Diferenciación neuronal eficiente utilizando el cultivo monocelular de células madre embrionarias humanas

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Aquí se presenta un protocolo para la generación de un cultivo de una sola célula de células madre embrionarias humanas y su posterior diferenciación en células progenitoras neuronales. El protocolo es simple, robusto, escalable y adecuado para aplicaciones de detección de drogas y medicina regenerativa.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Jeon, K., Park, K., Jetten, A. M. Efficient Neural Differentiation using Single-Cell Culture of Human Embryonic Stem Cells. J. Vis. Exp. (155), e60571, doi:10.3791/60571 (2020).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

La diferenciación in vitro de células madre embrionarias humanas (HESC) ha transformado la capacidad de estudiar el desarrollo humano a nivel biológico y molecular y ha proporcionado células para su uso en aplicaciones regenerativas. Los enfoques estándar para el cultivo de hESC utilizando el cultivo de tipo colonia para mantener los hESC indiferenciados y la formación de rosetas y cuerpo embrionario (EB) para la diferenciación en diferentes capas germinales son ineficientes y consumen mucho tiempo. Aquí se presenta un método de cultivo de una sola célula que utiliza hESC en lugar de una referencia cultural de tipo colonia. Este método permite el mantenimiento de las características características de los hESC indiferenciados, incluida la expresión de marcadores hESC a niveles comparables a los hESC de tipo colonia. Además, el protocolo presenta un método eficaz para la generación de células progenitoras neuronales (NPC) a partir de hESC de tipo de una sola célula que produce NPC dentro de 1 semana. Estas células expresan altamente varios genes marcadores NPC y pueden diferenciarse en varios tipos de células neurales, incluyendo neuronas dopaminérgicas y astrocitos. Este sistema de cultivo de una sola célula para hESCs será útil para investigar los mecanismos moleculares de estos procesos, estudios de ciertas enfermedades y pantallas de descubrimiento de fármacos.

Introduction

Las células madre embrionarias humanas (HESC) tienen el potencial de diferenciarse en las tres capas primarias de gérmenes, que luego se diferencian en varios linajes de células progenitoras multipotentes. Estos linajes posteriormente dan lugar a todos los tipos de células en el cuerpo humano. Los sistemas de cultivo hESC in vitro han transformado la capacidad de estudiar el desarrollo embrionario humano y han servido como una valiosa herramienta para obtener nuevos conocimientos sobre cómo estos procesos se regulan a nivel biológico y molecular. Del mismo modo, los estudios de células madre pluripotentes inducidas (IPSC) generadas a partir de la reprogramación de células somáticas aisladas de pacientes humanos proporcionan nuevos conocimientos sobre diversas enfermedades. Además, el progenitor y las células diferenciadas derivadas de los HEC pueden ser útiles para la investigación que involucra terapia con células madre y detección de drogas1,2,3,4.

Los hESC se pueden inducir a diferenciarse en células progenitoras neuronales (NCC), que son células multipotenciales con una amplia capacidad de autorenovación. Posteriormente, estas células se pueden diferenciar en neuronas, astrocitos y oligodendrocitos5,6. Los PNJ también ofrecen un sistema celular para estudios in vitro de biología del neurodesarrollo y diversas enfermedades neurológicas. Sin embargo, los métodos actuales de cultivo de tipo colonia que implican heSC y su diferenciación en NNP son ineficientes y a menudo implican cocultivo, así como formación de cuerpo embrionario (EB) y formación de rosetas5,7,8,9. Estos protocolos presentan tasas de supervivencia más bajas y diferenciación espontánea y consumen más tiempo.

Aquí se presenta un sistema de cultivo mejorado y robusto que es fácilmente escalable y utiliza el cultivo de tipo de una sola célula de alta densidad de hESCs10. La inclusión del inhibidor de la roh-quinasa (ROCK) contribuyó a mejorar significativamente la eficiencia de supervivencia durante el cultivo de tipo de célula única de hESC10,11,12,13,14. En este sistema de cultivo, los hESC se pueden mantener y ampliar fácilmente. Además, el protocolo presenta un método eficiente para generar PNJ a partir del cultivo de tipo de una sola célula de hESC, lo que permite la producción de PNJ altamente puros.

En resumen, el protocolo de cultivo de tipo de una sola célula que utiliza hESCs ofrece un modelo atractivo para estudiar la diferenciación de estas células en varios linajes, incluidos los PNJ. Este protocolo es fácilmente escalable y por lo tanto adecuado para generar células para la investigación que involucra terapia regenerativa y cribado de drogas.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Preparación de placas recubiertas de matriz de membrana de sótano calificadas por hESC

  1. Descongelar lentamente la matriz de membrana de sótano calificada por hESC (ver Tabla de Materiales)solución a 4 oC durante al menos 2-3 h o durante la noche para evitar la formación de un gel.
  2. Para preparar placas recubiertas con matriz de membrana de sótano, diluya la matriz en frío DMEM/F12 a una concentración final del 2%. Mezclar bien y cubrir cada pocal de una placa de 6 pocillos con 1 ml de la solución de matriz diluida.
  3. Incubar las placas recubiertas con matriz de membrana del sótano a temperatura ambiente (RT) durante al menos 3 h o a 4 oC durante la noche.
    NOTA: Las placas con matriz de membrana de sótano se pueden almacenar a 4 oC durante 1 semana antes de retirar la solución de matriz y utilizar las placas.

2. Adaptación de los hESC de tipo Colonia a la cultura hESC de una sola célula

  1. Para pasar los cultivos libres de comederos de los heSC de tipo colonia H9 (WA09) cultivados en la matriz de membrana del sótano, aspirar el medio de los pozos(Figura 1A)9.
  2. Lavar 1x con 1 mL de DPBS. Añadir 1 ml de solución de dosificación (1 U/ml) por poca e incubar a 37oC durante 20 min.
  3. Retire la dosis, lave las células 1x suavemente con 2 ml de DMEM/F12, retire el medio y agregue 2 ml de DMEM/F12 a cada placa.
  4. Separe suavemente las colonias pipeteando suavemente hacia arriba y hacia abajo y transfiera a un tubo de 15 ml.
  5. Centrifugar los pellets durante 2 min a 370 x g y aspirar el medio.
  6. Para disociar los gránulos celulares en células individuales, añadir 2 ml de solución de desprendimiento celular (1x concentración, ver Tabla de materiales)e incubar a 37 oC durante 10 min.
  7. Células centrífugas durante 2 min a 370 x g y retire la solución de desprendimiento.
  8. Agregue el medio ESC humano mTeSR1 fresco y disocia las células en células individuales mediante un suave pipeteo hacia arriba y hacia abajo.
  9. Para adaptar los hESC de tipo colonia a un cultivo de tipo de una sola célula, placa aproximadamente 1,5–2,0 x 106 hESC en cada pocel de la placa de 6 pocillos recubiertos con matriz de membrana del sótano en 2 ml de mTeSR1 que contiene 10 m de inhibidor de ROCK para 24 h(Figura 1A).
  10. Después de 24 h, reemplace el medio hESC por mTeSR1 fresco sin inhibidor DE ROCK y permita que los hESC crezcan como un tipo de una sola célula durante 3 días. Cambia el medio a diario.
  11. En el día 4, cuando los cultivos alcanzan casi el 100% de confluencia, disocia las células en la solución de desprendimiento, luego se vuelve a enredar como se describe en el paso 2.6.
    NOTA: El inhibidor DE ROCK mejora la supervivencia celular durante las 24 horas iniciales del cultivo hESC de tipo de una sola célula.

3. Formación y diferenciación del cuerpo embrioide en tres capas de gérmenes (Figura 2)

  1. Para formar EBs, primero resuspenda las células en 3 ml de medio mTeSR1 con inhibidor de 10 M ROCK durante las primeras 24 horas, luego incubadurante durante la noche en platos de fijación baja de 60 mm en una incubadora de 37 oC para permitir la agregación.
  2. Después de 24 h, los pequeños EB se transfieren a un tubo de 15 ml. Deje que los EB se asienten en la parte inferior del tubo y retire suavemente el medio con una pipeta. Transfiera los EB s a un medio EB (knockout-DMEM complementado con un 20% de reemplazo sérico, 1 x suplemento de glutamina [ver Tabla de Materiales],1% NEAA [aminoácidos no esenciales; ver Tabla de Materiales],y 0,2% de mercaptoetanol) y permitirles expandirse en platos de baja fijación durante 7 días. El medio se puede cambiar cada dos días como se describió anteriormente(Figura 2A).
  3. El día 7, recoger los EB s de los platos y transferirlos a un tubo de 15 ml. Retire suavemente el medio con una pipeta y transfiera los EB a una placa de 6 pocillos recubierta con matriz de membrana de sótano.
  4. Permitir que los EB se adhieran a la placa e incuban durante 12 días en medio EB, durante los cuales se diferenciarán en las tres capas germinales(Figura 2B). Cambia el medio cada dos días.
    NOTA: Durante la agregación de células, la placa de unión baja ayuda a evitar la fijación de EB.

4. Diferenciación de hESC de tipo de una sola célula en NNP(Figura 3)

  1. Para inducir la diferenciación de NPC, disociar los hESC de tipo una sola célula con 1 ml de solución de desprendimiento (1x) e incubar durante 10 min a 37oC.
  2. Centrifugar las células durante 2 min a 370 x g y retire el sobrenadante de solución de desprendimiento. Agregue 1 ml de DMEM/F12 y vuelva a suspender las células mediante pipeteo suave.
  3. Células de placa en una placa de 6 pocillos recubiertas con matriz de membrana de sótano a una densidad de 2 x 105 células/pozo en 2 ml de mTeSR1 que contiene 10 m de inhibidor DE ROCK.
  4. Después de 24 h, sustituya el medio de cultivo por medio de inducción neuronal (DMEM con 1% B27 menos vitamina A) complementado con 1 M de dorsomorforina y 5 M SB431542.
  5. Cambiar el medio cada dos días durante los primeros 4 días de inducción neuronal, luego todos los días hasta alcanzar la confluencia en el día 7 (Figura 3B).
    NOTA: (1) La dorsomorfina inhibe la vía BMP apuntando a los receptores ALK2,3,6 y también inhibe AMPK; SB431542 es un inhibidor de la vía TGF/Activin dirigiéndose a ALK5,7. (2) El mismo protocolo fue probado con otra línea ESC (WA01), que produjo resultados similares a WA0916. (3) Hemos utilizado generalmente Matrigel para la matriz de membrana del sótano; sin embargo, las células se pueden cultivar en Geltrex y luego diferenciarse en PNJ con resultados muy similares como se indica por la expresión de varios marcadores NPC(Figura 4D,E). Manipule Geltrex de la misma manera que Matrigel (ver sección 1).

5. Expansión y criopreservación de NPC

  1. Después de 7 días de inducción neuronal, disociar las células con 1 ml de solución de desprendimiento (1x) e incubar durante 10 min a 37oC.
  2. Centrifugar las células durante 2 min a 370 x g y retire el sobrenadante de solución de desprendimiento. Agregue 1 ml de medio de expansión NPC (ver Tabla de materiales)y resuspenda las células mediante pipeteo suave.
  3. Placa 1 x 105 células en 2 ml de medio de expansión NPC en placas de 6 pocillos recubiertas con matriz de membrana de sótano.
  4. Pasaje NPCs varias veces, según sea necesario, cuando las culturas alcanzan casi 90% de confluencia. Durante los primeros 3-4 pasajes, agregue el inhibidor de 10 M ROCK durante las 24 horas iniciales para evitar la muerte celular. Después de estos pasajes, las células se pueden pasar y cultivar sin inhibidor de ROCK. Cambie el medio cada dos días durante la expansión.
  5. Crioconserva los PNJ cuando las culturas alcancen la confluencia.
    1. Para la criopreservación, disociar las células en 1 ml de solución de desprendimiento (1x) durante 5 min a 37 oC, luego la suspensión centrífuga durante 2 min a 370 x g para eliminar la solución de desprendimiento.
    2. Añadir solución de congelación de células (ver Tabla de Materiales)a Los PNJ disociados a 1 x 106 células/ml y distribuir 1 mL de alícuotas a crioviales.
    3. Colocar los crioviales en un recipiente de congelación y guardarlos durante la noche en un congelador de -80 oC.
  6. Almacene los crioviales en el nitrógeno líquido.

6. Preparación de poli-L-ornitina (PLO) y placas recubiertas de Laminin

  1. Para preparar placas recubiertas de OLP/laminina, diluya la solución de material de la OLP en PBS o agua hasta una concentración final de 10 g/ml. Mezclar bien y cubrir cada pocal de una placa de 6 pocillos con 1 ml de solución de OLP diluida.
  2. Incubar durante al menos 2 h a 37 oC o durante la noche a 4oC.
  3. Lave cada pocáea con PBS.
  4. Diluir la solución de laminina en PBS frío o agua a 10 g/ml. Mezclar bien la solución laminina. Retire el PBS y cubra inmediatamente cada pocón con 1 ml de la solución laminina. Conservar las placas a 4oC y utilizarlas en 1 semana. Lavar con PBS y añadir inmediatamente un medio de cultivo.
    NOTA: No deje que las placas recubiertas de OLP/laminina se sequen.

7. Diferenciación de PNJ derivados de hESC en neuronas dopaminérgicas (Figura 6A)

  1. Placa NpCs en platos recubiertos de OLP/laminines en medio de expansión NPC a una densidad de aproximadamente 50%.
  2. Después de 24 h, cambiar el medio a medio DA1 (medio neurobasal que contiene 2 mM de suplemento de glutamina, 1x NEAA, 1x B27, 200 ng/mL SHH, y 100 ng/mL FGF8) y cambiar el medio cada dos días.
  3. Pasar culturas cuando alcanzan la confluencia. Disociar las células con 1 ml de solución de desprendimiento (1x) e incubar durante 10 min a 37oC.
  4. Centrifugar las células durante 2 min a 370 x g y retire el sobrenadante de solución de desprendimiento. Añadir 1 mL de medio DA1 y resuspender las células mediante pipeteo suave.
  5. Placa 1 x 105 células en 2 mL de medio DA1 en placas de pozo sacadas por OLP/laminina.
  6. Después de 10 días, cambie a medio DA2 (medio neurobasal que contiene 2 mM de suplemento de glutamina, 1x NEAA, 1x B27, 200 m de ácido ascórbico, 20 ng/ml BDNF y 20 ng/mL GNDF) y cambie el medio cada dos días durante 20 días adicionales(Figura 6A).
    NOTA: Agregue ácido ascórbico fresco diariamente al medio DA2. Dentro de los primeros 14 días, las células diferenciadas deben pasarse cuando alcanzan una confluencia del 90%, pero ya no después de eso.

8. Diferenciación de los PNJ derivados de la ESC en Astrocitos

  1. Células progenitoras neuronales de placas en placas recubiertas de OLP/lamininen en medio de expansión NPC a una densidad de aproximadamente el 50%.
  2. Después de las 24 h, cambie el medio a medio de astrocito (medio DMEM/F12 incluyendo 1:100 N2, 1:100 B27, 200 ng/mL IGF, 10 ng/mL activin A, 10 ng/mL heregulin-1, y 8 ng/mL bFGF) y cambie el medio cada dos días.
  3. Pasar culturas cuando alcanzan la confluencia. Disociar las células con 1 ml de solución de desprendimiento (1x) e incubar durante 10 min a 37oC.
  4. Centrifugar las células durante 2 min a 370 x g y retire el sobrenadante de solución de desprendimiento. Añadir 1 ml de medio de astrocito y resuspender las células mediante pipeteo suave.
  5. Placa 1 x 105 células en 2 ml de medio de astrocito en OLP/laminina recubierta de 6 platos de pozos.
  6. Permitir que la diferenciación continúe durante un total de 5-6 semanas(Figura 6B).

9. Mancha de inmunofluorescencia

  1. Células de cultivo en platos de 35 mm como se describió anteriormente para cada tipo de célula. Aspirar el medio y añadir 1 mL de solución de PCA al 4% por plato e incubar durante 20 min a RT.
  2. Lavar 2x durante 5 min con PBS.
    NOTA: Una vez fijadas las células, las placas de ensayo se pueden sellar con parafilm y almacenarse a 4 oC. Mancha con un anticuerpo dentro de 1 semana después de la fijación.
  3. Añadir 300 l de solución de bloqueo (cabra o suero de burro en PBS) por plato e incubar a RT durante 30-60 min.
  4. Lave el plato 2x con PBS durante 5 min.
  5. Añadir 300 l de solución de anticuerpos primarios(Tabla 1) (diluido en solución de bloqueo) e incubar a RT durante 1,5 h o durante la noche a 4oC.
  6. Lavar 2x con PBS durante 10 min.
  7. Añadir 300 sl de anticuerpo secundario conjugado fluorescente(Tabla 1) en la solución de bloqueo e incubar en la oscuridad durante 1 h a RT.
  8. Lavar las células 2veces durante 10 min con PBS.
  9. Añadir la solución de tinción Hoechst (concentración final de 1 M en PBS) a los núcleos de manchas. Incubar las células en la oscuridad durante 5 minutos a RT.
  10. Lave las células 1x con PBS durante 5 min y luego agregue 500 s de PBS. Mantenga los platos en la oscuridad, luego observe la fluorescencia con un microscopio confocal(Figura 2B, Figura 5C, Figura 6Ay Figura 7B).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Aquí se presenta un protocolo mejorado para el mantenimiento y la expansión del cultivo de tipo de una sola célula de hESC y su diferenciación eficiente en células progenitoras neuronales, que posteriormente se diferencia en varios linajes neuronales aguas abajo, incluyendo neuronas dopaminérgicas y astrocitos.

Las imágenes representativas de contraste de fase muestran la morfología celular en diferentes pasos durante la adaptación de los hESC de tipo colonia al cultivo de tipo de una sola célula (Figura 1A). A través de la condición de cultivo de una sola célula, se encontró que los hESC adaptados eran capaces de mantenerse a alta densidad, luego subcultureados fácil y eficientemente al alcanzar la confluencia(Figura 1A,B). Estas células retuvieron las características del ciclo celular (es decir, una fase G1 corta y una alta proporción de células en fase S) típicas de los hESC de tipo colonia(Figura 1C,D). También expresaron los marcadores ESC (es decir, OCT4, TRA 1-81, SOX2 y NANOG) a niveles comparables a los de los hESC de tipo colonia, como indica QRT-PCR y análisis de inmunostaining(Figura 7, Tabla 2). Además, se demostró que los hESC de una sola célula eran capaces de formar cuerpos embrionarios que contenían células de las tres capas germinales: endoderm (expresión SOX17), mesoderm (expresión SMA) y ectoderm (expresión Tuj-1) (Figura 2).

A continuación, se demostró que los hESC de tipo de una sola célula se diferenciaban eficientemente en células progenitoras neuronales utilizando un protocolo NPC(Figura 3A),como lo indica la pérdida de morfología típica de hESC y la apariencia de morfología NPC(Figura 3B)16. La diferenciación de NPC fue apoyada por el aumento de la expresión de los marcadores NPC de firma (es decir, SOX1, OTX2, ZIC1 y OTX1; Figura 5A, Tabla 2) y confirmada por inmunomancha y análisis FACS. El mismo análisis también mostró que más del 90% de las células manchadas positivas para la proteína SOX1, PAX6 y NCAM(Figura 5B,C). Para examinar la capacidad de los PNJ derivados del hESC de una sola célula para diferenciarse en varios linajes neuronales aguas abajo, se examinó la diferenciación de estas células en neuronas dopaminérgicas y astrocitos. Como se muestra en la Figura 6A,B,los PNJ derivados del hESC de una sola célula fueron capaces de diferenciarse en neuronas dopaminérgicas y astrocitos, como lo indica la aparición de morfologías características y la expresión de marcadores dopaminérgicos específicos del linaje (es decir, TH; Figura 6A) y marcadores de astrocitos (es decir, GFAP y S100B; Figura 6B).

Figure 1
Figura 1: Adaptación de los hESC de tipo de colonia a la referencia cultural de tipo de una sola célula. (A) Imágenes de contraste de fase representativa de cultivos de células únicas de hESC en diferentes momentos después de chapar en platos recubiertos con matriz de membrana de sótano del 2%. Aumento bajo (izquierda) y alto (derecha). Panel superior: imagen representativa del tipo de colonia hESCs. Otros paneles muestran imágenes representativas de las culturas en diferentes momentos durante la adaptación a los hESC de tipo de una sola célula. Barra de escala a 200 m. (B) Las curvas de crecimiento de los hESC H9 se monitorizaron en placas recubiertas con matriz de membrana de sótano del 2% con inhibidor de ROCK de 10 m durante las primeras 24 horas durante la condición de cultivo de una sola célula. (C,D) Análisis del ciclo celular del tipo de colonia (C) y tipo de una sola célula (D) H9 hESC sportometría por flujo de citometría. Haga clic aquí para ver una versión más grande de esta figura.

Figure 2
Figura 2: Diferenciación in vitro de hESCs de tipo monocélula adaptados en tres capas germinales. (A) Imágenes representativas en fase de los cuerpos embrionarios (EB) derivadas del tipo de célula única de los HESC. Barra de escala a 100 m. (B) Imágenes inmunofluorescentes de hESC diferenciados analizadas para la expresión de los tres marcadores de capa germinal diferentes: SOX17 (endoderm), SMA (mesoderm) y Tuj-1 (ectoderm). Los núcleos se mancharon con DAPI. Barra de escala a 50 m. Haga clic aquí para ver una versión más grande de esta figura.

Figure 3
Figura 3: Diferenciación de hESC de tipo de una sola célula en células progenitoras neuronales por diferenciación directa. (A) Esquema del protocolo de diferenciación de los HECC en células progenitoras neuronales (NPM). los hESC se trataron con dorsomorfina (DMH) y SB431542 (SB) 1 día después del enchapado. (B) Imágenes representativas de contraste de fase de morfología celular durante la diferenciación neuronal. Barra de escala a 200 m. Haga clic aquí para ver una versión más grande de esta figura.

Figure 4
Figura 4: cultivo hESC en diferentes productos de matriz de membrana de sótano. (A) hESC cultivados en Matrigel o Geltrex exhibieron una capacidad para crecer y diferenciarse en PNJ que era similar a la cultura celular única. Las células se tiñieron con un anticuerpo NESTIN. Los núcleos se mancharon con DAPI. Barra de escala a 50 m. (B) los hESC cultivados en Matrigel o Geltrex mostraron un potencial similar para diferenciarse en PNJ, como indica el porcentaje de células positivas NESTIN y PAX6. Las células fueron analizadas por citometría de flujo en el día 7 de diferenciación de NPC. Haga clic aquí para ver una versión más grande de esta figura.

Figure 5
Figura 5: Expresión de marcadores NPC. (A) Después de 7 días de diferenciación neuronal, QRT-PCR analizó la expresión de genes marcadores NPC (es decir, OTX1, OTX2, SOX1 y ZIC1). Los valores se normalizaron en GAPDH y se calcularon en relación con los valores de los HESC (p < 0,05). (B) El porcentaje de células positivas SOX1, NESTIN, SOX2 y NCAM se determinó mediante citometría de flujo en el día 7 de diferenciación de NPC. ( C ) Eneldía 7 diferenciación NPC, las células se tiñieron con anticuerpos contra los marcadores neurales SOX1, NESTIN, NCAM, OTX2 y PAX6. Los núcleos se mancharon con DAPI. Barra de escala a 100 m. Haga clic aquí para ver una versión más grande de esta figura.

Figure 6
Figura 6: Diferenciación de neuronas dopaminérgicas y astrocitos de los PNJ derivados de hESC de tipo de una sola célula. (A) Imagen de contraste de fase representativa de las neuronas dopaminérgicas (panel superior). Barra de escala a 100 m. Las células diferenciadas se teñieron con anticuerpos contra el marcador de neurona dopaminérgica TH (tirosina hidroxilasa) como se indica. Los núcleos se mancharon con DAPI. Barra de escala a 50 m. (B) Imagen representativa del contraste de fase de los astrocitos (panel superior). Barra de escala a 100 m. Las células diferenciadas se teñieron con anticuerpos contra el marcador de astrocito s'FERAP (proteína ácida fibrilar glial) y S100-B (proteína de unión al calcio S100 B), como se indica. Los núcleos se mancharon con DAPI. Barra de escala a 50 m. Haga clic aquí para ver una versión más grande de esta figura.

Figure 7
Figura 7: Caracterización de hESC de tipo de celda única. (A) hESC adaptados al cultivo de tipo de una sola célula se analizaron para la expresión de marcadores ESC (es decir, OCT4, NANOG y SOX2) por QRT-PCR. Los valores se normalizaron a GAPDH (p < 0.05). (B) Imágenes inmunofluorescentes de hESC sintidas para la expresión de los marcadores de pluripotencia OCT4, TRA-1-81 y SSEA-1. Los núcleos se mancharon con DAPI. Barra de escala a 50 m. Haga clic aquí para ver una versión más grande de esta figura.

Anticuerpos primarios Especies Dilución Número de catálogo Empresa
OCT4 Ratón 1:1000 sc-5279 Santa Cruz
TRA 1-81 Ratón 1:500 sc-21706 Santa Cruz
SSEA-1 Ratón 1:500 sc-21702 Santa Cruz
SOX1 Cabra 1:500 AF-3369 I+D
SOX2 Conejo 1:1,000 sc-20088 Santa Cruz
Sma Conejo 1:500 ab-5694 Abcam
Tuj1 Ratón 1:1000 T8578 Sigma
NESTIN Ratón 1:1000 ab-22035 Abcam
OTX2 Ratón 1:250 ab-21990 Abcam
hNCAM Ratón 1:200 sc-106 Santa Cruz
hPAX6 Ratón 1:250 561664 Bd
TH Ratón 1:500 T1299 Sigma
S100b Ratón 1:250 ab4066 Abcam
Gfap Conejo 1:1,000 ab7260 Abcam
Anticuerpos secundarios
Anti-ratón Cabra 1:1,000 AF 488 o 647 Tecnologías de la vida
Anticonejo Cabra 1:1,000 AF 488 o 647 Tecnologías de la vida

Tabla 1: Anticuerpos utilizados en inmunocitoquímica y análisis FACS.

Primer nombre Secuencia de imprimación
OCT4 F: GGAAGGTATTCAGCCAAACG
R: CTCCAGGTTGCCTCTCACTC
Nanog F: GGTTCCAGAACCAGAGAATGA
R: ATTGGAAGGTTCCCAGTCG
SOX1 F: CCTTAGGTTTCCCCTCTCTTTT
R: CAGGCTGAATTCGGTTCTCATT
OTX1 F: AAGATCAACCTGCCGGAGTCT
R: CGTGAATTGGCCACTGCTTTT
OTX2 F: TGGAAGCACTGTTTGCCAAG
R: TAAACCATACCTGCACCCTCG
ZIC1 F: AACCCCAAAAAGTCGTGCAAC
R: TCCTCCCAGAAGCAGATGTGA
Gapdh F: CCCATCACCATCTTCCAGGAG
R: CTTCTCCATGGTGTGAAGACG

Tabla 2: Lista de imprimaciones utilizadas en el análisis QRT-PCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Los métodos escalables y eficientes para la diferenciación de los HEC en varios linajes y la generación de un número suficiente de células diferenciadas son criterios importantes para la detección de fármacos y la terapia con células madre. Se han publicado varios métodos de paso de una sola célula, en los que las células se cultivan en presencia de inhibidores de LA NAdo u otras moléculas pequeñas para mejorar la supervivencia, pero los productos finales de estos métodos de cultivo son los hESC de tipo colonia17,18,19,20,21. El protocolo ESC de una sola célula, que se basa parcialmente en los métodos publicados anteriormente19,20,21,22, genera y mantiene con éxito cultivos hESC de tipo de celda única y evita la referencia cultural hESC de tipo de colonia. Incluye chapado de una sola célula de alta densidad, asociación multicelular, crecimiento monocapa y subcultura eficiente (Figura 1). Este último se logró mediante la adición de inhibidor DE ROCK durante las 24 h iniciales del cultivo tipo de una sola célula de los HESC, lo que mejora la supervivencia celular17,18,19,20,21. Este protocolo es más fácilmente escalable y permite la expansión de estas células para aplicaciones terapéuticas en el cribado de fármacos y células madre.

Se ha demostrado además que los hESC de tipo de una sola célula pueden diferenciarse eficientemente con el linaje NPC(Figura 3)sin utilizar una etapa intermedia, como la formación de EB y roseta23,24,25. La alta conversión neuronal de los hESC de tipo de una sola célula se logró mediante la inhibición de las vías de señalización BMP/TGF/activina mediante tratamiento con los inhibidores de la ALK, la dorsomorfina y la SB43154215,16,26. Con este protocolo, los hESC de tipo de una sola célula adaptados pueden diferenciarse eficientemente en PNJ sin necesidad de formación de EB y roseta(Figura 5)y o ser inducidos a diferenciarse en neuronas dopaminérgicas y astrocitos(Figura 6).

En resumen, el cultivo de tipo de una sola célula de los hESC proporciona un sistema rápido y eficiente para estudiar los mecanismos moleculares que regulan la diferenciación multipaso a varios linajes. Específicamente, este protocolo utilizó NNP y describió su posterior diferenciación en linajes neuronales adicionales, como astrocitos y neuronas dopaminérgicas. El protocolo proporciona una plataforma para la producción simple, robusta y escalable de células progenitoras y diferenciadas que pueden ser adecuadas para estudios básicos, pruebas de detección de drogas y aplicaciones en medicina regenerativa.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores no declaran conflictos de intereses.

Acknowledgments

Agradecemos al Dr. Carl D. Bortner (NIEHS) por su asistencia con el análisis FACS. Esta investigación fue apoyada por el Programa de Investigación Intramuros del Instituto Nacional de Ciencias de la Salud Ambiental, los Institutos Nacionales de Salud, Z01-ES-101585 a AMJ.

Materials

Name Company Catalog Number Comments
35 mm m-dishes ibidi 81156 Cell culture dish
6-well plates Corning 3516
Accutase Innovative Cell Technologies AT104-500 Cell detachment solution
Activin A R&D system 338-AC-050
Ascorbic Acid Sigma Aldrich A4403
B27 supplement Thermo Fisher 17504044
B27 supplement (-Vit A) Thermo Fisher 12587010
BDNF Applied Biological Materials Z100065
bFGF Peprotech 100-18C
Centrifuge DAMON/ICE 428-6759
CO2 incubator Thermo Fisher 4110
Corning hESC-qulified Matrix (Magrigel) Corning 354277 Basement membrane matrix (used for most of the protocol here)
Cryostor CS 10 Stemcell Technologies 7930 Cell freezing solution
Dispase Stemcell Technologies 7923
DMEM Thermo Fisher 10569-010
DMEM/F12 Thermo Fisher 10565-018
Dorsomorphin Tocris 3093
EGF Peprotech AF-100-16A
Fetal Bovine Serum Fisher Scientific SH3007003HI
FGF8 Applied Biological Materials Z101705
GDNF Applied Biological Materials Z101057
Geltrex matrix Thermo Fisher A1569601 Basement membrane matrix
GlutaMax Thermo Fisher 35050061 Glutamine supplement, 100X
H9 (WA09) human embryonic stem cell line WiCell WA09
Heregulin b-1 Peprotech 100-3
IGF Peprotech 100-11
Knockout DMEM Thermo Fisher 10829018
Knockout Serum Replacement Thermo Fisher 10828028
Laminin Sigma Aldrich L2020
mTeSR1 Stemcell Technologies 85850 hESC culture medium
N2 supplement Thermo Fisher 17502001
NEAA Thermo Fisher 11140050
Neurobasal Thermo Fisher 21103049
Poly-L-ornithine Sigma Aldrich P3655
ROCK inhibitor Tocris 1254
SB431542 Tocris 1614
SHH Applied Biological Materials Z200617
Stemdiff Neural Progenitor medium Stemcell Technologies 5833 NPC expansion medium

DOWNLOAD MATERIALS LIST

References

  1. Thomson, J. A., et al. Embryonic stem cell lines derived from human blastocysts. Science. 282, (5391), 1145-1147 (1998).
  2. Rosler, E. S., et al. Long-term culture of human embryonic stem cells in feeder-free conditions. Developmental Dynamics. 229, (2), 259-274 (2004).
  3. Mallon, B. S., Park, K. Y., Chen, K. G., Hamilton, R. S., McKay, R. D. Toward xeno-free culture of human embryonic stem cells. The International Journal of Biochemistry & Cell Biology. 38, (7), 1063-1075 (2006).
  4. Hoffman, L. M., Carpenter, M. K. Characterization and culture of human embryonic stem cells. Nature Biotechnology. 23, (6), 699-708 (2005).
  5. Yan, Y., et al. Efficient and rapid derivation of primitive neural stem cells and generation of brain subtype neurons from human pluripotent stem cells. Stem Cells Translational Medicine. 2, (11), 862-870 (2013).
  6. Goncalves, J. T., Schafer, S. T., Gage, F. H. Adult Neurogenesis in the Hippocampus: From Stem Cells to Behavior. Cell. 167, (4), 897-914 (2016).
  7. Watanabe, K., et al. A ROCK inhibitor permits survival of dissociated human embryonic stem cells. Nature Biotechnology. 25, (6), 681-686 (2007).
  8. International Stem Cell Initiative. Characterization of human embryonic stem cell lines by the International Stem Cell Initiative. Nature Biotechnology. 25, (7), 803-816 (2007).
  9. Hartung, O., Huo, H., Daley, G. Q., Schlaeger, T. M. Clump passaging and expansion of human embryonic and induced pluripotent stem cells on mouse embryonic fibroblast feeder cells. Current Protocols in Stem Cell Biology. 14, (1), Chapter 1 Unit 1C 10 (2010).
  10. Chen, K. G., et al. Non-colony type monolayer culture of human embryonic stem cells. Stem Cell Research. 9, (3), 237-248 (2012).
  11. Chen, G., Hou, Z., Gulbranson, D. R., Thomson, J. A. Actin-myosin contractility is responsible for the reduced viability of dissociated human embryonic stem cells. Cell Stem Cell. 7, (2), 240-248 (2010).
  12. Li, X., Krawetz, R., Liu, S., Meng, G., Rancourt, D. E. ROCK inhibitor improves survival of cryopreserved serum/feeder-free single human embryonic stem cells. Human Reproduction. 24, (3), 580-589 (2009).
  13. Ohgushi, M., et al. Molecular pathway and cell state responsible for dissociation-induced apoptosis in human pluripotent stem cells. Cell Stem Cell. 7, (2), 225-239 (2010).
  14. Pakzad, M., et al. Presence of a ROCK inhibitor in extracellular matrix supports more undifferentiated growth of feeder-free human embryonic and induced pluripotent stem cells upon passaging. Stem Cell Reviews and Reports. 6, (1), 96-107 (2010).
  15. Chambers, S. M., et al. Highly efficient neural conversion of human ES and iPS cells by dual inhibition of SMAD signaling. Nature Biotechnology. 27, (3), 275-280 (2009).
  16. Jeon, K., et al. GLIS3 Transcriptionally Activates WNT Genes to Promote Differentiation of Human Embryonic Stem Cells into Posterior Neural Progenitors. Stem Cells. 37, (2), 202-215 (2019).
  17. Emre, N., et al. The ROCK inhibitor Y-27632 improves recovery of human embryonic stem cells after fluorescence-activated cell sorting with multiple cell surface markers. PLoS ONE. 5, (8), e12148 (2010).
  18. Hanna, J., et al. Human embryonic stem cells with biological and epigenetic characteristics similar to those of mouse ESCs. Proceedings of the National Academy of Sciences of the United States of America. 107, (20), 9222-9227 (2010).
  19. Saha, K., et al. Surface-engineered substrates for improved human pluripotent stem cell culture under fully defined conditions. Proceedings of the National Academy of Sciences of the United States of America. 108, (46), 18714-18719 (2011).
  20. Tsutsui, H., et al. An optimized small molecule inhibitor cocktail supports long-term maintenance of human embryonic stem cells. Nature Communications. 2, 167 (2011).
  21. Xu, Y., et al. Revealing a core signaling regulatory mechanism for pluripotent stem cell survival and self-renewal by small molecules. Proceedings of the National Academy of Sciences of the United States of America. 107, (18), 8129-8134 (2010).
  22. Ungrin, M. D., Joshi, C., Nica, A., Bauwens, C., Zandstra, P. W. Reproducible, ultra high-throughput formation of multicellular organization from single cell suspension-derived human embryonic stem cell aggregates. PLoS ONE. 3, (2), e1565 (2008).
  23. Kim, D. S., et al. Highly pure and expandable PSA-NCAM-positive neural precursors from human ESC and iPSC-derived neural rosettes. PLoS ONE. 7, (7), e39715 (2012).
  24. Sun, Y., Hu, J., Zhou, L., Pollard, S. M., Smith, A. Interplay between FGF2 and BMP controls the self-renewal, dormancy and differentiation of rat neural stem cells. Journal of Cell Science. 124, (Pt 11), 1867-1877 (2011).
  25. Zhou, J. M., Chu, J. X., Chen, X. J. An improved protocol that induces human embryonic stem cells to differentiate into neural cells in vitro. Cell Biology International. 32, (1), 80-85 (2008).
  26. Smith, J. R., et al. Inhibition of Activin/Nodal signaling promotes specification of human embryonic stem cells into neuroectoderm. Developmental Biology. 313, (1), 107-117 (2008).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics