Effektiv neurala differentiering med hjälp av Single-cell kultur av mänskliga embryonala stamceller

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Här presenteras ett protokoll för generering av en encellig kultur av mänskliga embryonala stamceller och deras efterföljande differentiering till neurala stamcells celler. Protokollet är enkelt, robust, skalbar och lämplig för läkemedels screening och regenerativ medicin applikationer.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Jeon, K., Park, K., Jetten, A. M. Efficient Neural Differentiation using Single-Cell Culture of Human Embryonic Stem Cells. J. Vis. Exp. (155), e60571, doi:10.3791/60571 (2020).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

In vitro differentiering av mänskliga embryonala stamceller (hESCs) har förändrat förmågan att studera mänsklig utveckling på både biologiska och molekylära nivåer och som celler för användning i regenerativa tillämpningar. Standard metoder för hESC kultur med hjälp av kolonin typ kultur för att bibehålla odifferentierade hESCs och embryoid kropp (EB) och rosett formation för differentiering i olika köns lagren är ineffektiva och tidskrävande. Här presenteras en encellig kultur metod med hjälp av hESCs istället för en koloni-typ kultur. Denna metod möjliggör underhåll av de karakteristiska dragen i odifferentierade hESCs, inklusive uttryck av hESC markörer på nivåer jämförbara med kolonin typ hESCs. Dessutom, protokollet presenterar en effektiv metod för neurala progenitorceller (NPC) generation från Single-celltyp hESCs som producerar NPC inom 1 vecka. Dessa celler uttrycker högt flera NPC markörgener och kan differentiera till olika neurala celltyper, inklusive dopaminerga neuroner och astrocyter. Detta encellig kultur system för hESCs kommer att vara användbart för att undersöka de molekylära mekanismerna i dessa processer, studier av vissa sjukdomar, och Drug discovery skärmar.

Introduction

Mänskliga embryonala stamceller (hESCs) har potential att differentiera till de tre primära bakterie lagren, som sedan differentieras till olika multipotenta stamcellslinjer. Dessa härstamningar ger därefter upphov till alla celltyper i människokroppen. In vitro har hESC kultur system förändrat förmågan att studera mänsklig embryonal utveckling och har fungerat som ett värdefullt verktyg för att få nya insikter i hur dessa processer regleras på biologisk och molekylär nivå. På samma sätt ger studier av inducerade pluripotenta stamceller (iPSCs) som genereras från omprogrammering av somatiska celler isolerade från mänskliga patienter nya insikter i olika sjukdomar. Dessutom kan stamceller och differentierade celler som härrör från hESCs vara användbara för forskning som involverar stamcellsterapi och läkemedels screening1,2,3,4.

hESCs kan induceras för att differentiera till neurala progenitorceller (NPCs), som är multipotentialceller med en omfattande självförnyelse kapacitet. Därefter kan dessa celler differentieras till nervceller, astrocyter, och oligodendrocyter5,6. NPCs erbjuder också ett cellsystem för in vitro-studier av neuroutvecklingsbiologi och olika neurologiska sjukdomar. Men nuvarande koloni typ kultur metoder som involverar hESCs och deras differentiering i NPC är ineffektiva och ofta involverar samodling samt embryoid kropp (EB) och rosett formation5,7,8,9. Dessa protokoll uppvisar lägre överlevnadsgrad och spontan differentiering och är mer tidskrävande.

Presenteras här är ett förbättrat och robust kultur system som är lätt skalbar och använder hög densitet Single-celltyp kultur av hESCs10. Införandet av Roh-Kinas (Rock) hämmare bidragit till signifikant ökad överlevnad effektivitet under Single celltyp kultur av hESC10,11,12,13,14. I detta kultur system kan hESCs lätt underhållas och utökas. Dessutom utgör protokollet en effektiv metod för att skapa NPC-er från encellig typ kultur av hESCs, som gör det möjligt att tillverka mycket rena NPC: er. hämning av BMP/tgfβ/Activin signalering vägar med ALK-hämmare inducera effektivt differentiering av encellig typ hESCs i NPCs15,16, som sedan kan induceras för att differentiera till funktionella neurala linjer, såsom dopaminerga neuroner och astrocyter.

Sammanfattnings, den Single-celltyp kultur protokoll med hjälp av hESCs erbjuder en attraktiv modell för att studera differentiering av dessa celler i olika linjer, inklusive NPCs. Detta protokoll är lätt att skalbart och lämpar sig därför för att generera celler för forskning som involverar regenerativ terapi och läkemedels screening.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. beredning av hESC-kvalificerade basalmembran Matrix-belagda plattor

  1. Tina långsamt hESC-kvalificerat basalmembran Matrix (se tabell över material) lösning vid 4 ° c i minst 2 – 3 h eller över natten för att undvika bildandet av en gel.
  2. För att förbereda basalmembran matris-belagda plattor, späd matris i kallt DMEM/F12 till en 2% slutkoncentration. Blanda väl och täck varje brunn av en 6 brunn tallrik med 1 mL av den utspädda mat ris lösningen.
  3. Inkubera basalmembranet Matrix-belagda plattor i rumstemperatur (RT) för minst 3 h eller vid 4 ° c över natten.
    Anmärkning: plattor med basalmembran mat ris kan förvaras vid 4 ° c i 1 vecka innan mat ris lösningen avlägsnas och plattorna används.

2. anpassning av kolonin typ hESCs till Single-cell hESC kultur

  1. Att passera Feeder-fria kulturer av kolonin typ H9 (WA09) hESCs odlas på basalmembran matris, aspirera mediet från brunnarna (figur 1A)9.
  2. Tvätta 1x med 1 mL DPBS. Tillsätt 1 ml dispas lösning (1 U/ml) per brunn och inkubera vid 37 ° c i 20 min.
  3. Ta bort dispase, tvätta cellerna 1x försiktigt med 2 mL DMEM/F12, ta bort mediet och tillsätt 2 mL DMEM/F12 till varje tallrik.
  4. Ta försiktigt bort kolonierna genom att försiktigt Pipettera upp och ner och överför till en 15 mL tub.
  5. Centrifugera pelletar för 2 min vid 370 x g och aspirera mediet.
  6. För att separera cell pellets till enstaka celler, tillsätt 2 mL cell avskiljnings lösning (1x koncentration, se tabell över material) och inkubera vid 37 ° c i 10 min.
  7. Centrifugera celler i 2 min vid 370 x g och ta bort avlossning lösning.
  8. Tillsätt färsk mTeSR1 Human ESC medium och separera cellerna i enstaka celler genom att försiktigt Pipettera upp och ner.
  9. För att anpassa kolonin typ hESCs till en enda celltyp kultur, tallrik cirka 1.5 – 2.0 x 106 hESCs i varje brunn i källaren membran Matrix-coated 6 väl plattan i 2 ml mTeSR1 som innehåller 10 μm berg hämmare för 24 h (figur 1a).
  10. Efter 24 h, ersätta hESC medium med färska mTeSR1 utan ROCK inhibitor och låta hESCs att växa som en encellig typ för 3 dagar. Ändra mediet dagligen.
  11. På dag 4, när kulturer når nästan 100% confluency, separera celler i avlossning lösning, sedan replate som beskrivs i steg 2,6.
    Obs: berg hämmaren förbättrar cellöverlevnad under den inledande 24 h av Single-celltyp hESC kultur.

3. embryoid kropps bildning och differentiering i tre bakterie skikt (figur 2)

  1. För att bilda EBs, först Omsuspendera celler i 3 mL mTeSR1 medium med 10 μM ROCK inhibitor under de första 24 h, sedan Inkubera över natten till 60 mm låg tillbehör rätter i en 37 ° c inkubator för att möjliggöra aggregering.
  2. Efter 24 h, de små EBs överförs till en 15 mL tub. Låt EBs sätta sig till botten av röret och försiktigt ta bort mediet med en pipett. Överför EBs till EB medium (Knockout-DMEM kompletteras med 20% knockout serum Replacement, 1x glutamin tillägg [se tabell över material], 1% neaa [icke-essentiella aminosyror; se tabell över material], och 0,2% β-merkaptoetanol) och tillåta dem att expandera i låg tillbehör rätter i 7 dagar. Mediet kan bytas varannan dag enligt beskrivningen ovan (figur 2a).
  3. På dag 7, samla EBs från rätterna och överföra dem till en 15 mL tub. Ta försiktigt bort mediet med en pipett och överför EBs till ett basalmembran Matrix-coated 6 brunn tallrik.
  4. Låt EBs att fästa på plattan och inkubera i 12 dagar i EB medium, under vilken de kommer att differentiera till de tre köns lagren (figur 2B). Ändra mediet varannan dag.
    ANMÄRKNINGAR: under aggregering av celler hjälper den låga bilagans skålen till att undvika EB-infästning.

4. differentiering av encellig typ hESCs i NPCs (figur 3)

  1. För att inducera NPC differentiering, separera encellig typ hESCs med 1 mL avlossning lösning (1x) och inkubera i 10 min vid 37 ° c.
  2. Centrifugera cellerna i 2 min vid 370 x g och ta bort avlossning lösning supernatanten. Tillsätt 1 mL DMEM/F12 och Omsuspendera celler genom skonsam pipettering.
  3. Plattceller på en basalmembran matris-belagd 6 väl tallrik med en densitet av 2 x 105 celler/brunn i 2 ml mTeSR1 som innehåller 10 μm rock inhibitor.
  4. Efter 24 h, ersätta odlingssubstrat med neurala induktion medium (DMEM med 1% B27 minus vitamin A) kompletteras med 1 μM dorsomorphin och 5 μM SB431542.
  5. Ändra mediet varannan dag under de första 4 dagarna av neurala induktion, sedan varje dag tills nå sammanflödet på dag 7 (figur 3B).
    Anmärkning: (1) Dorsomorphin hämmar BMP vägen genom att rikta ALK2, 3, 6 receptorer och även hämmar AMPK; SB431542 är en hämmare av TGFβ/Activin-vägen genom att rikta ALK5, 7. (2) samma protokoll testades med en annan ESC-linje (WA01), vilket gav liknande resultat som WA0916. (3) vi har vanligtvis använt Matrigel för basalmembran matris; men celler kan odlas på Geltrex och sedan differentieras till NPC med mycket liknande resultat som indikeras av uttrycket av flera NPC markörer (figur 4D, E). Hantera Geltrex på samma sätt som Matrigel (se avsnitt 1).

5. NPC expansion och Cryopreservation

  1. Efter 7 dagar av neurala induktion, dissociera celler med 1 mL avlossning lösning (1x) och inkubera i 10 min vid 37 ° c.
  2. Centrifugera cellerna i 2 min vid 370 x g och ta bort avlossning lösning supernatanten. Tillsätt 1 mL NPC expansions medium (se tabell över material) och Omsuspendera celler genom skonsam pipettering.
  3. Tallrik 1 x 105 celler i 2 ml NPC expansions medium på basalmembran matris-belagda 6 bra tallrikar.
  4. Passage NPCs flera gånger, vid behov, när kulturer når nästan 90% confluency. Under de första 3 – 4 passager, tillsätt 10 μM ROCK inhibitor under den initiala 24 h för att förhindra celldöd. Efter dessa passager, celler kan blint och odlas utan rock inhibitor. Ändra mediet varannan dag under expansionen.
  5. Cryopreserve NPCs när kulturer nå sammanlänkning.
    1. För kryopreservation, separera celler i 1 ml avlossning lösning (1x) för 5 min vid 37 ° c, sedan Centrifugera suspensionen för 2 min vid 370 x g för att ta bort avlossning lösning.
    2. Tillsätt cell frysning lösning (se tabell över material) till separerade NPCs vid 1 x 106 celler/mL och fördela 1 ml alikvoter till cryovials.
    3. Placera kryovialerna i frys behållaren och förvara dem över natten i en-80 ° c frys.
  6. Förvara kryovialerna i flytande kväve.

6. beredning av poly-L-Ornithine (PLO) och laminin belagda plattor

  1. För beredning av PLO/laminin belagda plattor, späd PLO-lagerlösningen till PBS eller vatten till en slutkoncentration på 10 μg/mL. Blanda väl och täck varje brunn av en 6 brunn tallrik med 1 mL utspädd PLO lösning.
  2. Inkubera i minst 2 timmar vid 37 ° c eller över natten vid 4 ° c.
  3. Tvätta varje brunn med PBS.
  4. Späd laminin lagerlösning i kallt PBS eller vatten vid 10 μg/mL. Blanda laminin-lösningen väl. Ta bort PBS och täck genast varje brunn med 1 mL av laminin-lösningen. Förvara plattorna vid 4 ° c och Använd inom 1 vecka. Tvätta med PBS och tillsätt genast odlingsmedium.
    Obs: Låt inte PLO/laminin belagda plattorna torka ut.

7. differentiering av hESC-härledda NPCs i dopaminerga neuroner (figur 6A)

  1. Tallrik NPCs i PLO/laminin-belagda rätter i NPC expansions medium med en densitet på cirka 50%.
  2. Efter 24 h, ändra medium till DA1 medium (neurobasal medium som innehåller 2 mM glutamin tillägg, 1x NEAA, 1x B27, 200 ng/mL SHH, och 100 ng/mL FGF8) och ändra mediet varannan dag.
  3. Passage kulturer när de når confluency. Separera cellerna med 1 mL avlösningslösning (1x) och inkubera i 10 min vid 37 ° c.
  4. Centrifugera cellerna i 2 min vid 370 x g och ta bort avlossning lösning supernatanten. Tillsätt 1 mL DA1 medium och Omsuspendera cellerna genom skonsam pipettering.
  5. Platta 1 x 105 celler i 2 ml DA1 medium på PLO/lamininbelagda 6 plattor.
  6. Efter 10 dagar, ändra till DA2 medium (neurobasal medium som innehåller 2 mM glutamin tillägg, 1x NEAA, 1x B27, 200 μM askorbinsyra, 20 ng/mL BDNF, och 20 ng/mL GNDF) och ändra medium varannan dag i ytterligare 20 dagar (figur 6A).
    Anmärkning: Tillsätt färsk askorbinsyra dagligen till DA2-mediet. Inom de första 14 dagarna, de differentierade cellerna bör överföras när de når 90% confluency, men inte längre efter det.

8. differentiering av ESC-härledda NPCs i astrocyter

  1. Platta neurala progenitorceller på PLO/laminin-belagda plattor i NPC expansions medium med en densitet på cirka 50%.
  2. Efter 24 h, ändra medium till astrocytmodell medium (DMEM/F12 medium inklusive 1:100 N2, 1:100 B27, 200 ng/mL IGF, 10 ng/mL Activin A, 10 ng/mL heregulin β-1, och 8 ng/mL bFGF) och ändra mediet varannan dag.
  3. Passage kulturer när de når confluency. Separera cellerna med 1 mL avlösningslösning (1x) och inkubera i 10 min vid 37 ° c.
  4. Centrifugera cellerna i 2 min vid 370 x g och ta bort avlossning lösning supernatanten. Tillsätt 1 mL astrocytmedium och Omsuspendera cellerna genom skonsam pipettering.
  5. Tallrik 1 x 105 celler i 2 ml astrocytmedium på PLO/lamininbelagda 6 bra rätter.
  6. Kan differentieringen fortsätta under sammanlagt 5 – 6 veckor (figur 6B).

9. färgning av immunofluorescensteknik

  1. Kultur celler i 35 mm μ-rätter som beskrivits ovan för varje celltyp. Aspirera mediet och tillsätt 1 mL 4% PFA-lösning per fat och inkubera i 20 minuter vid RT.
  2. Tvätta 2x i 5 min med PBS.
    Anmärkning: när cellerna har fixats kan analys plattorna förseglas med parafilm och förvaras vid 4 ° c. Fläcken med en antikropp inom 1 vecka efter fixering.
  3. Tillsätt 300 μL blockerande lösning (Get-eller åsnserum i PBS) per fat och inkubera vid RT i 30 – 60 min.
  4. Tvätta skålen 2x med PBS i 5 min.
  5. Tillsätt 300 μL primär antikropp (tabell 1) lösning (utspädd i blockerande lösning) och inkubera vid RT för 1,5 h eller över natten vid 4 ° c.
  6. Tvätta 2x med PBS i 10 min.
  7. Tillsätt 300 μL fluorescerande-konjugerad sekundär antikropp (tabell 1) i blockerande lösning och inkubera i mörker i 1 h vid RT.
  8. Tvätta cellerna 2x i 10 min med PBS.
  9. Tillsätt Hoechst-färgningslösning (1 μM slutlig koncentration i PBS) för att fläcka kärnor. Inkubera cellerna i mörker i 5 minuter vid RT.
  10. Tvätta cellerna 1x med PBS i 5 min och tillsätt sedan 500 μL PBS. Håll rätter i mörker, sedan Observera fluorescens med ett konfokalmikroskop (figur 2B, figur 5C, figur 6a, och figur 7B).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Presenteras här är ett förbättrat protokoll för underhåll och utbyggnad av encellig typ kultur av hESCs och deras effektiva differentiering till neurala stamceller, som senare skiljer sig i olika nedströms neurala linjer, inklusive dopaminerga neuroner och astrocyter.

Representativa faskontrast bilder visar cellmorfologi vid olika steg under anpassningen av kolonin typ hESCs till encellig typ kultur (figur 1A). Genom en enda cell odlingstillstånd, konstaterades det att de anpassade hESCs kunde upprätthållas vid hög densitet, sedan lätt och effektivt subkultiverade när de når sammanlänkning (figur 1A, B). Dessa celler behöll cellcykelns egenskaper (dvs. en kort G1-fas och hög andel celler i S-fas) som är typiska för kolonin typ hESCs (figur 1C, D). De uttryckte också ESC-markörer (dvs. OCT4, TRA 1-81, SOX2 och NANOG) på nivåer som är jämförbara med de som gäller för kolonityp hESCs som indikeras av QRT-PCR och immunofärgning analys (figur 7, tabell 2). Dessutom visade det sig att encelliga hESCs kunde bilda embryoida kroppar som innehöll celler från alla tre bakterie lagren: endoderm (SOX17 Expression), Mesoderm (SMA-uttryck) och ektoderm (tuj-1-uttryck) (figur 2).

Därefter visades att encellig typ hESCs effektivt differentieras till neurala stamceller med hjälp av en NPC protokoll (figur 3A), vilket indikeras av förlusten av typiska hESC morfologi och uppkomsten av NPC morfologi (figur 3B)16. NPC differentiering stöddes av det ökade uttrycket av signaturen NPC markörer (dvs., SOX1, OTX2, ZIC1 och OTX1; Figur 5A, tabell 2) och bekräftas av immunofärgning och FACS-analys. Samma analys visade också att mer än 90% av cellerna färgade positiva för SOX1, PAX6, och NCAM protein (figur 5B, C). För att undersöka möjligheten för encellig hESC-härledda NPC att differentiera till olika nedströms neurala linjer, differentiering av dessa celler i dopaminerga neuroner och astrocyter undersöktes. Som framgår av figur 6A, B, var encelliga hESC-härledda NPCs kunna differentiera till dopaminerga neuroner och astrocyter, vilket indikeras av utseendet på karakteristiska morfologier och uttryck av härstamning-specifika dopaminerga markörer (dvs., Th; Figur 6A) och astrocytmarkörer (dvs. gfap och S100B; Figur 6B).

Figure 1
Figur 1: anpassning av kolonin typ hESCs till encellig typ kultur. (A) representativa faskontrast bilder av enstaka cellkulturer av H9 hESCs vid olika tidpunkter efter plätering på 2% basalmembran matris-belagda rätter. Låg (vänster) och hög (höger) förstoring. Övre panelen: representativ bild av kolonin typ hESCs. Andra paneler visar representativa bilder av kulturer vid olika tidpunkter under anpassningen till encellig typ hESCs. Skalstapel = 200 μm. (B) tillväxtkurvor på H9 hESCs övervakades i 2% basalmembran Matrix-belagda plattor med 10 μm rock inhibitor för de första 24 h under encellig odlingstillstånd. (C, D) Cell cykel analys av kolonin typ (C) och Single-celltyp (D) H9 hESCs av flödescytometri. Vänligen klicka här för att se en större version av denna siffra.

Figure 2
Figur 2: in vitro differentiering av anpassade encelliga typ hESCs i tre bakterie skikt. A) representativa fas bilder av embryonala kroppar (EB) som härrör från encellig typ av hESCs. Skalstapel = 100 μm. B) Immunofluorescerande bilder av differentierade hESCs analyserade för uttrycket av de tre olika bakterie skikt MARKÖRER: SOX17 (endoderm), SMA (mesoderm), och tuj-1 (ectoderm). Kärnor färgas med DAPI. Skalstapel = 50 μm. Vänligen klicka här för att se en större version av denna siffra.

Figure 3
Figur 3: differentiering av encellig typ hESCs i neurala stamceller genom direkt differentiering. (A) schematiskt av differentierings protokollet för hESCs till neurala stamceller (NPCs). hESCs behandlades med dorsomorphin (DMH) och SB431542 (SB) 1 dag efter plätering. (B) representativa faskontrast bilder av cellmorfologi under neurala differentiering. Skalstapel = 200 μm. Vänligen klicka här för att se en större version av denna siffra.

Figure 4
Figur 4: hESC kultur på olika basalmembran mat risprodukter. (A) hESCs odlade på matrigel eller Geltrex uppvisade en förmåga att växa och differentiera till NPCs som liknade den enda cell-kulturen. Celler färgas med en NESTIN-antikropp. Kärnor färgas med DAPI. Skalstapel = 50 μm. (B) hESCs odlade på matrigel eller Geltrex visade liknande potential att differentiera till NPCs som anges av andelen nestin-och PAX6-positiva celler. Celler analyserades av flödescytometri vid dag 7 av NPC differentiering. Vänligen klicka här för att se en större version av denna siffra.

Figure 5
Figur 5: uttryck för NPC-markörer. (A) efter 7 dagar av neural differentiering, uttryck av NPC markörgener (dvs., OTX1, OTX2, SOX1, och ZIC1) analyserades av QRT-PCR. Värdena normaliserades till GAPDH och beräknades i förhållande till värdena för hESCs (p < 0,05). (B) andelen SOX1-, nestin-, SOX2-och ncam-positiva celler bestämdes genom flödescytometri vid dag 7 av NPC-differentiering. (C) vid dag 7 NPC differentiering, celler färgas med antikroppar mot neurala markörer SOX1, NESTIN, NCAM, OTX2, och PAX6. Kärnor färgas med DAPI. Skalstapel = 100 μm. Vänligen klicka här för att se en större version av denna siffra.

Figure 6
Figur 6: dopaminerga neuron och astrocytdifferentiering av NPCs som härrör från encellig typ hESCs. (A) representativ faskontrast bild av dopaminerga neuroner (övre panelen). Skalstapel = 100 μm. Differentierade celler färgas med antikroppar mot dopaminerga neuron markör TH (tyrosin hydroxylase) som anges. Kärnor färgas med DAPI. Skalstapel = 50 μm. (B) representativ faskontrast bild av astrocyter (övre panelen). Skalstapel = 100 μm. Differentierade celler var färgade med antikroppar mot astrocyt markör gfap (Glial hjärn sura protein) och S100-B (S100 kalcium bindande protein B), som anges. Kärnor färgas med DAPI. Skalstapel = 50 μm. Vänligen klicka här för att se en större version av denna siffra.

Figure 7
Figur 7: karakterisering av enstaka celltyp hESCs. A) hESCs som anpassats till encellig typ kultur analyserades för uttrycket av ESC-markörer (dvs. OCT4, nanog och SOX2) med QRT-PCR. Värden normaliserades till GAPDH (p < 0,05). B) Immunofluorescerande bilder av hESCs som har färgats för uttrycket av pluripotens markörer OCT4, TRA-1-81 och ssea-1. Kärnor färgas med DAPI. Skalstapel = 50 μm. Vänligen klicka här för att se en större version av denna siffra.

Primära antikroppar Arter Utspädning Katalognummer Företag
OCT4 Musen 1:1000 SC-5279 Santa Cruz
TRA 1-81 Musen 1:500 SC-21706 Santa Cruz
SSEA-1 Musen 1:500 SC-21702 Santa Cruz
SOX1 Get 1:500 AF-3369 R & D
SOX2 Kanin 1:1000 SC-20088 Santa Cruz
Sma Kanin 1:500 AB-5694 Abcam
Tuj1 Musen 1:1000 T8578 Sigma
NESTIN Musen 1:1000 AB-22035 Abcam
OTX2 Musen 1:250 AB-21990 Abcam
hNCAM Musen 1:200 SC-106 Santa Cruz
hPAX6 Musen 1:250 561664 Bd
Th Musen 1:500 T1299 Sigma
S100b Musen 1:250 ab4066 Abcam
GFAP Kanin 1:1000 ab7260 Abcam
Sekundära antikroppar
Anti-mus Get 1:1000 AF 488 eller 647 Life Technologies
Anti-kanin Get 1:1000 AF 488 eller 647 Life Technologies

Tabell 1: antikroppar som används i immunocytokemi och FACS-analys.

Namn på primer Primer sekvens
OCT4 F: GGAAGGTATTCAGCCAAACG
R: CTCCAGGTTGCCTCTCACTC
Nanog F: GGTTCCAGAACCAGAGAATGA
R: ATTGGAAGGTTCCCAGTCG
SOX1 F: CCTTAGGTTTCCCCTCGCTTT
R: CAGGCTGAATTCGGTTCTCATT
OTX1 F: AAGATCAACCTGCCGGAGTCT
R: CGTGAATTGGCCACTGCTTT
OTX2 F: TGGAAGCACTGTTTGCCAAG
R: TAAACCATACCTGCACCCTCG
ZIC1 F: AACCCCAAAAAGTCGTGCAAC
R: TCCTCCCAGAAGCAGATGTGA
GAPDH F: CCCATCACCATCTTCCAGGAG
R: CTTCTCCATGGTGGTGAAGACG

Tabell 2: lista över primrar som används i QRT-PCR-analys.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Skalbara och effektiva metoder för differentiering av hESCs i olika linjer och generering av tillräckligt antal differentierade celler är viktiga kriterier för läkemedels screening och stamcellsterapi. Olika Single-cell passerar metoder har publicerats, där celler odlas i närvaro av sten-hämmare eller andra små molekyler för att förbättra överlevnaden, men de slutliga produkterna av dessa kultur metoder är kolonin typ hESCs17,18,19,20,21. Encellig ESC-protokollet, som delvis bygger på tidigare publicerade metoder19,20,21,22, framgångsrikt genererar och upprätthåller Single cell-typ hESC kulturer och förhindrar kolonin typ hESC kultur. Den innehåller hög densitet encellsplätering, flercelliga Association, enskiktslager tillväxt, och effektiv subkultur (figur 1). Den senare uppnåddes genom tillsats av rock-hämmare under den första 24 h av Single-celltyp kultur av hESCs, vilket förbättrar cellöverlevnad17,18,19,20,21. Detta protokoll är lättare att skalbart och tillåter expansion av dessa celler för terapeutiska tillämpningar i läkemedels screening och stamcells.

Det är vidare visat att encellig typ hESCs effektivt kan differentiera till NPC härstamning (figur 3) utan användning av ett mellanliggande skede, såsom EB och rosett formation23,24,25. Hög neural omvandling från Single-celltyp hESCs uppnåddes genom hämning av BMP/tgfβ/Activin signalering vägar genom behandling med ALK-hämmare, dorsomorphin, och SB43154215,16,26. Med detta protokoll, den anpassade encellig typ hESCs kan effektivt differentieras till NPC utan behov av EB och rosett bildas (figur 5) och eller förmås att differentiera till dopaminerga neuroner och astrocyter (figur 6).

Sammanfattnings, encellig typ kultur av hESCs ger ett snabbt och effektivt system för att studera de molekylära mekanismer som reglerar i flera steg differentiering till olika linjer. Specifikt, detta protokoll utnyttjas NPCs och beskrev deras efterföljande differentiering till ytterligare neurala linjer, såsom astrocyter och dopaminerga neuroner. Protokollet ger en plattform för enkel, robust och skalbar produktion av stamceller och differentierade celler som kan vara lämpliga för grundläggande studier, läkemedels screening, och tillämpningar inom regenerativ medicin.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna förklarar inga intressekonflikter.

Acknowledgments

Vi tackar Dr. Carl D. Bortner (NIEHS) för hans hjälp med FACS-analysen. Denna forskning stöddes av intramural forsknings program av National Institute of Environmental Health Sciences, National Institutes of Health, Z01-ES-101585 till AMJ.

Materials

Name Company Catalog Number Comments
35 mm m-dishes ibidi 81156 Cell culture dish
6-well plates Corning 3516
Accutase Innovative Cell Technologies AT104-500 Cell detachment solution
Activin A R&D system 338-AC-050
Ascorbic Acid Sigma Aldrich A4403
B27 supplement Thermo Fisher 17504044
B27 supplement (-Vit A) Thermo Fisher 12587010
BDNF Applied Biological Materials Z100065
bFGF Peprotech 100-18C
Centrifuge DAMON/ICE 428-6759
CO2 incubator Thermo Fisher 4110
Corning hESC-qulified Matrix (Magrigel) Corning 354277 Basement membrane matrix (used for most of the protocol here)
Cryostor CS 10 Stemcell Technologies 7930 Cell freezing solution
Dispase Stemcell Technologies 7923
DMEM Thermo Fisher 10569-010
DMEM/F12 Thermo Fisher 10565-018
Dorsomorphin Tocris 3093
EGF Peprotech AF-100-16A
Fetal Bovine Serum Fisher Scientific SH3007003HI
FGF8 Applied Biological Materials Z101705
GDNF Applied Biological Materials Z101057
Geltrex matrix Thermo Fisher A1569601 Basement membrane matrix
GlutaMax Thermo Fisher 35050061 Glutamine supplement, 100X
H9 (WA09) human embryonic stem cell line WiCell WA09
Heregulin b-1 Peprotech 100-3
IGF Peprotech 100-11
Knockout DMEM Thermo Fisher 10829018
Knockout Serum Replacement Thermo Fisher 10828028
Laminin Sigma Aldrich L2020
mTeSR1 Stemcell Technologies 85850 hESC culture medium
N2 supplement Thermo Fisher 17502001
NEAA Thermo Fisher 11140050
Neurobasal Thermo Fisher 21103049
Poly-L-ornithine Sigma Aldrich P3655
ROCK inhibitor Tocris 1254
SB431542 Tocris 1614
SHH Applied Biological Materials Z200617
Stemdiff Neural Progenitor medium Stemcell Technologies 5833 NPC expansion medium

DOWNLOAD MATERIALS LIST

References

  1. Thomson, J. A., et al. Embryonic stem cell lines derived from human blastocysts. Science. 282, (5391), 1145-1147 (1998).
  2. Rosler, E. S., et al. Long-term culture of human embryonic stem cells in feeder-free conditions. Developmental Dynamics. 229, (2), 259-274 (2004).
  3. Mallon, B. S., Park, K. Y., Chen, K. G., Hamilton, R. S., McKay, R. D. Toward xeno-free culture of human embryonic stem cells. The International Journal of Biochemistry & Cell Biology. 38, (7), 1063-1075 (2006).
  4. Hoffman, L. M., Carpenter, M. K. Characterization and culture of human embryonic stem cells. Nature Biotechnology. 23, (6), 699-708 (2005).
  5. Yan, Y., et al. Efficient and rapid derivation of primitive neural stem cells and generation of brain subtype neurons from human pluripotent stem cells. Stem Cells Translational Medicine. 2, (11), 862-870 (2013).
  6. Goncalves, J. T., Schafer, S. T., Gage, F. H. Adult Neurogenesis in the Hippocampus: From Stem Cells to Behavior. Cell. 167, (4), 897-914 (2016).
  7. Watanabe, K., et al. A ROCK inhibitor permits survival of dissociated human embryonic stem cells. Nature Biotechnology. 25, (6), 681-686 (2007).
  8. International Stem Cell Initiative. Characterization of human embryonic stem cell lines by the International Stem Cell Initiative. Nature Biotechnology. 25, (7), 803-816 (2007).
  9. Hartung, O., Huo, H., Daley, G. Q., Schlaeger, T. M. Clump passaging and expansion of human embryonic and induced pluripotent stem cells on mouse embryonic fibroblast feeder cells. Current Protocols in Stem Cell Biology. 14, (1), Chapter 1 Unit 1C 10 (2010).
  10. Chen, K. G., et al. Non-colony type monolayer culture of human embryonic stem cells. Stem Cell Research. 9, (3), 237-248 (2012).
  11. Chen, G., Hou, Z., Gulbranson, D. R., Thomson, J. A. Actin-myosin contractility is responsible for the reduced viability of dissociated human embryonic stem cells. Cell Stem Cell. 7, (2), 240-248 (2010).
  12. Li, X., Krawetz, R., Liu, S., Meng, G., Rancourt, D. E. ROCK inhibitor improves survival of cryopreserved serum/feeder-free single human embryonic stem cells. Human Reproduction. 24, (3), 580-589 (2009).
  13. Ohgushi, M., et al. Molecular pathway and cell state responsible for dissociation-induced apoptosis in human pluripotent stem cells. Cell Stem Cell. 7, (2), 225-239 (2010).
  14. Pakzad, M., et al. Presence of a ROCK inhibitor in extracellular matrix supports more undifferentiated growth of feeder-free human embryonic and induced pluripotent stem cells upon passaging. Stem Cell Reviews and Reports. 6, (1), 96-107 (2010).
  15. Chambers, S. M., et al. Highly efficient neural conversion of human ES and iPS cells by dual inhibition of SMAD signaling. Nature Biotechnology. 27, (3), 275-280 (2009).
  16. Jeon, K., et al. GLIS3 Transcriptionally Activates WNT Genes to Promote Differentiation of Human Embryonic Stem Cells into Posterior Neural Progenitors. Stem Cells. 37, (2), 202-215 (2019).
  17. Emre, N., et al. The ROCK inhibitor Y-27632 improves recovery of human embryonic stem cells after fluorescence-activated cell sorting with multiple cell surface markers. PLoS ONE. 5, (8), e12148 (2010).
  18. Hanna, J., et al. Human embryonic stem cells with biological and epigenetic characteristics similar to those of mouse ESCs. Proceedings of the National Academy of Sciences of the United States of America. 107, (20), 9222-9227 (2010).
  19. Saha, K., et al. Surface-engineered substrates for improved human pluripotent stem cell culture under fully defined conditions. Proceedings of the National Academy of Sciences of the United States of America. 108, (46), 18714-18719 (2011).
  20. Tsutsui, H., et al. An optimized small molecule inhibitor cocktail supports long-term maintenance of human embryonic stem cells. Nature Communications. 2, 167 (2011).
  21. Xu, Y., et al. Revealing a core signaling regulatory mechanism for pluripotent stem cell survival and self-renewal by small molecules. Proceedings of the National Academy of Sciences of the United States of America. 107, (18), 8129-8134 (2010).
  22. Ungrin, M. D., Joshi, C., Nica, A., Bauwens, C., Zandstra, P. W. Reproducible, ultra high-throughput formation of multicellular organization from single cell suspension-derived human embryonic stem cell aggregates. PLoS ONE. 3, (2), e1565 (2008).
  23. Kim, D. S., et al. Highly pure and expandable PSA-NCAM-positive neural precursors from human ESC and iPSC-derived neural rosettes. PLoS ONE. 7, (7), e39715 (2012).
  24. Sun, Y., Hu, J., Zhou, L., Pollard, S. M., Smith, A. Interplay between FGF2 and BMP controls the self-renewal, dormancy and differentiation of rat neural stem cells. Journal of Cell Science. 124, (Pt 11), 1867-1877 (2011).
  25. Zhou, J. M., Chu, J. X., Chen, X. J. An improved protocol that induces human embryonic stem cells to differentiate into neural cells in vitro. Cell Biology International. 32, (1), 80-85 (2008).
  26. Smith, J. R., et al. Inhibition of Activin/Nodal signaling promotes specification of human embryonic stem cells into neuroectoderm. Developmental Biology. 313, (1), 107-117 (2008).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics