desenvolvemos uma técnica capaz de identificar rna específico da cadeia, e nós o usamos para estudar a proteína antisense HIV-1 ASP.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Mancarella, A., Procopio, F. A., Achsel, T., De Crignis, E., Foley, B. T., Corradin, G., Bagni, C., Pantaleo, G., Graziosi, C. Detection of Human Immunodeficiency Virus Type 1 (HIV-1) Antisense Protein (ASP) RNA Transcripts in Patients by Strand-Specific RT-PCR. J. Vis. Exp. (153), e60511, doi:10.3791/60511 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Em retrovírus, a transcrição antisense tem sido descrita tanto no vírus da imunodeficiência humana tipo 1 (HIV-1) quanto no vírus tinfotrópico T humano 1 (HTLV-1). No HIV-1, o gene asp de proteína antisense está localizado na vertente negativa da vv, no quadro de leitura -2, abrangendo a junção gp120/gp41. Na orientação de sentido, o final de 3' do quadro de leitura aberta asp se sobrepõe com gp120 regiões hipervariáveis V4 e V5. O estudo do RNA ASP foi frustrado por um fenômeno conhecido como RT-auto-priming, em que as estruturas secundárias de RNA têm a capacidade de prime RT na ausência da cartilha específica, gerando cDNAs não específicos. O uso combinado de alta desnaturação de RNA com primers reversos biotinylated na reação rt, juntamente com a purificação de afinidade do cDNA em contas magnéticas revestidas de streptavidin, nos permitiu amplificar seletivamente RNA ASP em células T CD4 + derivadas de indivíduos infectados com HIV-1. Nosso método é relativamente de baixo custo, simples de executar, altamente confiável e facilmente reproduzível. A este respeito, representa uma ferramenta poderosa para o estudo da transcrição antisense não só no HIV-1, mas também em outros sistemas biológicos.

Introduction

O gene da proteína antisense (ASP) é um quadro de leitura aberto (ORF) localizado na cadeia negativa do gene do envelope tipo 1 (HIV-1) do vírus da imunodeficiência humana (HIV-1), abrangendo a junção gp120/gp411. Nos últimos 30 anos, vários relatos mostraram que o gene HIV ASP é de fato transcrito e traduzido2,3,4,5,6,7,8,9. Embora as transcrições antisense asp tenham sido totalmente caracterizadas in vitro, até recentemente, as informações sobre a produção real de RNA ASP em pacientes ainda estavam faltando.

A seqüência de ASP é reversa e complementar ao env. Isso representa um grande obstáculo ao tentar detectar transcrições para ASP. Os métodos padrão de reação em cadeia de transcrição reversa-polimerase (RT-PCR) usam primers antisenso específicos do gene para sintetizar DNAs complementares (CDNAs) da polaridade certa. Esta abordagem, no entanto, não permite determinar a orientação (sentido ou antisenso) do modelo inicial de RNA, uma vez que grampos de cabelo rna ou loops podem prime RT em ambas as direções, na ausência de primers10, um fenômeno conhecido como RT auto-priming. A maioria dos investigadores ASP contornar o problema da RT auto-priming usando primers marcados com seqüências que não estão relacionadas com o HIV-111,12. Esta estratégia, no entanto, não elimina a ocorrência do fenômeno, e pode levar a potencial recarga de cDNAs não específicas para o PCR11.

Recentemente desenvolvemos um novo ensaio RT-PCR específico da vertente para o estudo do RNA antisenso e o usamos para a detecção de RNA da ASP em uma coorte de seis pacientes infectados pelo HIV, como mostrado na Tabela 1. O procedimento descrito abaixo foi publicado anteriormente por Antonio Mancarella et al.13. Em nosso protocolo, evitamos a produção de CDNAs não específicos por uma abordagem dupla. Em primeiro lugar, eliminamos as estruturas secundárias de RNA desnatando rna a alta temperatura (94 °C) e, em segundo lugar, transcrevemos o RNA ASP usando uma cartilha específica de ASP biotinylated e purificam aafinidade do cDNA resultante. Por essa abordagem, somos capazes de amplificar apenas nosso cDNA alvo, uma vez que outros produtos RT não específicos são impedidos de serem gerados (desnaturação de alta temperatura de RNA) ou eliminados antes do PCR (purificação de afinidade).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Este estudo foi aprovado pelo Conselho de Revisão Institucional do Centre Hospitalier Universitaire Vaudois (CHUV).

1. Infecção de células mononucleares periféricas do sangue (PBMCs) com cepaHIV-1 HXB2

  1. Dia 1: ESTIMULAÇÃO PBMCs
    1. Isolar PBMCs de um casaco de buffy doador saudável.
    2. Conde e resuspenda PBMCs auma concentração de 1x10 6/mL em completa Roswell Park Memorial Institute (RPMI) 1640 médio contendo 10% de soro bovino fetal (FBS) e 1% penic illilina/estreptomicina (R-10), com adição de 50 U/mL de interleucina-2 (IL-2) e 3 μg/mL fitohaemaglutinin (PHA).
    3. Pipet para cima e para baixo e dividir as células em duas placas de seis poços (3 mL de suspensão celular / bem).
    4. Incubar por 3 dias a 37 °C e 5% CO2.
  2. Dia 3: INFECÇÃO PBMCs
    NOTA: Use uma das duas placas como na etapa 1.1.3 como controle negativo (não infecte essas células).
    CUIDADO: Realize todo o procedimento em um laboratório de nível III de biossegurança (P3).
    1. Pbmcs piscina de uma placa em um tubo de falcão 50 mL e centrífuga em 300 x g para 10 min.
    2. Descarte o supernatant e resuspenda as células em 2,2 mL de R-10 contendo 20 U/mL de IL-2 e 2 μg/mL polibrene.
    3. Descongelar frascos contendo o vírusHIV-1 HXB2 e adicionar 1,8 mL de suspensão viral (0,376 ng/μL) para as células.
    4. Incubar as células por 2 h a 37 °C, rodando suavemente o tubo a cada 30 min.
    5. Centrífuga s as células a 300 x g por 10 min.
    6. Descarte o supernatant e resuspenda ascélulas em 1x10 6/mL em R-10 contendo IL-2 (50 U/mL).
    7. Transfira a suspensão celular para uma placa de 24 poços a uma concentração de 1 mL/bem e incubar por 5 dias a 37 °C e 5% DECO 2.
    8. Colher 1 bem a cada dia e transferir as células para tubo de 1,5 mL (rotulado com o dia da infecção).
      NOTA: Antes da centrifugação, transfira 150 μL de suspensão celular para um tubo de citometria de fluxo para controle de qualidade de infecção de PBMCs (ver passo 1.3)
    9. Centrífuga os tubos em 400 x g por 10 min e descartar o supernatant.
    10. Congele as pelotas celulares a -80 °C até o uso.
  3. Infecção por PBMCs: controle de qualidade
    1. Para cada dia de infecção, coletar 150 μL de PBMCs infectados e transferi-los para um tubo de citometria de fluxo.
    2. Adicione 1 mL de sostelo tampão de fosfato (PBS) e centrífuga a 400 x g por 5 min.
    3. Descarte o supernatant e adicione 50 μL de PBS contendo 1 μL de Aqua corante vivo/morto (previamente diluído 1:10 com PBS).
    4. Incubar a 4 °C por 15 min.
    5. Adicione 1 mL de PBS, centrífuga a 400 x g por 5 min, e descartar supernatant.
    6. Adicione 250 μL de solução de fixação/permeabilização e incubapor por 20 min à temperatura ambiente no escuro.
    7. Adicione 1 mL de 1x Perm/Wash Buffer (solução de estoque 10x contendo FBS e saponina diluída 1:10) e centrífuga a 400 x g por 5 min.
    8. Descarte o anticorpo supernatant e adicione 50 μL de PBS contendo HIV Gag p24 fluoesceinisanisocianana (FITC) -anticorpo conjugado (diluído 1:10).
    9. Incubar por 20 min à temperatura ambiente no escuro.
    10. Adicione 1 mL de PBS, centrífuga a 400 x g por 5 min, e descartar o supernatant.
    11. Adicione 150 μL de x CellFIX (solução de estoque 10x contendo formaldeído de 10%, 3,55% metanol, 0,93% de azida de sódio diluído 1:10) e analise as células por citometria de fluxo.

2. Estimulação de células T CD4+ humanas com anticorpos anti-CD3/CD28

  1. Isolar as células T CD4+ de PBMCs de pacientes infectados pelo HIV-1 e doadores saudáveis.
  2. Prepare a mistura humana do anticorpo anti-CD3/CD28 diluindo o anti-CD3 (1:100) e o anti-CD28 (1:50) em PBS.
  3. Cubra uma placa de 48 poços adicionando 200 μL de mistura de anticorpos por poço a um número adequado de poços e incubar a 37 °C por 2 h.
  4. Assaa a solução de anticorpos e adicione 1 mLde células CD4+T em 1x10 6/mL aos poços anti-CD3/CD28 revestidos de anticorpos.
    NOTA: Estimule as células T CD4+ até 5 dias.

3. Transcrição reversa

NOTA: Para obter primers específicos do paciente, o DNA proviral isolado das células CD4+T de cada paciente foi amplificado usando primers HIV-1HXB2 Pan ASP. Primers específicos do paciente foram projetados usando a seqüência proviral interna para os primers Pan ASP. Todas as cartetas e sondas utilizadas neste estudo estão listadas na Tabela 2.

  1. Isolando o RNA total das células
    1. Quantifique o RNA e elimine a contaminação do DNA tratando amostras com DNase.
    2. Realize reações de RT em um volume de 50 μL. Transferência de 0,1-1 μg de RNA total para um número apropriado de poços de uma placa PCR de 96 poços. Prepare a mistura de RNA adicionando os seguintes componentes ao RNA:
      5 μL de primer reverso asp biotinylated (20 μM)
      2,5 μL de triphosfatos de desoxinucleotídeos (dNTPs) (10 mM)
      25 μL de água destilada tratada com dietilpirocarbonato (DEPC) (dH2O).
      Prepare os controles de RT endógenos adicionando 5 μL de água livre de nuclease no lugar da cartilha reversa asp biotinylated.
    3. Coloque a placa PCR de 96 poços em um termocicloe e aqueça a mistura de RNA a 94 °C por 5 min.
    4. Resfrie imediatamente a mistura de RNA em água gelada por pelo menos 1 min.
    5. Prepare a mistura de reação adicionando os seguintes componentes a um tubo de 1,5 mL (calcule o número total de amostras mais 1):
      10 μL de 5x buffer RT
      2,5 μL de 0,1 M de 1,4-dithiothreitol (DTT)
      2,5 μL de RNase fora (40 unidades/μL)
      2,5 μL de enzima RT (200 unidades/μL)
    6. Transfira 17,5 μL desta mistura para cada um dos poços contendo RNA. Prepare os controles RT-menos substituindo a transcriptase reversa por 2,5 μL de água livre de nuclease.
    7. Misture suavemente e incubar a placa em 55 °C para 60 min usando um termociclor.
    8. Inativar as reações aquecendo a 70 °C por 15 min.

4. Purificação de afinidade de cDNA biotinylado asp

NOTA: Não purifique as reações RT-menos.

  1. Prepare 1 L de 2x de lavagem /tampão de ligação contendo 10 mM Tris-HCl (pH 7.5), 1 mM etilediásticaácidos (EDTA) e 2 M NaCl. Filtrar a solução.
    1. Prepare 50 mL de lavagem 1x / tampão de ligação usando água de grau PCR.
    2. Para cada reação, use 10 μL de contas magnéticas conjugadas por streptavidin. Com base no número de reações, transfira um volume apropriado de contas para um tubo de 1,5 mL.
    3. Lave as contas, adicionando um volume igual de 2x de lavagem / tampão de ligação e vórtice para 15 s.
    4. Coloque o tubo em um rack de separação magnética e incubar por 3 min à temperatura ambiente.
    5. Retire cuidadosamente o supernatant sem perturbar as contas e adicione o mesmo volume de lavagem / ligação 2x buffer como o volume inicial de contas.
    6. Vortex para 30 s e transferir 10 μL da suspensão de contas para um número adequado de tubos de 1,5 mL.
    7. Coloque os tubos em um rack de separação magnética e incubar por 3 min à temperatura ambiente.
    8. Descarte o supernatant e adicione 50 μL de lavagem / ligação 2x buffer.
    9. Adicione 50 μL de cDNA biotinylated aos tubos correspondentes que contêm os grânulos.
    10. Incubar por 30 min à temperatura ambiente girando suavemente.
    11. Separe os grânulos do supernatant por uma cremalheira da separação do ímã para 3 min na temperatura ambiente.
    12. Lave as contas adicionando 200 μL de 1x de lavagem / tampão de ligação. Coloque os tubos em um rack de separação ímã por 3 min à temperatura ambiente e descartar o supernatant. Repita duas vezes.
    13. Resuspenda as contas em 10 μL de água de grau PCR.

5. PCR padrão

NOTA: O objetivo do PCR padrão é amplificar todo o ORF do gene ASP. Os produtos de amplificação são então clonados em plasmídeo pCR2.1 para desenvolver curvas padrão para quantificação de RNA ASP por PCR em tempo real (ver parágrafo PCR em tempo real).

  1. Executar PCRs padrão em um volume total de 50 μL. Prepare um volume apropriado de mix mestre pcr (número de amostras mais 1). Para cada amostra, adicione os seguintes componentes a um tubo de 1,5 mL:
    1 μL de 10 primers ASP μM (frente e inverso)
    1 μL de 10 mM dNTPs
    Cloreto de magnésio (MgCl2)(concentração depende das cartilhas utilizadas)
    dH2O a um volume final de 49 μL
    1. Misture bem, rapidamente girar para baixo o conteúdo e transferir 49 μL / bem da mistura mestre PCR para uma placa PCR 96-bem.
    2. Cuidadosamente vórtice os tubos contendo as contas utilizadas para purificação de afinidade CDNA ASP para 15 s.
    3. Adicione 1 μL de contas nos poços correspondentes e execute o PCR usando o seguinte programa: 95 °C por 2 min, 40 ciclos de 95 °C para 30 s, 55 °C para 30 s e 68 °C para 40 s, em seguida, 68 °C por 7 min.
    4. Separe os produtos PCR em 1% de gel agarose, corte as bandas e clonhe os produtos amplificados em plasmídeos pCR2.1.
    5. Sequenciar e analisar as seqüências de cada clone.

6. Pcr quantitativo em tempo real (qPCR)

NOTA: Desenvolver primers específicos do paciente e sondas usando a abordagem descrita na etapa 3 "Transcrição reversa". Para qPCR incluem diluições plasmid ASP para curvas padrão. Plasms contendo inserções específicas do paciente são desenvolvidos como mencionado na nota no início da etapa 5 "PcR padrão".

  1. Prepare a curva padrão usando diluições em série de 1:10 ASP plasmid a partir de 3 x 106 cópias/μL até 3 cópias/μL.
    1. PCR da primeira rodada (pré-amplificador). Realize reações em um volume total de 25 μL. Prepare um volume apropriado de mix mestre de PCR (número de amostras mais 1). Para cada amostra, adicione os seguintes componentes a um tubo de 1,5 mL:
      0,5 μL de ASP ou mix de primer vv (concentração final 0,2 μM cada) (para a frente e para trás)
      0,5 μL de dNTPs mix (concentração final 0,2 mM cada)
      MgCl2 (concentração depende dos pares primer)
      dH2O a um volume final de 24 μL
    2. Transfira 24 μL de mix mestre PCR para um número apropriado de poços de uma placa PCR de 96 poços.
    3. Cuidadosamente vórtice os tubos contendo as contas com o cDNA para 15 s.
    4. Adicione 1 μL de contas aos poços correspondentes. Faça o mesmo para diluições plasmídeos.
    5. Executar o PCR usando o seguinte algoritmo: desnaturação por 2 min a 95 °C ; 30 s a 95 °C, 30 s a 55 °C, 40 s a 68 °C por 18 ciclos; extensão em 68 °C por 7 min.
    6. Diluir as reações pcrs primeira rodada 1:5 com água de grau PCR.
    7. Segunda rodada qPCR. Realize reações em um volume total de 20 μL. Prepare um volume apropriado de mix mestre de PCR (número de amostras mais 1). Para cada amostra, adicione os seguintes componentes a um tubo de 1,5 mL:
      1,8 μL 10 μM primers (frente e inverso)
      1 μL de 5 μM sonda
      6,2 μL de dH2O
    8. Transfira 19 μL de mix mestre qPCR em um número apropriado de poços de uma placa qPCR de 96 poços e adicione 1 μL das reações diluídas de PCR da primeira rodada aos poços correspondentes. Faça o mesmo para as diluições plasmídeos.
    9. Executar o qPCR com o seguinte algoritmo: desnaturação de 10 min a 95 °C; 15 s a 95 °C, 1 min a 60 °C por 40 ciclos.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Desnaturação de RNA de alta temperatura juntamente com a purificação de afinidade de cDNA biotinylated impede a amplificação de produtos ASP não específicos durante PCR em PBMCs infectados in vitro e em células T CD4+ isoladas dos pacientes. Rt auto-priming tem sido mostrado para ocorrer durante a transcrição reversa de RNAs antisense10,14,15,16,17. A fim de evitar este fenômeno, desenvolvemos uma nova abordagem usando a técnica originalmente descrita por Heist et al.10. Nosso procedimento envolve a desnaturação de alta temperatura do RNA antes do RT e o uso de primers biotinylated para executar o RT, seguido pela afinidade-purificação dos cDNAs biotinylated em grânulos magnéticos streptavidin-revestidos13. Os cDNAs obtidos por este método podem ser usados para aplicações a jusante, incluindo PCR padrão ou qPCR.

As condições experimentais para a transcrição antisense foram testadas primeiramente em PBMCs de um doador saudável contaminado in vitro com HIV-1HXB2,a seqüência de referência para o subtipo B HIV-1 (todos nossos pacientes são contaminados com os isolados deste subtype). A tabela 2 mostra as seqüências de primers e de pontas de prova usadas neste estudo. Nossas reações iniciais de RT foram feitas usando um primer antisenso regular, não biotinylated (ASP R1) e resultaram na amplificação bem sucedida de ASP (par primer ASP F1-R1) (Figura 1A, Pistas 1 - 3). No entanto, por esta abordagem, também ampliou uma faixa do mesmo peso molecular em primer-menos CONTROLES DE REAÇÃO RT (Pistas 4-6). A completa falta de sinal em nossos controles negativos (Pistas 7-8) indicou que o modelo não específico vinha da reação do RT e não da contaminação cruzada de amostras.

Para contornar o problema criado pela auto-priming RT, decidimos usar um método previamente descrito por Haist et al.10, em que a cartilha antisense específica é rotulado com biotina para que o cDNA biotinylated resultante correspondente à orientação antisense pode ser purificado antes do PCR e amplificado seletivamente. Por essa abordagem, conseguimos amplificar a sequência asp (Figura 1B,Pistas 1-3) com contaminação muito reduzida do CDNA não específico nos controles primer-menos (Figura 1B, Pistas 4-6).

A otimização deste método foi alcançada pela desnaturação completa do RNA antes do RT em 94 °C, seguido pelo resfriamento imediato em água gelada. Como mostrado na Figura 2A,B, a banda ASP é efetivamente amplificada, enquanto os produtos não específicos desapareceram.

O RNA do ASP é detectado em células T CD4+ de pacientes com viraemia detectável e na ausência de terapia, após estimulação com anti-CD3/CD28. O RNA asp era indetectável em PBMCs não fracionados ou em células T CD4+ não estimuladas isoladas de pacientes com HIV (dados não mostrados). No entanto, poderia ser facilmente detectado em células CD4 isoladas de três indivíduos HIV-positivos, MP135, MP140 e MP148(Tabela 1),após estimulação com anti-CD3/CD28. A cinética da expressão de RNA asp medida pelo qPCR nesses três pacientes são mostradas na Figura 3.

As células CD4 isoladas de pacientes submetidos a TARV e com viraemia não detectável podem produzir pequenas quantidades de RNA ASP quando estimuladas com anti-CD3/CD28. A quantificação dos níveis de RNA asp em dois desses pacientes (MP071, MP146) por qPCR mostra que nessas condições o RNA ASP é detectado em níveis baixos (10-15 cópias/milhões de células T CD4+ em 3-5 dias após a estimulação (Figura 4). Em um paciente entretanto (MP069), nenhum RNA de ASP poderia ser detectado a qualquer ponto de hora (os dados não mostrados).

ASP e RNAs vtêm padrões semelhantes de expressão em um paciente não tratado com viraemia detectável (MP140). Foram analisados dois pacientes, um não tratado (MP140) e um tratado (MP146). Na MP140, pudemos detectar tanto a ASP quanto a env. Embora seus níveis de transcrição fossem diferentes(Figura 5A),a curva de expressão desses dois genes ao longo do tempo era idêntica, que pode ser visualizada traçando dados em escala logarítica(Figura 5B). No paciente MP146, que foi tratado e cuja viraemia estava abaixo dos níveis de detecção, ASP e vv eram pouco detectáveis e somente após vários dias de estimulação(Figura 5C).

Figure 1
Figura 1: Expressão de RNA ASP em PBMCs de um indivíduo HIV-negativo infectado in vitro com HIV-1HXB2 pelo RT-PCR padrão e modificado. (A)Detecção de RNA ASP usando RT-PCR padrão. Asp é amplificado a partir de cDNA sintetizado na presença do não-biotinylated ASP específico antisense primer ASP R1 (Pistas 1-3). A mesma banda também é encontrada em controles de RT primer-menos (Pistas 4-6). (B) Visualização do RNA ASP por biotinylation da cartilha antisense e purificação cDNA (Pistas 1-3). Uma faixa de intensidade diminuída ainda é detectada em controles primer-menos (Pistas 4-6). Nenhuma faixa está presente em controles negativos. Publicado anteriormente no artigo "Detecção de transcrições de RNA de proteína antisense (ASP) em indivíduos infectados com o vírus da imunodeficiência humana tipo 1 (HIV-1)", de Mancarella et al.13 (J Gen Virol 100 (5):863-876. doi: 10.1099/jgv.0.001244). Clique aqui para ver uma versão maior deste número.

Figure 2
Figura 2: O RNA ASP é expresso em PMBCs de um indivíduo HIV-negativo após a infecção comHIV-1 HXB2. (A) A banda ASP é facilmente detectada RNA que foi totalmente desnaturado e reverso transcrito usando o primer RT biotinylated (ASP R1) (Pistas 1-3), mas não em cDNA purificado de primer-menos controles (Pistas 4-6). (B) Nenhum sinal correspondente ao ASP é detectado em controles RT-menos de RNA de PBMCs infectados, PBMCs não infectados ou água, embora uma faixa clara seja visível no controle positivo da mordaça das células ACH-2. Publicado anteriormente no artigo "Detecção de transcrições de RNA de proteína antisense (ASP) em indivíduos infectados com o vírus da imunodeficiência humana tipo 1 (HIV-1)", de Mancarella et al.13 (J Gen Virol 100 (5):863-876. doi: 10.1099/jgv.0.001244). Clique aqui para ver uma versão maior deste número.

Figure 3
Figura 3: Em células T CD4+ estimuladas por CD3/CD28 isoladas de três pacientes não tratados, a produção de RNA asp é facilmente detectável e picos entre os dias 2 e 4 pós-estimulação. Em MP135 e MP140, a expressão de ASP atingiu o pico no dia 4 pós-estimulação, enquanto em MP148 atingiu o pico no dia 2. Os níveis de ASP são expressos como cópias de RNA/milhões de células T CD4+. Os pontos do curso de tempo correspondem ao valor médio das reações triplicadas de PCR. Publicado anteriormente no artigo "Detecção de transcrições de RNA de proteína antisense (ASP) em indivíduos infectados com o vírus da imunodeficiência humana tipo 1 (HIV-1)", de Mancarella et al.13 (J Gen Virol 100 (5):863-876. doi: 10.1099/jgv.0.001244). Clique aqui para ver uma versão maior deste número.

Figure 4
Figura 4: Em dois pacientes aviremic que submetem-se à ARTE, ASP é mal detectável somente após alguns dias da estimulação. Em ambos os nossos pacientes, a ASP não pôde ser detectada no dia 0. No Paciente MP071, baixos níveis de ASP puderam ser detectados no dia 3, enquanto no Paciente MP146, tivemos que esperar até o dia 5 para ver alguns níveis de RNA. Os níveis de ASP são expressos como cópias de RNA/milhões de células T CD4+. Os pontos do curso de tempo correspondem ao valor médio das reações triplicadas de PCR. Publicado anteriormente no artigo "Detecção de transcrições de RNA de proteína antisense (ASP) em indivíduos infectados com o vírus da imunodeficiência humana tipo 1 (HIV-1)", de Mancarella et al.13 (J Gen Virol 100 (5):863-876. doi: 10.1099/jgv.0.001244). Clique aqui para ver uma versão maior deste número.

Figure 5
Figura 5: Expressão de ASP e env em células T CD4+ estimuladas por CD3/CD28 em pacientes tratados (MP146) e não tratados (MP140). (A)No paciente não tratado (MP140), a env é expressa em níveis mais elevados do que a ASP; (B) Os mesmos dados traçados em escala logarítica mostram que a ASP e a expressão de env são caracterizadas por um perfil semelhante ao longo do tempo; (C) Expressão cinética de ASP e env em um paciente com viraemia indetectável e submetidos a TARV (MP146). Publicado anteriormente no artigo "Detecção de transcrições de RNA de proteína antisense (ASP) em indivíduos infectados com o vírus da imunodeficiência humana tipo 1 (HIV-1)", de Mancarella et al.13 (J Gen Virol 100 (5):863-876. doi: 10.1099/jgv.0.001244). Clique aqui para ver uma versão maior deste número.

Identificação do paciente Idade Sexo Estágio da infecção pelo HIV Clado Carga viral (cópias/ml) Contagem cd4 (células/μl) Status TARV
MP135 MP135 44 M C3 C3 B 1.6x105 1.6x105 176 Tratada
MP140 MP140 23 M A2 A2 B 3.6x104 3.6x104 427 Tratada
MP148 MP148 37 M A1 A1 B 2.0x104 2.0x104 717 Tratada
MP069 MP069 42 M A1 A1 B E 20 1309 Tratado
MP071 MP071 47 M C3 C3 B E 20 167 Tratado
MP146 MP146 59 M C3 C3 B E 20 385 Tratado

Tabela 1: Características dos pacientes. Publicado anteriormente no artigo "Detecção de transcrições de RNA de proteína antisense (ASP) em indivíduos infectados com o vírus da imunodeficiência humana tipo 1 (HIV-1)", de Mancarella et al.13 (J Gen Virol 100 (5):863-876. doi: 10.1099/jgv.0.001244).

Nome primer/probe Sequência primer (5' a 3')
ASP F1 TTAGGAGTAGCACCCACCAA
ASP R1 GAACCCAAGGAAAAAGCTC GAACCCAAGGAAAAAGCTC
PAN ASP F ACCAAGCCTCCTACTATTATG ACCAAGCCTCCTACTATTATG
PAN ASP R GCACATTGTAACATTAGAGCA GCACATTGTAACATTAGAGCA
ASP MP135, 146, 071 F CCCAAGAACCCAAGGACaTAG
ASP MP135, 146, 071 R CATTAGGAATAGCACCCACCAA
ASP MP135, 146, 071 Sonda FAM/TAMRA TCTCTGCACCACTCTTCTTTGCC TCTCTCTTCtTTGCC TCTCTGCACCACTCTCTTCTTTGCC
ASP MP140 F CCCATAGTGCTTCCTGCTATTC CCCATAGTGCTTCCTGCTATTC
ASP MP140 R AGAAGAGTGGTGCAGAGAGA AGAAGAGTGGTGCAGAGAGA
SONDA ASP MP140 FAM/TAMRA AGCTCCTATTGTTCCCACTGCTCT AGCTCCTATTGTTCCCACTTCT
ASP MP148 F CTCTGCACCACTCTTCTTTTT
ASP MP148 R AGACCTGGAGGAGGAGATATG AGACCTGGAGGAGGAGATATG
SONDA ASP MP148 FAM/TAMRA TGGTGGGTGCTACTCCTAATGGTTTTT TGGTGGGTGCTACTCCTAATGGTTT
ENV MP140 F AGAAGAGTGGTGCAGAGAGA AGAAGAGTGGTGCAGAGAGA
ENV MP140 R CCCATAGTGCTTCCTGCTATTC CCCATAGTGCTTCCTGCTATTC
SONDA ENV MP140 FAM/TAMRA AGCTCCTATTGTTCCCACTGCTCT AGCTCCTATTGTTCCCACTTCT
ENV MP146 F CATTAGGAATAGCACCCACCAA
ENV MP146 R CCCAAGAACCCAAGGACaTAG
SONDA ENV MP146 FAM/TAMRA TCTCTGCACCACTCTTCTTTGCC TCTCTCTTCtTTGCC TCTCTGCACCACTCTCTTCTTTGCC

Tabela 2: Primers e sondas RT-PCR

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Neste relatório descrevemos um ensaio rt específico da cadeia aplicado à detecção de RNA ASP em células T CD4+ isoladas de indivíduos infectados pelo HIV-1. A ocorrência de escoramento não específico durante a RT dificulta a detecção de transcrições de RNA com a polaridade certa, levando à má interpretação dos resultados. Grupos anteriores desenvolveram várias estratégias destinadas a prevenir a síntese de CDNA independente durante a reação rt. Marcar a cartilha reversa no final do 3' com sequências não relacionadas ao HIV provou ser eficaz em alcançar amplificação específica da cadeia6,8,9. No entanto, essa abordagem só permite tornar o cDNA falsamente preparado indetectável em vez de evitá-lo, com o risco de vazar para a reação do PCR, causando amplificação de produtos de DNA não específicos (ou seja, env em vez de ASP).

Nossas tentativas iniciais de RT-PCR na detecção de RNA asp foram realizadas usando uma cartilha antisense padrão. As amplificações foram bem sucedidas, pois obtivemos bandas do peso molecular certo, mas bandas do mesmo tamanho também estavam presentes em nossos controles primer-menos. Com base nesses resultados, usamos uma abordagem diferente, realizando RT com uma cartilha antisense específica biotinylated, como descrito por Haist et al.10. Embora nossos experimentos preliminares resultem em uma diminuição drástica da auto-priming RT, não poderíamos remover totalmente produtos não específicos de amplificação. Haist e colegas de trabalho eliminar produtos cDNA não específicos, lavando as contas em condições de alta stringency10. Em nosso método, removemos completamente a fonte de auto-priming na forma de estruturas secundárias de RNA usando altas temperaturas de desnaturação para linearizar totalmente o modelo de RNA.

Mostramos que o RNA ASP é expresso em linfócitos CD4+ T estimulados por CD3/CD28. A detecção de ASP, no entanto, não pode ser alcançada em células sem estimulação. Nossos dados são um pouco diferentes daqueles por Zapata e colegas de trabalho, que relataram expressão de baixos níveis de ASP em células CD4+ em repouso isoladas de pacientes submetidos a TAR9. Com base nesses resultados, eles propõem que o RNA ASP pode desempenhar um papel na regulação da latência do HIV. Nossa constatação de que, no mesmo indivíduo, a cinética da expressão de ASP e vv são caracterizadas pelo mesmo perfil não é consistente com o modelo9da Zapata. Na verdade, se realmente ASP estava envolvido na regulação da latência, seu perfil de expressão deve ser oposto ao observado para env18.

Também observamos que os níveis de transcrição de vv são mais de 2 registros superiores aos da ASP, pelo menos em pacientes sem terapia. Estes dados estão de acordo com estudos de Laverdure et al.8 mostrando que nas células CD4+ primárias infectadas in vitro, a transcrição antisense ltr 3' é muito menor (até 1000 vezes) do que a transcrição do sentido de 5'. Nossos resultados indicam que as ps é expressa em linfócitos CD4 infectados, independentemente da fase da doença, enquanto as células são devidamente estimuladas. Além disso, nossos dados demonstram que a ASP é expressa em células de pacientes submetidos ao tratamento de TARV, embora o nível de expressão nessas células seja menor do que nas células de pacientes sem terapia.

Em resumo, sugerimos um ensaio rt confiável específico da cadeia com o objetivo de evitar a síntese de CDNA independente da cartilha. ASP e vv são dois genes que se sobrepõem uns aos outros em direção oposta, uma característica que torna seu estudo muito desafiador. Nossa abordagem, que permite capturar seletivamente cDNAs retrotranscritos do RNA com polaridade negativa e positiva, representa uma ferramenta ideal e eficaz para o estudo desses dois genes em particular, e genes sobrepostos em seu antisense orientação em geral.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores declaram que não há conflitos de interesse.

Acknowledgments

Agradecemos a Patrizia Amelio, Alessandra Noto, Craig Fenwick e Matthieu Perreau por estarem sempre disponíveis para discutir nosso trabalho e todas as pessoas do Laboratório de Imunopatogenigenese da AIDS por sua preciosa assistência técnica. Também gostaríamos de agradecer a John e Aaron Weddle da VSB Associated Inc. que contribuíram com excelente arte. Finalmente, muito agradecimento especial a todos os pacientes, sem os quais este trabalho não teria sido possível. Este trabalho não recebeu nenhuma subvenção específica de qualquer agência de financiamento.

Materials

Name Company Catalog Number Comments
BD LSR II Becton Dickinson
BigDye Terminator v1.1 Cycle Sequencing Kit Applied Biosystem, Thermo Fisher Scientific 4337450
dNTP Set (100 mM) Invitrogen, Thermo Fisher Scientific 10297018
Dynabeads M-280 Streptavidin Invitrogen, Thermo Fisher Scientific 11205D
EasySep Human CD4+ T Cell Isolation Kit Stemcell Technologies 19052
Fetal Bovine Serum Biowest S1010-500
Fixation/Permeabilization Solution Kit Becton Dickinson 554714
HIV Gag p24 flow cytometry antibody - Kc57-FITC Beckman Coulter 6604665
Human IL-2 Miltenyi Biotec 130-097-743
Lectin from Phaseolus vulgaris (PHA) Sigma-Aldrich 61764-1MG
LIVE/DEAD Fixable Yellow Dead Cell Stain Kit, for 405 nm excitation Invitrogen, Thermo Fisher Scientific L34967
Mouse Anti-Human CD28 Becton Dickinson 55725
Mouse Anti-Human CD3 Becton Dickinson 55329
Primers and Probes Integrated DNA Technologies (IDT)
Penicillin-Streptomycin BioConcept 4-01F00-H
Platinum Taq DNA Polymerase High Fidelity Invitrogen, Thermo Fisher Scientific 11304011
Polybrene Infection / Transfection Reagent Sigma-Aldrich TR-1003-G
RNeasy Mini Kit Qiagen 74104
Roswell Park Memorial Institute (RPMI) 1640 Medium Gibco, Thermo Fisher Scientific 11875093
StepOnePlus Real-Time PCR System Applied Biosystem, Thermo Fisher Scientific 4376600
SuperScript III Reverse Transcriptase Invitrogen, Thermo Fisher Scientific 18080044
TaqMan Gene Expression Master Mix Applied Biosystem, Thermo Fisher Scientific 4369016
TOPO TA Cloning Kit for Subcloning, with One Shot TOP10 chemically competent E. coli cells Invitrogen, Thermo Fisher Scientific K450001
TURBO DNase (2 U/µL) Invitrogen, Thermo Fisher Scientific AM2238
Veriti Thermal Cycler Applied Biosystem, Thermo Fisher Scientific 4375786

DOWNLOAD MATERIALS LIST

References

  1. Miller, R. H. Human immunodeficiency virus may encode a novel protein on the genomic DNA plus strand. Science. 239, (4846), 1420-1422 (1988).
  2. Vanheebrossollet, C., et al. A Natural Antisense Rna Derived from the Hiv-1 Env Gene Encodes a Protein Which Is Recognized by Circulating Antibodies of Hiv+ Individuals. Virology. 206, (1), 196-202 (1995).
  3. Briquet, S., Vaquero, C. Immunolocalization studies of an antisense protein in HIV-1-infected cells and viral particles. Virology. 292, (2), 177-184 (2002).
  4. Clerc, I., et al. Polarized expression of the membrane ASP protein derived from HIV-1 antisense transcription in T cells. Retrovirology. 8, 74 (2011).
  5. Landry, S., et al. Detection, characterization and regulation of antisense transcripts in HIV-1. Retrovirology. 4, 71 (2007).
  6. Kobayashi-Ishihara, M., et al. HIV-1-encoded antisense RNA suppresses viral replication for a prolonged period. Retrovirology. 9, 38 (2012).
  7. Barbagallo, M. S., Birch, K. E., Deacon, N. J., Mosse, J. A. Potential control of human immunodeficiency virus type 1 asp expression by alternative splicing in the upstream untranslated region. DNA Cell Biol. 31, (7), 1303-1313 (2012).
  8. Laverdure, S., et al. HIV-1 Antisense Transcription Is Preferentially Activated in Primary Monocyte-Derived Cells. Journal of Virology. 86, (24), 13785-13789 (2012).
  9. Zapata, J. C., et al. The Human Immunodeficiency Virus 1 ASP RNA promotes viral latency by recruiting the Polycomb Repressor Complex 2 and promoting nucleosome assembly. Virology. 506, 34-44 (2017).
  10. Haist, K., Ziegler, C., Botten, J. Strand-Specific Quantitative Reverse Transcription-Polymerase Chain Reaction Assay for Measurement of Arenavirus Genomic and Antigenomic RNAs. PLoS One. 10, (5), 0120043 (2015).
  11. Lerat, H., et al. Specific detection of hepatitis C virus minus strand RNA in hematopoietic cells. The Journal of Clinical Investigation. 97, (3), 845-851 (1996).
  12. Tuiskunen, A., et al. Self-priming of reverse transcriptase impairs strand-specific detection of dengue virus RNA. J Gen Virol. 91, Pt 4 1019-1027 (2010).
  13. Mancarella, A., et al. Detection of antisense protein (ASP) RNA transcripts in individuals infected with human immunodeficiency virus type 1 (HIV-1). Journal of General Virology. (2019).
  14. Peyrefitte, C. N., Pastorino, B., Bessaud, M., Tolou, H. J., Couissinier-Paris, P. Evidence for in vitro falsely-primed cDNAs that prevent specific detection of virus negative strand RNAs in dengue-infected cells: improvement by tagged RT-PCR. J Virol Methods. 113, (1), 19-28 (2003).
  15. Boncristiani, H. F., Di Prisco, G., Pettis, J. S., Hamilton, M., Chen, Y. P. Molecular approaches to the analysis of deformed wing virus replication and pathogenesis in the honey bee, Apis mellifera. Virol J. 6, 221 (2009).
  16. Boncristiani, H. F., Rossi, R. D., Criado, M. F., Furtado, F. M., Arruda, E. Magnetic purification of biotinylated cDNA removes false priming and ensures strand-specificity of RT-PCR for enteroviral RNAs. J Virol Methods. 161, (1), 147-153 (2009).
  17. Craggs, J. K., Ball, J. K., Thomson, B. J., Irving, W. L., Grabowska, A. M. Development of a strand-specific RT-PCR based assay to detect the replicative form of hepatitis C virus RNA. J Virol Methods. 94, (1-2), 111-120 (2001).
  18. Barbeau, B., Mesnard, J. M. Making sense out of antisense transcription in human T-cell lymphotropic viruses (HTLVs). Viruses. 3, (5), 456-468 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics