Эффективная нейронная дифференциация с использованием одноклеточной культуры эмбриональных стволовых клеток человека

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Здесь представлен протокол для генерации одноклеточной культуры эмбриональных стволовых клеток человека и их последующей дифференциации в нервные клетки-прародители. Протокол прост, надежен, масштабируем и подходит для скрининга лекарственных средств и применения регенеративной медицины.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Jeon, K., Park, K., Jetten, A. M. Efficient Neural Differentiation using Single-Cell Culture of Human Embryonic Stem Cells. J. Vis. Exp. (155), e60571, doi:10.3791/60571 (2020).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Дифференциация эмбриональных стволовых клеток человека (HESCs) в пробирке изменила способность изучать развитие человека как на биологическом, так и на молекулярном уровнях и предоставила клетки для использования в регенеративных целях. Стандартные подходы к культуре hESC с использованием культуры типа колонии для поддержания недифференцированных HESCs и эмбрионального тела (EB) и образования розетки для дифференциации в различные слои зародыша являются неэффективными и отнимают много времени. Здесь представлен одноклеточный метод культуры с использованием hESCs вместо культуры колонии типа. Этот метод позволяет сохранить характерные особенности недифференцированных HESCs, в том числе выражение маркеров hESC на уровнях, сопоставимых с уровнем of colony type hESC. Кроме того, протокол представляет собой эффективный метод генерации нейронных клеток-прародителей (NPC) из одноклеточного типа hESCs, который производит NPC в течение 1 недели. Эти клетки очень выразить несколько генов NPC маркер и может дифференцировать в различные типы нервных клеток, в том числе дофаминергических нейронов и астроцитов. Эта одноклеточная система культуры для HESCs будет полезна в исследовании молекулярных механизмов этих процессов, исследований некоторых заболеваний и экранов обнаружения лекарств.

Introduction

Человеческие эмбриональные стволовые клетки (HESCs) имеют потенциал, чтобы дифференцироваться в три первичных слоя зародыша, которые затем дифференцироваться в различные многопотентные линии клеток-прародителей. Эти линии впоследствии приводят к появлению всех типов клеток в организме человека. Системы культуры In vitro hESC изменили способность изучать эмбриональное развитие человека и послужили ценным инструментом для получения новых сведений о том, как эти процессы регулируются на биологическом и молекулярном уровнях. Аналогичным образом, исследования индуцированных плюрипотентных стволовых клеток (iPSCs), полученных в результате перепрограммирования соматических клеток, изолированных от пациентов с человеком, дают новое представление о различных заболеваниях. Кроме того, прародитель и дифференцированные клетки, полученные из HESCs может быть полезным для исследований, связанных с терапией стволовыми клетками и скринингом лекарственных средств1,2,3,4.

hESCs можно навести для того чтобы продифференцировать в нервные клетки прародителя (NPC), которые multipotential клетки с обширной емкостью самообновления. Впоследствии эти клетки могут быть дифференцированы в нейроны, астроциты и олигодендроциты5,6. NPC также предлагают клеточной системы для in vitro исследований биологии нейроразвития и различных неврологических заболеваний. Тем не менее, современные методы культуры типа колонии, включающие hESCs и их дифференциацию в NPC, неэффективны и часто связаны с кокультурой, а также эмбриональным телом(EB) и образованием розетки5,7,8. Эти протоколы демонстрируют более низкие показатели выживаемости и спонтанную дифференциацию и отнимают больше времени.

Представлено здесь улучшенная и надежная система культуры, которая легко масштабируема и использует высокую плотность одноклеточного типа культуры hESCs10. Включение ингибитора Roh-kinase (ROCK) способствовало значительному повышению эффективности выживания при культуре одноклеточного типа hESC10,11,12,13,14. В этой системе культуры, hESCs можно легко поддерживать и расширить. Кроме того, Протокол представляет собой эффективный метод для генерации NPCs из одноклеточного типа культуры hESCs, который позволяет производство высоко чистых NPCs. Ингибирование BMP / TGF/активирующих сигнальных путей с ингибиторами ALK эффективно индуцировать дифференциацию одноклеточного типа hESCs в NPCs15,16, которые затем могут быть индуцированы в функциональную линию.

Таким образом, протокол культуры одноклеточного типа с использованием hESCs предлагает привлекательную модель для изучения дифференциации этих клеток на различные линии, включая NPC. Этот протокол легко масштабируемый и поэтому подходит для генерации клеток для исследований, связанных с регенеративной терапией и скринингом лекарств.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Подготовка hESC-квалифицированных Подвал Мембрана Матрица покрытием пластин

  1. Медленно оттаивать hESC-квалифицированных подвал мембранной матрицы (см. Таблица материалов) решение на 4 кв, по крайней мере 2-3 ч или на ночь, чтобы избежать образования геля.
  2. Для подготовки подвальных мембранных матричных пластин, разбавить матрицу в холодной DMEM/F12 до 2% конечной концентрации. Хорошо перемешайте и покройте каждую скважину из 6 колодца с 1 мл разбавленного матричного раствора.
  3. Инкубировать подвальные мембранные матричные пластины с покрытием при комнатной температуре (RT) не менее 3 ч или при температуре 4 градусов цельсия на ночь.
    ПРИМЕЧАНИЕ: Пластины с мембранной матрицей подвала могут храниться при 4 градусах По Цельсию в течение 1 недели, прежде чем матричная раствор будет удалена и пластины используются.

2. Адаптация еэск типа Колонии к одноклеточной культуре hESC

  1. Для прохождения фидер-свободных культур колонии типа H9 (WA09) hESCs, выращенных на подвальной мембранной матрице, аспирировать среду из скважин(Рисунок 1A)9.
  2. Вымойте 1x с 1 мл DPBS. Добавьте 1 мл раствора диспаса (1 U/mL) на скважину и инкубировать при 37 градусах По Цельсия в течение 20 мин.
  3. Удалить диспазировать, мыть клетки 1x осторожно с 2 мл DMEM / F12, удалить среду, и добавить 2 мл DMEM / F12 к каждой пластине.
  4. Аккуратно отсоедините колонии, аккуратно поднимаясь вверх и вниз и переведивайте в трубку 15 мл.
  5. Centrifuge гранулы в течение 2 мин на 370 х г и аспирации среды.
  6. Чтобы разобщить клеточные гранулы на одиночные клетки, добавьте 2 мл раствора отслоения клеток (концентрация 1x, см. Таблица материалов)и инкубировать при 37 градусах По цельсии в течение 10 мин.
  7. Центрифуги клетки в течение 2 мин на 370 х г и удалить отслоение раствора.
  8. Добавьте свежий mTeSR1 человека ESC среды и разъединить клетки в одиночные клетки, нежный pipetting вверх и вниз.
  9. Чтобы адаптировать колоний типа hESCs к одноклеточной культуре типа, пластины примерно 1,5-2,0 х 106 hESCs в каждый колодец подвала мембраны матрицы покрытием 6 хорошо пластины в 2 мл mTeSR1, содержащий 10 мкм ROCK ингибитор для 24 ч (Рисунок 1A).
  10. После 24 ч замените среду hESC на свежий mTeSR1 без ингибитора ROCK и позвольте hESC расти как одноклеточный тип в течение 3 дней. Изменение среды ежедневно.
  11. На 4-й день, когда культуры достигают почти 100% стопроцентности, разъединяют клетки в решении отряда, затем переплывающиеся, как описано в шаге 2.6.
    ПРИМЕЧАНИЕ: Ингибитор ROCK улучшает выживаемость клеток в течение первоначального 24 ч одноклеточного типа культуры hESC.

3. Эмбрибидное формирование тела и дифференциация на три слоя зародыша(рисунок 2)

  1. Чтобы сформировать ЭБ, сначала повторно новьпетить клетки в 3 мл mTeSR1 среды с 10 мкм ROCK ингибитор в течение первых 24 ч, а затем инкубировать на ночь в 60 мм низких блюд крепления в 37 C инкубатор, чтобы агрегировать.
  2. После 24 ч небольшие ЭБ переносятся на трубку 15 мл. Пусть EBs осесть на дно трубки и осторожно удалить среду с пипеткой. Передача EBs в EB-среде (нокаут-DMEM дополнены 20% нокаут омолаживающей замены сыворотки, 1x глутамин дополнение »см. Таблица материалов, 1% NEAA (несущественные аминокислоты; см. Таблица Материалов,и 0,2% -меркаптоэтанол) и позволяют им расширить в блюдах с низким креплением в течение 7 дней. Среда может быть изменена через день, как описано выше(Рисунок 2A).
  3. На 7-й день соберите EBs из посуды и перенесите их в трубку 15 мл. Аккуратно удалите среду с помощью пипетки и перенесите ЭБ в мембранную матриму с покрытием под 6 скважин.
  4. Разрешить EBs прикрепить к пластине и инкубировать в течение 12 дней в среде EB, в течение которого они будут дифференцироваться в три слоя зародыша(Рисунок 2B). Изменение среды через день.
    ПРИМЕЧАНИЕ: Во время агрегации клеток, низкая привязанность блюдо помогает избежать вложения EB.

4. Дифференциация одноклеточных hESCs типа в NPC(рисунок 3)

  1. Чтобы вызвать дифференциацию NPC, разъедините одноклеточный тип hESC с 1 мл отслоения раствора (1x) и инкубировать в течение 10 мин при 37 градусах Цельсия.
  2. Центрифугклетки в течение 2 мин при 370 х г и удалите отслоение раствора супернатанта. Добавьте 1 мл DMEM/F12 и отдохните клетки нежным пипеттингом.
  3. Клетки плиты на подвальной мембранной матричной матричной пластине с 6-й пластиной при плотности 2 х 105 клеток/колодца в 2 мл mTeSR1, содержащей 10 ингибитор омрок.
  4. После 24 ч замените культурную среду нейронной индукцией (DMEM с 1% B27 минус витамином А), дополненной 1 мкм дорсоморфином и 5 мкм SB431542.
  5. Изменение среды через день в течение первых 4 дней нервной индукции, а затем каждый день до достижения слияния в день 7(Рисунок 3B).
    ПРИМЕЧАНИЕ: (1) Дорсоморфин ингибирует путь БМП, ориентируясь на ALK2,3,6 рецепторов, а также подавляет AMPK; SB431542 является ингибитором пути TGF/Activin, нацелившись на ALK5,7. (2) Тот же протокол был протестирован с другой линией ESC (WA01), которая дала аналогичные результаты, как WA0916. (3) Мы обычно использовали Matrigel для матрицы мембраны подвала; однако, клетки могут быть культивированы на Geltrex, а затем дифференцированы в NPCs с очень похожими результатами, как указано выражением нескольких маркеров NPC (Рисунок 4D, E). Обработка Geltrex так же, как Matrigel (см. раздел 1).

5. Расширение и криоконсервация NPC

  1. После 7 дней нейроиндукции, разъединить клетки с 1 мл отслоения раствора (1x) и инкубировать в течение 10 минут при 37 градусов по Цельсию.
  2. Центрифугклетки в течение 2 мин при 370 х г и удалите отслоение раствора супернатанта. Добавьте 1 мл среды расширения NPC (см. Таблицу Материалов)и resuspend клетки нежным pipetting.
  3. Плита 1 х 105 клеток в 2 мл NPC расширение среды на подвале мембраны матрицы покрытием 6 хорошо пластин.
  4. Прохождение NPCs несколько раз, по мере необходимости, когда культуры достигают почти 90% выпуклость. В течение первых 3-4 проходов, добавить 10 мкм ROCK ингибитор в течение первоначального 24 ч, чтобы предотвратить гибель клеток. После этих проходов, клетки могут быть пройдена и культивируется без ингибитора ROCK. Изменение среды через день во время расширения.
  5. Криоконсервация NpCs, когда культуры достигают неустойчивости.
    1. Для криоконсервации, разъединяют клетки в 1 мл отслоения раствора (1x) в течение 5 мин при 37 градусах Цельсия, затем центрифуга подвески в течение 2 мин при 370 х г, чтобы удалить решение отслоения.
    2. Добавьте решение для замораживания ячеек (см. Таблица материалов),чтобы разрозненные NPC на 1 х 106 ячеек/мл и распределите 1 мл aliquots для криовиалов.
    3. Поместите криовиалы в замораживающий контейнер и храните их на ночь в морозильной камере -80 градусов.
  6. Храните криовиалы в жидком азоте.

6. Приготовление поли-L-орнитина (PLO) и ламинина с покрытием пластин

  1. Для приготовления пластин с покрытием ооп. /ламинина разбавьте раствор оспы в PBS или воду до конечной концентрации 10 мкг/мл. Хорошо перемешать и покрыть каждую скважину 6-й пластины 1 мл разбавленного раствора ООП.
  2. Инкубировать не менее 2 ч при 37 градусах цельсия или на ночь при 4 градусах Цельсия.
  3. Вымойте каждый хорошо с PBS.
  4. Разбавить раствор бульона ламинина в холодной PBS или воде при 10 мкг/мл. Хорошо перемешайте раствор ламинина. Снимите PBS и сразу же покрыть каждый хорошо с 1 мл раствора ламинина. Держите тарелки при 4 градусах по Цельсию и используйте в течение 1 недели. Вымойте с PBS и сразу же добавить культуры среды.
    ПРИМЕЧАНИЕ: Не позволяйте Plo / ламинин покрытием пластины высохнуть.

7. Дифференциация NPCs, полученных hESC, в дофаминергические нейроны(рисунок 6A)

  1. Пластины NPCs в PLO / ламинин покрытием блюд в NPC расширение среды при плотности около 50%.
  2. После 24 ч, изменить среднюю до DA1 среды (нейробазальная среда, содержащая 2 мМ глутамин дополнения, 1x NEAA, 1x B27, 200 нг/мл SHH, и 100 нг /мл FGF8) и изменить среду через день.
  3. Проход культур, когда они достигают сфлюкс. Диссоциативные клетки с 1 мл отслоения раствора (1x) и инкубировать в течение 10 мин при 37 градусах Цельсия.
  4. Центрифугклетки в течение 2 мин при 370 х г и удалите отслоение раствора супернатанта. Добавьте 1 мл среды DA1 и переприостановите клетки нежным пипеткой.
  5. Плита 1 х 105 клеток в 2 мл среды DA1 на Plo/laminin покрытием 6 хорошо пластин.
  6. После 10 дней, изменение на DA2 среды (нейробазальная среда, содержащая 2 мМ глутамин дополнение, 1x NEAA, 1x B27, 200 мКм аскорбиновой кислоты, 20 нг/мл BDNF, и 20 нг /мл GNDF) и изменить среду через день в течение дополнительных 20 дней (Рисунок 6A).
    ПРИМЕЧАНИЕ: Добавить свежую аскорбиновую кислоту ежедневно в среду DA2. В течение первых 14 дней, дифференцированные клетки должны быть переданы, когда они достигают 90% confluency, но не после этого.

8. Дифференциация НСПК, полученных из ЭСК, на астроциты

  1. Клетки нейронных прародителей плиты на пластинах, покрытых Plo/laminin покрытием, в среде расширения NPC при плотности около 50%.
  2. После 24 ч, изменить средний среды для астроцитов (DMEM / F12 среды в том числе 1:100 N2, 1:100 B27, 200 нг /мЛ IGF, 10 нг /мЛ активицин A, 10 нг/мл ерегулин No-1, и 8 нг/мл bFGF) и изменить
  3. Проход культур, когда они достигают сфлюкс. Диссоциативные клетки с 1 мл отслоения раствора (1x) и инкубировать в течение 10 мин при 37 градусах Цельсия.
  4. Центрифугклетки в течение 2 мин при 370 х г и удалите отслоение раствора супернатанта. Добавьте 1 мл астроцита среднего и resuspend клетки нежным пипеттингом.
  5. Плита 1 х 105 клеток в 2 мл астроцитов среды на Plo / ламинин покрытием 6 хорошо блюда.
  6. Разрешить дифференциацию, чтобы продолжить в общей сложности 5-6 недель(рисунок 6B).

9. Иммунофлуоресценция окрашивание

  1. Культурные клетки в 35 мм, как описано выше для каждого типа клеток. Усилите среду и добавьте 1 мл 4% раствора PFA на блюдо и инкубировать в течение 20 минут на RT.
  2. Вымойте 2x в течение 5 мин с PBS.
    ПРИМЕЧАНИЕ: После того, как клетки фиксируются, пластины ассеа могут быть запечатаны парафильмом и храниться при 4 градусах Цельсия. Пятно с антителами в течение 1 недели после фиксации.
  3. Добавьте 300 кл блокирующего раствора (козьей или ослиной сыворотки в PBS) на блюдо и инкубировать на RT в течение 30-60 мин.
  4. Вымойте блюдо 2x с PBS в течение 5 мин.
  5. Добавьте 300 л первичного антитела(таблица 1)раствора (разбавленного в блокирующем растворе) и инкубировать на РТ в течение 1,5 л или на ночь при 4 градусах Цельсия.
  6. Вымойте 2x с PBS в течение 10 мин.
  7. Добавьте 300 л л флуоресцентных конъюгированных вторичных антител(таблица 1) в блокирующий раствор и инкубировать в темноте в течение 1 ч на RT.
  8. Вымойте клетки 2x в течение 10 минут с PBS.
  9. Добавьте hoechst окрашивая разрешение (1 мкм окончательная концентрация в PBS) к пятнам ядер. Инкубировать клетки в темноте в течение 5 мин на RT.
  10. Вымойте клетки 1x с PBS в течение 5 мин, а затем добавить 500 ЗлЛ PBS. Держите блюда в темноте, а затем наблюдать флуоресценцию с конфокальный микроскоп(Рисунок 2B, Рисунок 5C, Рисунок 6A, и Рисунок 7B).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Представлено здесь улучшенный протокол для обслуживания и расширения одноклеточного типа культуры hESCs и их эффективной дифференциации в нейронные клетки-прародители, которые впоследствии дифференцируется в различные вниз по течению нейронных линий, включая дофаминергические нейроны и астроциты.

Репрезентативные контрастные изображения показывают морфологию клеток на разных этапах во время адаптации hESCs типа колонии к одноклеточной культуре типа(рисунок 1A). Благодаря одноклеточной культуре было установлено, что адаптированные HESCs были в состоянии поддерживаться при высокой плотности, а затем легко и эффективно субкультуры при достижении сближи(Рисунок 1A,B). Эти клетки сохранили характеристики клеточного цикла (т.е. короткую фазу G1 и высокую долю клеток в фазе S), типичные для hESC типа колонии(рисунок 1C,D). Они также выразили маркеры ESC (т.е., OCT4, TRA 1-81, SOX2 и NANOG) на уровнях, сопоставимых с уровнями у колоний типа hESCs, как указано в РТ-ПЦР и иммуно-анализа(рисунок 7, Таблица 2). Кроме того, было показано, что одноклеточные hESCs были в состоянии сформировать эмбриональные тела, содержащие клетки из всех трех слоев зародыша: эндодерм (выражение SOX17), мезодерм (выражение SMA) и эктодерм (выражение Тудж-1) (Рисунок 2).

Далее было продемонстрировано, что одноклеточного типа hESCs эффективно дифференцированы в нейронные клетки-прародители с помощью протокола NPC(Рисунок 3A), о чем свидетельствует потеря типичной морфологии hESC и внешний вид морфологии NPC (Рисунок 3B)16. Дифференциация NPC была поддержана повышенным выражением подписных маркеров NPC (т.е. SOX1, OTX2, ЗИК1 и OTX1; Рисунок 5A, Таблица 2) и подтверждено иммуно-истог и FACS анализа. Тот же анализ также показал, что более 90% клеток окрашенных положительные для SOX1, PAX6, и NCAM белка(Рисунок 5B, C). Для изучения способности одноклеточных NPCs, полученных hESC, дифференцироваться в различные нейронные линии вниз по течению, была изучена дифференциация этих клеток на дофаминергические нейроны и астроциты. Как показано на рисунке 6A,B, одноклеточные NPCs, полученные hESC, смогли дифференцироваться в дофаминергические нейроны и астроциты, о чем свидетельствует появление характерных морфологий и выражение линейных специфических дофаминергических маркеров (т.е. TH; Рисунок 6А)и астроцитные маркеры (например, GFAP и S100B; Рисунок 6B).

Figure 1
Рисунок 1: Адаптация амск типа колонии к одноклеточной культуре типа. (A) Представитель фазы контрастные изображения одноклеточных культур H9 hESCs в разное время после покрытия на 2% подвале мембраны матричной посуды покрытием. Низкое (слева) и высокое (правое) увеличение. Верхняя панель: репрезентативное изображение of oneSТипа колонии. Другие панели показывают репрезентативные изображения культур в разное время во время адаптации к одноклеточным типу hESC. Шкала бар 200 мкм. (B) Кривые роста H9 hESCs были проверены в 2% подвале мембраны матримовой матрост покрытием пластин с 10 мкм ROCK ингибитор для первых 24 ч в течение одноклеточного состояния культуры. (C,D) Анализ клеточного цикла типа колонии(C)и одноклеточного типа (D) H9 hESCs по цитометрии потока. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 2
Рисунок 2: Дифференциация в пробирке адаптированных одноклеточных hESCs на три слоя микробов. (A) Репрезентативные фазовые изображения эмбриональных тел (EB), полученные из одноклеточного типа hESC. Шкала бар 100 мкм. (B) Иммунофлуоресцентные изображения дифференцированных hESCs проанализированы для выражения 3 по-разному маркеров слоя зародыша: SOX17 (эндодерм), SMA (мезодерм) и Tuj-1 (эктодерм). Ядра были запятнаны DAPI. Шкала бар 50 мкм. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 3
Рисунок 3: Дифференциация одноклеточного типа hESCs в нейронные клетки-прародители путем прямой дифференциации. (A) Схема протокола дифференциации hESCs в нервные клетки-прародители (NPCs). hESCs лечили дорсоморфином (DMH) и SB431542 (SB) 1 день после покрытия. (B) Представитель фазы контрастных изображений клеточной морфологии во время нервной дифференциации. Шкала бар 200 мкм. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 4
Рисунок 4: культура hESC на различных мембранных матричных продуктах. (A) hESCs культивируется на Matrigel или Geltrex выставлены способность расти и дифференцировать в NPCs, который был похож на одной клеточной культуры. Клетки были окрашены антителами NESTIN. Ядра были запятнаны DAPI. Шкала бар 50 мкм. (B) hESCs культивируется на Matrigel или Geltrex показали аналогичный потенциал дифференцировать в NPCs, как указано на процент NESTIN- и PAX6-положительных клеток. Клетки были проанализированы цитометрией потока на 7-й день дифференциации NPC. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 5
Рисунок 5: Выражение маркеров NPC. ()После 7 дней нервной дифференциации, экспрессия генов nPC маркера (т.е., OTX1, OTX2, SOX1, и ЗИК1) была проанализирована ЗРТ-PCR. Значения были нормализованы к GAPDH и рассчитаны по отношению к значениям hESCs (p qlt; 0.05). (B) Процент SOX1-, NESTIN-, SOX2-, и NCAM-положительных клеток был определен цитометрией потока на 7-й день дифференциации NPC. (C) На 7 NPC дифференциации, клетки были окрашены антителами против нервных маркеров SOX1, NESTIN, NCAM, OTX2, и PAX6. Ядра были запятнаны DAPI. Шкала бар 100 мкм. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 6
Рисунок 6: Дофаминергический нейрон и астроцитов дифференциации NPCs, полученных от одноклеточного типа hESCs. (A) Представитель фазы контрастное изображение дофаминергических нейронов (верхняя панель). Шкала бар 100 мкм. Дифференцированные клетки были окрашены антителами против дофаминергического нейрона маркера TH (тирозин гидроксилаза), как указано. Ядра были запятнаны DAPI. Шкала бар 50 мкм. (B) Представитель фазового контрастного изображения астроцитов (верхняя панель). Шкала бар 100 мкм. Дифференцированные клетки были окрашены антителами против астроцитов маркерGFAP (глиальный фибрилловый кислотный белок) и S100-B (S100 кальция связывающий белок B), как указано. Ядра были запятнаны DAPI. Шкала бар 50 мкм. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 7
Рисунок 7: Характеристика одноклеточного типа hESC. (A) hESCs адаптированы к одноклеточной культуры типа были проанализированы для выражения маркеров ESC (т.е., OCT4, NANOG, и SOX2) по ЗРТ-PCR. Значения были нормализованы до GAPDH (p qlt; 0.05). (B) Иммунофлуоресцентные изображения hESCs окрашенных для выражения плюрипотентных маркеров OCT4, TRA-1-81, и SSEA-1. Ядра были запятнаны DAPI. Шкала бар 50 мкм. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Первичные антитела Видов Разбавления Номер каталога Компании
OCT4 Мыши 1:1000 sc-5279 Санта-Крус
ТРА 1-81 Мыши 1:500 sc-21706 Санта-Крус
SSEA-1 Мыши 1:500 sc-21702 Санта-Крус
SOX1 Коза 1:500 AF-3369 НИОКР
SOX2 Кролик 1:1,000 sc-20088 Санта-Крус
Sma Кролик 1:500 AB-5694 Abcam
Tuj1 Мыши 1:1000 T8578 Sigma
НЕСТИН Мыши 1:1000 AB-22035 Abcam
OTX2 Мыши 1:250 AB-21990 Abcam
hNCAM Мыши 1:200 sc-106 Санта-Крус
hPAX6 Мыши 1:250 561664 Bd
Й Мыши 1:500 T1299 Sigma
S100b Мыши 1:250 ab4066 Abcam
GFAP Кролик 1:1,000 ab7260 Abcam
Вторичные антитела
Анти-мышь Коза 1:1,000 AF 488 или 647 Технологии жизни
Анти-кролик Коза 1:1,000 AF 488 или 647 Технологии жизни

Таблица 1: Антитела, используемые в иммуноцитохимии и анализе FACS.

Имя праймер Последовательность праймер
OCT4 F: GGAAGGTATTCAGCCAAACG
R: CTCCAGGTCTCTCTCACTC
НАНОГ Ф: ГГТЦКАГААКЗААААААААТГА
R: ATTGGAAGGTTCCCAGTCGCGCG
SOX1 F: CCTTAGGTTCCCCTCTCTTT
Р: CAGGCTGAATTCGGTCTCTCATCATTCATT
OTX1 F: ААГАТКААКККККГГГТКТККТКТКТ
R: CGTGAATTGGCCACTGCTTT
OTX2 F: TGGAAGCACTGTTGCCAAG
R: TAAACCATACCAccACCACCCTCGCGCG
ЗИК1 F: ААКККАААААГГТГГКККККЗААК
R: TCCTCCCAGAAGGATGTGA
GAPDH F: CCCATCACCATCTTCCAGGAG
Р: КТЦбККТАТГТГТГАГАГАГАКГ

Таблица 2: Список праймеров, используемых в анализе RT-PCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Важными критериями скрининга и терапии стволовыми клетками являются масштабируемые и эффективные методы дифференциации ГСС на различные линии и генерации достаточного количества дифференцированных клеток. Различные одноклеточные методы прохождения были опубликованы, в которых клетки культивируются в присутствии ингибитора ROCK или других малых молекул для улучшения выживания, но конечными продуктами этих методов культуры являются колонии типа hESCs17,18,19,20,21. Одноклеточный протокол ESC, который частично основан на ранее опубликованных методах19,20,21,22,успешно генерирует и поддерживает культуры hESC типа одной клетки и предотвращает культуру hESC типа колонии. Она включает в себя высокую плотность одноклеточного покрытия, многоклеточной ассоциации, монослой роста, и эффективной субкультуры(рисунок 1). Последний был достигнут за счет добавления ингибитора ROCK в течение первоначального 24 ч одноклеточного типа культуры hESCs, который улучшает выживаемость клеток17,18,19,20,21. Этот протокол легче масштабируемый и позволяет расширение этих клеток для терапевтического применения в скрининге наркотиков и стволовых клеток.

Кроме того, показано, что одноклеточный тип hESCs может эффективно дифференцировать к линии NPC(Рисунок 3) без использования промежуточной стадии, такие как EB и розетка формирования23,24,25. Высокая нейронная конверсия из одноклеточного типа hESCs была достигнута за счет ингибирования БМП/TGF/актививацина сигналирующих путей путем лечения ингибиторами ALK, дорсоморфином и SB43154215,16,26. С помощью этого протокола, адаптированные одноклеточного типа hESCs может эффективно дифференцировать в NPCs без необходимости EB и розетки формирования(Рисунок 5) и или быть индуцированы дифференцировать в дофаминергических нейронов и астроцитов(Рисунок 6).

Таким образом, одноклеточная культура hESCs обеспечивает быструю и эффективную систему для изучения молекулярных механизмов, которые регулируют многоступенчатую дифференциацию различных линий. В частности, в этом протоколе использовались NPC и описывалась их последующая дифференциация на дополнительные нейронные линии, такие как астроциты и дофаминергические нейроны. Протокол обеспечивает платформу для простого, надежного и масштабируемого производства прародителей и дифференцированных клеток, которые могут быть пригодны для фундаментальных исследований, скрининга лекарственных средств и применения в регенеративной медицине.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторы не заявляют о конфликте интересов.

Acknowledgments

Мы благодарим д-ра Карла Д. Бортнера (NIEHS) за его помощь в анализе FACS. Это исследование было поддержано Внештремальной исследовательской программой Национального института экологических наук, Национальных институтов здравоохранения, No01-ES-101585 в AMJ.

Materials

Name Company Catalog Number Comments
35 mm m-dishes ibidi 81156 Cell culture dish
6-well plates Corning 3516
Accutase Innovative Cell Technologies AT104-500 Cell detachment solution
Activin A R&D system 338-AC-050
Ascorbic Acid Sigma Aldrich A4403
B27 supplement Thermo Fisher 17504044
B27 supplement (-Vit A) Thermo Fisher 12587010
BDNF Applied Biological Materials Z100065
bFGF Peprotech 100-18C
Centrifuge DAMON/ICE 428-6759
CO2 incubator Thermo Fisher 4110
Corning hESC-qulified Matrix (Magrigel) Corning 354277 Basement membrane matrix (used for most of the protocol here)
Cryostor CS 10 Stemcell Technologies 7930 Cell freezing solution
Dispase Stemcell Technologies 7923
DMEM Thermo Fisher 10569-010
DMEM/F12 Thermo Fisher 10565-018
Dorsomorphin Tocris 3093
EGF Peprotech AF-100-16A
Fetal Bovine Serum Fisher Scientific SH3007003HI
FGF8 Applied Biological Materials Z101705
GDNF Applied Biological Materials Z101057
Geltrex matrix Thermo Fisher A1569601 Basement membrane matrix
GlutaMax Thermo Fisher 35050061 Glutamine supplement, 100X
H9 (WA09) human embryonic stem cell line WiCell WA09
Heregulin b-1 Peprotech 100-3
IGF Peprotech 100-11
Knockout DMEM Thermo Fisher 10829018
Knockout Serum Replacement Thermo Fisher 10828028
Laminin Sigma Aldrich L2020
mTeSR1 Stemcell Technologies 85850 hESC culture medium
N2 supplement Thermo Fisher 17502001
NEAA Thermo Fisher 11140050
Neurobasal Thermo Fisher 21103049
Poly-L-ornithine Sigma Aldrich P3655
ROCK inhibitor Tocris 1254
SB431542 Tocris 1614
SHH Applied Biological Materials Z200617
Stemdiff Neural Progenitor medium Stemcell Technologies 5833 NPC expansion medium

DOWNLOAD MATERIALS LIST

References

  1. Thomson, J. A., et al. Embryonic stem cell lines derived from human blastocysts. Science. 282, (5391), 1145-1147 (1998).
  2. Rosler, E. S., et al. Long-term culture of human embryonic stem cells in feeder-free conditions. Developmental Dynamics. 229, (2), 259-274 (2004).
  3. Mallon, B. S., Park, K. Y., Chen, K. G., Hamilton, R. S., McKay, R. D. Toward xeno-free culture of human embryonic stem cells. The International Journal of Biochemistry & Cell Biology. 38, (7), 1063-1075 (2006).
  4. Hoffman, L. M., Carpenter, M. K. Characterization and culture of human embryonic stem cells. Nature Biotechnology. 23, (6), 699-708 (2005).
  5. Yan, Y., et al. Efficient and rapid derivation of primitive neural stem cells and generation of brain subtype neurons from human pluripotent stem cells. Stem Cells Translational Medicine. 2, (11), 862-870 (2013).
  6. Goncalves, J. T., Schafer, S. T., Gage, F. H. Adult Neurogenesis in the Hippocampus: From Stem Cells to Behavior. Cell. 167, (4), 897-914 (2016).
  7. Watanabe, K., et al. A ROCK inhibitor permits survival of dissociated human embryonic stem cells. Nature Biotechnology. 25, (6), 681-686 (2007).
  8. International Stem Cell Initiative. Characterization of human embryonic stem cell lines by the International Stem Cell Initiative. Nature Biotechnology. 25, (7), 803-816 (2007).
  9. Hartung, O., Huo, H., Daley, G. Q., Schlaeger, T. M. Clump passaging and expansion of human embryonic and induced pluripotent stem cells on mouse embryonic fibroblast feeder cells. Current Protocols in Stem Cell Biology. 14, (1), Chapter 1 Unit 1C 10 (2010).
  10. Chen, K. G., et al. Non-colony type monolayer culture of human embryonic stem cells. Stem Cell Research. 9, (3), 237-248 (2012).
  11. Chen, G., Hou, Z., Gulbranson, D. R., Thomson, J. A. Actin-myosin contractility is responsible for the reduced viability of dissociated human embryonic stem cells. Cell Stem Cell. 7, (2), 240-248 (2010).
  12. Li, X., Krawetz, R., Liu, S., Meng, G., Rancourt, D. E. ROCK inhibitor improves survival of cryopreserved serum/feeder-free single human embryonic stem cells. Human Reproduction. 24, (3), 580-589 (2009).
  13. Ohgushi, M., et al. Molecular pathway and cell state responsible for dissociation-induced apoptosis in human pluripotent stem cells. Cell Stem Cell. 7, (2), 225-239 (2010).
  14. Pakzad, M., et al. Presence of a ROCK inhibitor in extracellular matrix supports more undifferentiated growth of feeder-free human embryonic and induced pluripotent stem cells upon passaging. Stem Cell Reviews and Reports. 6, (1), 96-107 (2010).
  15. Chambers, S. M., et al. Highly efficient neural conversion of human ES and iPS cells by dual inhibition of SMAD signaling. Nature Biotechnology. 27, (3), 275-280 (2009).
  16. Jeon, K., et al. GLIS3 Transcriptionally Activates WNT Genes to Promote Differentiation of Human Embryonic Stem Cells into Posterior Neural Progenitors. Stem Cells. 37, (2), 202-215 (2019).
  17. Emre, N., et al. The ROCK inhibitor Y-27632 improves recovery of human embryonic stem cells after fluorescence-activated cell sorting with multiple cell surface markers. PLoS ONE. 5, (8), e12148 (2010).
  18. Hanna, J., et al. Human embryonic stem cells with biological and epigenetic characteristics similar to those of mouse ESCs. Proceedings of the National Academy of Sciences of the United States of America. 107, (20), 9222-9227 (2010).
  19. Saha, K., et al. Surface-engineered substrates for improved human pluripotent stem cell culture under fully defined conditions. Proceedings of the National Academy of Sciences of the United States of America. 108, (46), 18714-18719 (2011).
  20. Tsutsui, H., et al. An optimized small molecule inhibitor cocktail supports long-term maintenance of human embryonic stem cells. Nature Communications. 2, 167 (2011).
  21. Xu, Y., et al. Revealing a core signaling regulatory mechanism for pluripotent stem cell survival and self-renewal by small molecules. Proceedings of the National Academy of Sciences of the United States of America. 107, (18), 8129-8134 (2010).
  22. Ungrin, M. D., Joshi, C., Nica, A., Bauwens, C., Zandstra, P. W. Reproducible, ultra high-throughput formation of multicellular organization from single cell suspension-derived human embryonic stem cell aggregates. PLoS ONE. 3, (2), e1565 (2008).
  23. Kim, D. S., et al. Highly pure and expandable PSA-NCAM-positive neural precursors from human ESC and iPSC-derived neural rosettes. PLoS ONE. 7, (7), e39715 (2012).
  24. Sun, Y., Hu, J., Zhou, L., Pollard, S. M., Smith, A. Interplay between FGF2 and BMP controls the self-renewal, dormancy and differentiation of rat neural stem cells. Journal of Cell Science. 124, (Pt 11), 1867-1877 (2011).
  25. Zhou, J. M., Chu, J. X., Chen, X. J. An improved protocol that induces human embryonic stem cells to differentiate into neural cells in vitro. Cell Biology International. 32, (1), 80-85 (2008).
  26. Smith, J. R., et al. Inhibition of Activin/Nodal signaling promotes specification of human embryonic stem cells into neuroectoderm. Developmental Biology. 313, (1), 107-117 (2008).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics