Efficiënte Neurale differentiatie met behulp van eencellige cultuur van menselijke embryonale stamcellen

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Hier gepresenteerd is een protocol voor het genereren van een eencellige cultuur van menselijke embryonale stamcellen en hun daaropvolgende differentiatie in neurale voorlopercellen. Het protocol is eenvoudig, robuust, schaalbaar en geschikt voor geneesmiddelen screening en toepassingen voor regeneratieve geneeskunde.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Jeon, K., Park, K., Jetten, A. M. Efficient Neural Differentiation using Single-Cell Culture of Human Embryonic Stem Cells. J. Vis. Exp. (155), e60571, doi:10.3791/60571 (2020).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

In vitro differentiatie van menselijke embryonale stamcellen (hESCs) heeft het vermogen om menselijke ontwikkeling te bestuderen op zowel biologische als moleculaire niveaus getransformeerd en cellen verstrekt voor gebruik in regeneratieve toepassingen. Standaard benaderingen voor de hESC cultuur met behulp van kolonie type cultuur te handhaven ongedifferentieerde hESCs en embryo id lichaam (EB) en rozet vorming voor differentiatie in verschillende kiem lagen zijn inefficiënt en tijdrovend. Gepresenteerd hier is een eencellige cultuur methode met behulp van hESCs in plaats van een kolonie-type cultuur. Deze methode maakt het mogelijk om de karakteristieke kenmerken van ongedifferentieerde hESCs te onderhouden, inclusief expressie van hESC-markers op niveaus die vergelijkbaar zijn met hESCs van het kolonie type. Bovendien, het protocol presenteert een efficiënte methode voor neurale voorlopercellen (NPC) generatie van eencellige type hESCs die Npc's binnen 1 week produceert. Deze cellen uitdrukken sterk verschillende NPC marker genen en kunnen differentiëren in verschillende neurale celtypen, waaronder Dopaminerge neuronen en astrocyten. Dit eencellige cultuur systeem voor hESCs zal nuttig zijn bij het onderzoeken van de moleculaire mechanismen van deze processen, studies van bepaalde ziekten en Drug Discovery-schermen.

Introduction

Menselijke embryonale stamcellen (hESCs) hebben het potentieel om te differentiëren in de drie primaire kiem lagen, die vervolgens differentiëren in verschillende multipotente voorlopercellen. Deze kilometerstanden geven vervolgens aanleiding tot alle celtypen in het menselijk lichaam. In vitro cultuur systemen van hESC hebben het vermogen om menselijke embryonale ontwikkeling te bestuderen getransformeerd en hebben gediend als waardevol hulpmiddel voor het verkrijgen van nieuwe inzichten in hoe deze processen op het biologische en moleculaire niveau worden gereguleerd. Evenzo, studies van geïnduceerde pluripotente stamcellen (iPSCs) gegenereerd uit herprogrammering somatische cellen geïsoleerd van menselijke patiënten bieden nieuwe inzichten in verschillende ziekten. Bovendien kunnen voorlopercellen en gedifferentieerde cellen die zijn afgeleid van hescs nuttig zijn voor onderzoek waarbij stamceltherapie en geneesmiddelen screening1,2,3,4worden behandeld.

hESCs kunnen worden geïnduceerd om te differentiëren in neurale voorlopercellen (Npc's), die multipotential cellen met een uitgebreide zelfvernieuwings capaciteit zijn. Vervolgens kunnen deze cellen worden gedifferentieerd in neuronen, astrocyten, en oligodendrocyten5,6. Npc's bieden ook een cellulaire systeem voor in vitro studies van neuro ontwikkelingsbiologie en verschillende neurologische aandoeningen. Echter, huidige kolonie type cultuur methoden met hescs en hun differentiatie in npc's zijn inefficiënt en vaak betrekken cocultuur, alsmede embryoid lichaam (EB) en rozet vorming5,7,8,9. Deze protocollen vertonen lagere overlevingspercentages en spontane differentiatie en zijn meer tijdrovend.

Gepresenteerd hier is een verbeterde en robuuste cultuur systeem dat is gemakkelijk schaalbaar en maakt gebruik van hoge dichtheid eencellige type cultuur van hESCs10. De opname van ROH-kinase (Rock) remmer droeg bij aan een significant verbeterde overlevings efficiëntie tijdens het type eencellige cultuur van hesc10,11,12,13,14. In dit cultuur systeem kunnen hESCs gemakkelijk worden onderhouden en uitgebreid. Daarnaast presenteert het protocol een efficiënte methode om npc's te genereren van de eencellige type cultuur van hescs, waardoor de productie van zeer zuivere NPCs. remming van BMP/tgfβ/activin signalering trajecten met alk remmers efficiënt induceren differentiatie van eencellige type hescs in npc's15,16, die vervolgens kan worden geïnduceerd om te differentiëren in functionele neurale lijnen, zoals Dopaminerge neuronen en astrocyten.

Samengevat, het eencellige type cultuur protocol met behulp van hESCs biedt een aantrekkelijk model om de differentiatie van deze cellen te bestuderen in verschillende kilometerstanden, waaronder Npc's. Dit protocol is gemakkelijk schaalbaar en daarom geschikt voor het genereren van cellen voor onderzoek waarbij regeneratieve therapie en geneesmiddelen screening worden betrokken.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. bereiding van de hESC-gekwalificeerde Basmembraan-gecoate platen

  1. Langzaam ontdooien de hESC-gekwalificeerde kelder membraan matrix (Zie tabel van de materialen) oplossing bij 4 °c gedurende ten minste 2 – 3 uur of 's nachts om vorming van een gel te voorkomen.
  2. Voor de bereiding van de kelder-gecoate platen, Verdun matrix in koude DMEM/F12 tot een 2% eindconcentratie. Meng goed en Coat elk goed van een 6-put plaat met 1 mL van de verdunde matrix oplossing.
  3. Incuberen de kelder-gecoate platen op kamertemperatuur (RT) gedurende ten minste 3 uur of bij 4 °C 's nachts.
    Opmerking: platen met een kelder membraan matrix kunnen gedurende 1 week bij 4 °C worden bewaard voordat de matrix oplossing wordt verwijderd en de platen worden gebruikt.

2. aanpassing van de kolonie type hESCs naar eencellige hESC-cultuur

  1. Naar passage de feeder-vrije culturen van kolonie type H9 (WA09) hescs geteeld op kelder membraan matrix, aspiraat het medium uit de putten (Figuur 1A)9.
  2. Was 1x met 1 mL DPBS. Voeg 1 mL dispase oplossing (1 U/mL) per put toe en inincuberen bij 37 °C gedurende 20 min.
  3. Verwijder de dispase, was de cellen 1x zachtjes met 2 mL DMEM/F12, verwijder het medium en voeg 2 mL DMEM/F12 toe aan elke plaat.
  4. Maak de kolonies voorzichtig los door ze zachtjes op en neer te pipetteren en over te brengen naar een buis van 15 mL.
  5. Centrifuge de pellets 2 min bij 370 x g en aspireren het medium.
  6. Om de celpellets in afzonderlijke cellen te ontkoppelen, voegt u 2 mL celdetacherings oplossing toe (1x concentratie, Zie tabel met materialen) en inincuberen bij 37 °c gedurende 10 minuten.
  7. Centrifugeer cellen 2 min bij 370 x g en verwijder de loslating oplossing.
  8. Voeg Fresh mTeSR1 Human ESC medium toe en dissocieren de cellen in afzonderlijke cellen door voorzichtig te pipetteren op en neer.
  9. Om kolonie type hESCs aan te passen aan een eencellige type cultuur, plaat ongeveer 1.5 – 2.0 x 106 hescs in elke put van de kelder membraan matrix-Coated 6 well plate in 2 ml mTeSR1 met 10 μM rotsremmer voor 24 h (Figuur 1a).
  10. Na 24 h, vervang de hESC medium met verse mTeSR1 zonder ROTSREMMER en laat de hESCs groeien als een eencellige type voor 3 dagen. Verander het medium dagelijks.
  11. Op dag 4, wanneer culturen bijna 100% confluency bereiken, dissociëren cellen in Detacherings oplossing, dan replate zoals beschreven in stap 2,6.
    Opmerking: de ROTSREMMER verbetert de overleving van de cel tijdens de eerste 24 uur van de hESC-cultuur van een eencellige type.

3. embryoïde lichaams vorming en differentiatie in drie kiem lagen (Figuur 2)

  1. Om EBs te vormen, moet u eerst cellen in 3 mL mTeSR1 medium met 10 μM-ROTSREMMER in de eerste 24 uur regenen, en vervolgens 's nachts incueren in 60 mm lage aanbouw gerechten in een incubator van 37 °C om aggregatie mogelijk te maken.
  2. Na 24 h, de kleine EBs worden overgebracht naar een 15 mL buis. Laat de EBs op de bodem van de buis zitten en verwijder het medium voorzichtig met een pipet. Breng EBs over naar EB medium (Knockout-DMEM aangevuld met 20% Knockout serum vervanging, 1x glutamine supplement [Zie tabel van materialen], 1% neaa [niet-essentiële aminozuren; Zie tabel van materialen], en 0,2% β-mercaptoethanol) en laat ze uit te breiden in lage gehechtheid gerechten voor 7 dagen. Het medium kan om de andere dag worden gewijzigd, zoals hierboven beschreven (Figuur 2A).
  3. Op dag 7, verzamel de EBs van de gerechten en breng ze over in een buis van 15 mL. Verwijder voorzichtig het medium met een pipet en breng de EBs over naar een kelder-gecoate 6-put plaat.
  4. Laat de EBs aan de plaat hechten en inbroed gedurende 12 dagen in EB-medium, waarbij zij in de drie kiem lagen zullen differentiëren (Figuur 2B). Verander het medium om de andere dag.
    Opmerking: tijdens de aggregatie van cellen helpt de lage bevestigings schaal EB-bevestiging te voorkomen.

4. differentiatie van eencellige type hESCs in Npc's (Figuur 3)

  1. Voor het opwekken van NPC-differentiatie, dissociëren eencellige type hESCs met 1 mL loslating oplossing (1x) en incuberen gedurende 10 minuten bij 37 °C.
  2. Centrifugeer de cellen 2 min bij 370 x g en verwijder de loslating oplossing supernatant. Voeg 1 mL DMEM/F12 toe en reacteer de cellen door voorzichtig te pipetteren.
  3. Plaat cellen op een kelder membraan matrix-gecoat 6 goed plaat met een dichtheid van 2 x 105 cellen/goed in 2 ml mTeSR1 met 10 μM rotsremmer.
  4. Vervang na 24 uur het kweekmedium door een neurale inductie medium (DMEM met 1% B27 minus vitamine A) aangevuld met 1 μM dorsomorfine en 5 μM SB431542.
  5. Verander het medium om de andere dag tijdens de eerste 4 dagen van neurale inductie, dan elke dag tot het bereiken van samenvloeiing op dag 7 (Figuur 3B).
    Opmerking: (1) Dorsomorphin remt de BMP-route door te richten op ALK2, 3, 6 receptoren en ook AMPK remt; SB431542 is een remmer van het TGFβ/Activin traject door te richten op ALK5, 7. (2) hetzelfde protocol werd getest met een andere ESC-lijn (WA01), die vergelijkbare resultaten leverde als WA0916. (3) we hebben over het algemeen Matrigel gebruikt voor de kelder membraan matrix; cellen kunnen echter worden gekweekt op Geltrex en vervolgens worden gedifferentieerd in Npc's met zeer vergelijkbare resultaten zoals aangegeven door de uitdrukking van verschillende NPC-markers (Figuur 4D, E). Behandel Geltrex op dezelfde manier als Matrigel (zie rubriek 1).

5. NPC-uitbreiding en Cryopreservation

  1. Na 7 dagen van neurale inductie, dissociëren cellen met 1 mL van loslating oplossing (1x) en inbroed 10 min bij 37 °C.
  2. Centrifugeer de cellen 2 min bij 370 x g en verwijder de loslating oplossing supernatant. Voeg 1 mL NPC-uitbreidings medium toe (Zie tabel met materialen) en rebreng cellen door voorzichtig pipetteren.
  3. Plaat 1 x 105 cellen in 2 ml NPC-uitbreidings medium op kelder membraan matrix-gecoat 6 goed platen.
  4. Passage Npc's meerdere malen, indien nodig, wanneer culturen bereiken bijna 90% confluency. Tijdens de eerste 3 – 4 passages, voeg 10 μM ROTSREMMER tijdens de eerste 24 h om celdood te voorkomen. Na deze passages kunnen cellen worden doorgeprikt en gekweekt zonder ROTSREMMER. Verander het medium om de dag tijdens de uitbreiding.
  5. Cryopreserve Npc's wanneer culturen confluency bereiken.
    1. Voor cryopreservation, dissociëren cellen in 1 mL van loslating oplossing (1x) gedurende 5 min bij 37 °C, vervolgens Centrifugeer suspensie gedurende 2 minuten bij 370 x g om de loslating oplossing te verwijderen.
    2. Voeg cel invries oplossing (Zie tabel van de materialen) op gezien npc's bij 1 x 106 cellen/ml en verdeel 1 ml aliquots naar cryoflesjes.
    3. Plaats de cryoflesjes in een Vries bakje en bewaar ze 's nachts in een vriezer van 80 °C.
  6. Bewaar de cryoflesjes in de vloeibare stikstof.

6. bereiding van poly-L-Ornithine (PLO) en laminin gecoate platen

  1. Voor het bereiden van PLO/laminin gecoate platen, Verdun de PLO-stamoplossing in PBS of water tot een uiteindelijke concentratie van 10 μg/mL. Meng goed en vacht elk goed van een 6 goed bord met 1 mL verdunde PLO oplossing.
  2. Inincuberen gedurende ten minste 2 uur bij 37 °C of 's nachts bij 4 °C.
  3. Was elk goed met PBS.
  4. Verdun laminine stockoplossing in koude PBS of in water bij 10 μg/mL. Meng de laminine oplossing goed. Verwijder de PBS en onmiddellijk Coat elk goed met 1 mL van de laminine oplossing. Houd de platen bij 4 °C en gebruik deze binnen 1 week. Was met PBS en voeg direct een kweekmedium toe.
    Opmerking: laat de PLO/laminin gecoate platen niet uitdrogen.

7. differentiatie van Npc's die afkomstig zijn van hESC in Dopaminerge neuronen (Figuur 6A)

  1. Plaat Npc's in de PLO/laminin-gecoate gerechten in NPC-uitbreidings medium met een dichtheid van ongeveer 50%.
  2. Verander na 24 uur het medium naar DA1 medium (neurobasal medium met 2 mM glutamine supplement, 1x NEAA, 1x B27, 200 ng/mL SHH en 100 ng/mL FGF8) en verander het medium om de andere dag.
  3. Doorgang culturen wanneer ze confluency bereiken. Dissociate cellen met 1 mL loslating oplossing (1x) en incuberen gedurende 10 min bij 37 °C.
  4. Centrifugeer de cellen 2 min bij 370 x g en verwijder de loslating oplossing supernatant. Voeg 1 mL DA1 medium toe en reacteer de cellen door voorzichtig te pipetteren.
  5. Plaat 1 x 105 cellen in 2 ml da1 medium op PLO/laminin-Coated 6 well platen.
  6. Na 10 dagen, veranderen in DA2 medium (neurobasal medium met 2 mM glutamine supplement, 1x NEAA, 1x B27, 200 μM ascorbinezuur, 20 ng/mL BDNF, en 20 ng/mL GNDF) en verander medium om de andere dag voor nog eens 20 dagen (Figuur 6A).
    Opmerking: Voeg dagelijks vers ascorbinezuur toe aan het DA2-medium. Binnen de eerste 14 dagen moeten de gedifferentieerde cellen worden doorgegeven wanneer ze 90% confluency bereiken, maar niet meer daarna.

8. differentiatie van op ESC afgeleide Npc's in astrocyten

  1. Plaat neurale voorlopercellen op de PLO/laminin-gecoate platen in NPC-uitbreidings medium met een dichtheid van ongeveer 50%.
  2. Na 24 h, verander de medium naar astrociet medium (DMEM/F12 medium met inbegrip van 1:100 N2, 1:100 B27, 200 ng/ml IGF, 10 ng/ml activine A, 10 ng/ml heregulin β-1, en 8 ng/ml bFGF) en verander het medium om de andere dag.
  3. Doorgang culturen wanneer ze confluency bereiken. Dissociate cellen met 1 mL loslating oplossing (1x) en incuberen gedurende 10 min bij 37 °C.
  4. Centrifugeer de cellen 2 min bij 370 x g en verwijder de loslating oplossing supernatant. Voeg 1 mL astrocyten medium toe en breng de cellen door met een zachte Pipetteer tijd.
  5. Plaat 1 x 105 cellen in 2 ml van het astrocyten medium op de PLO/laminin-Coated 6 well gerechten.
  6. Laat differentiatie gedurende een totaal van 5 – 6 weken (Figuur 6B).

9. immunofluorescentie kleuring

  1. Kweekcellen in 35 mm μ-gerechten zoals hierboven beschreven voor elk celtype. Zuig het medium op en voeg 1 mL 4% PFA-oplossing per gerecht toe en inincuberen gedurende 20 minuten bij RT.
  2. Was 2x voor 5 minuten met PBS.
    Opmerking: zodra de cellen zijn bevestigd, kunnen de test platen met Parafilm worden verzegeld en bij 4 °C worden bewaard. Beits met een antilichaam binnen 1 week na fixatie.
  3. Voeg per gerecht 300 μL blokkerende oplossing (geit of Donkey serum in PBS) toe en inbroed bij RT gedurende 30 – 60 minuten.
  4. Was de schaal 2x met PBS gedurende 5 min.
  5. Voeg 300 μL primair antilichaam (tabel 1) oplossing (verdund in blokkerende oplossing) toe en inincuberen bij RT voor 1,5 uur of 's nachts bij 4 °c.
  6. Was 2x met PBS gedurende 10 minuten.
  7. Voeg 300 μL TL-geconjugeerd secundair antilichaam (tabel 1) toe in blokkerende oplossing en inincuberen in het donker gedurende 1 uur bij RT.
  8. Was de cellen 2x voor 10 min met PBS.
  9. Voeg Hoechst-kleurings oplossing (1 μM eindconcentratie in PBS) toe aan vlek kernen. Inincuberen de cellen in het donker gedurende 5 minuten bij RT.
  10. Spoel de cellen 1x met PBS gedurende 5 minuten en voeg vervolgens 500 μL PBS toe. Houd de gerechten in het donker en observeer de fluorescentie met een confocale Microscoop (Figuur 2b, Figuur 5C, Figuur 6aen Figuur 7b).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Gepresenteerd hier is een verbeterd protocol voor het onderhoud en de uitbreiding van de eencellige type cultuur van hESCs en hun efficiënte differentiatie in neurale voorlopercellen, die vervolgens differentieert in verschillende downstream neurale lijnen, met inbegrip van Dopaminerge neuronen en astrocyten.

Representatieve fase contrast beelden tonen celmorfologie in verschillende stappen tijdens de aanpassing van de kolonie type hESCs aan de eencellige type cultuur (Figuur 1A). Door de toestand van de eencellige cultuur bleek dat de aangepaste hESCs in staat waren om te worden gehandhaafd bij hoge dichtheid, vervolgens gemakkelijk en efficiënt gesubcultureerd bij het bereiken van confluentie (Figuur 1A, B). Deze cellen behielden de kenmerken van de celcyclus (d.w.z. een korte G1-fase en een hoog percentage van de cellen in de S-fase), typerend voor het type hESCs van de kolonie (Figuur 1C, D). Ze gaven ook de ESC-markers (d.w.z. OCT4, TRA 1-81, SOX2 en NANOG) uit op niveaus die vergelijkbaar zijn met die van type hESCs van de kolonie, zoals aangegeven door QRT-PCR-en immunokleurings analyse (Figuur 7, tabel 2). Bovendien werd aangetoond dat eencellige hESCs embryoïde lichamen konden vormen die cellen bevatten uit alle drie de kiem lagen: endoderm (SOX17 expressie), mesoderm (SMA expressie) en Ectoderm (tuj-1 expressie) (Figuur 2).

Vervolgens werd aangetoond dat eencellige type hESCs efficiënt gedifferentieerd worden in neuralevoorlopercellen met behulp van een NPC-Protocol (Figuur 3A), zoals aangegeven door het verlies van typische morfologie van de hesc en het uiterlijk van NPC-morfologie (Figuur 3B)16. NPC-differentiatie werd ondersteund door de toegenomen uitdrukking van de kenmerkende NPC-markers (d.w.z. SOX1, OTX2, ZIC1 en OTX1; Afbeelding 5A, tabel 2) en bevestigd door immunokleuring en FACS analyse. Dezelfde analyse toonde ook aan dat meer dan 90% van de cellen positief gekleurd voor SOX1, PAX6, en NCAM eiwit (Figuur 5B, C). Om het vermogen van eencellige hESC-afgeleide Npc's te onderzoeken om onderscheid te maken in verschillende downstream-neurale lijnen, werd de differentiatie van deze cellen in Dopaminerge neuronen en astrocyten onderzocht. Zoals weergegeven in Figuur 6A, B, waren eencellige Hesc-afgeleide npc's in staat om onderscheid te maken in Dopaminerge neuronen en astrocyten, zoals aangegeven door de verschijning van karakteristieke morfologieën en expressie van Lineage-specifieke Dopaminerge markers (d.w.z. th; Figuur 6A) en astrocyten markers (D.W.Z. GFAp en S100B; Figuur 6B).

Figure 1
Figuur 1: aanpassing van de kolonie type hESCs naar de eencellige type cultuur. (A) representatieve fase contrast beelden van Eencelculturen van H9 hescs op verschillende tijdstippen na beplating op 2% kelder-gecoate gerechten. Laag (links) en hoge (rechts) vergroting. Bovenblad: representatief beeld van het kolonie type hESCs. Andere panelen tonen representatieve beelden van culturen op verschillende tijdstippen tijdens de aanpassing aan eencellige type hESCs. Schaalbalk = 200 μm. B) de groeicurves van H9 hescs werden gemonitord in 2% kelder-gecoate platen met 10 ΜM-rotsremmer voor de eerste 24 uur tijdens de toestand van de eencellige cultuur. (C, D) Celcyclus analyse van kolonie type (C) en eencellige type (D) H9 hescs door Flowcytometrie. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 2
Figuur 2: in vitro differentiatie van aangepaste eencellige type hESCs in drie kiem lagen. A) representatieve fase beelden van embryonale lichamen (EB) die zijn afgeleid van eencellige type hescs. Schaalbalk = 100 μm. B) immunofluorescentie beelden van gedifferentieerde hescs die zijn geanalyseerd voor de uitdrukking van de drie verschillende kiem laag Markeringen: SOX17 (endoderm), SMA (mesoderm) en tuj-1 (Ectoderm). Nuclei waren bevlekt met DAPI. Schaalbalk = 50 μm. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 3
Figuur 3: differentiatie van eencellige type-hESCs in neurale voorlopercellen door directe differentiatie. A) Schematische voorstelling van het differentiatie Protocol van hescs in neurale voorlopercellen (npc's). hESCs werden behandeld met dorsomorphin (DMH) en SB431542 (SB) 1 dag na het beplating. B) representatieve fase contrast beelden van celmorfologie tijdens Neurale differentiatie. Schaalbalk = 200 μm. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 4
Figuur 4: hESC-cultuur op verschillende kelder-membraanmatrix producten. A) hescs gekweekt op matrigel of geltrex vertoonden een vermogen om te groeien en te differentiëren in npc's die vergelijkbaar waren met de eencellige cultuur. Cellen werden bevlekt met een NESTIN antilichaam. Nuclei waren bevlekt met DAPI. Schaalbalk = 50 μm. B) hescs gekweekt op matrigel of geltrex toonde een soortgelijk potentieel om te differentiëren in npc's zoals aangegeven door het percentage nestin-en PAX6-positieve cellen. Cellen werden geanalyseerd door Flowcytometrie op dag 7 van NPC-differentiatie. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 5
Figuur 5: uitdrukking van NPC-markers. A) na 7 dagen van neurale differentiatie werd de expressie van NPC marker genen (d.w.z. OTX1, OTX2, SOX1 en ZIC1) geanalyseerd door QRT-PCR. Waarden werden genormaliseerd naar GAPDH en berekend ten opzichte van de waarden van hESCs (p < 0,05). B) het percentage van SOX1-, nestin-, SOX2-en NCAM-positieve cellen werd bepaald door Flowcytometrie op dag 7 van NPC-differentiatie. (C) op dag 7 NPC-differentiatie, cellen werden bevlekt met antilichamen tegen de neurale markers SOX1, NESTIN, NCAM, OTX2, en PAX6. Nuclei waren bevlekt met DAPI. Schaalbalk = 100 μm. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 6
Figuur 6: Dopaminerge neuron en astrocyten differentiatie van Npc's afgeleid van eencellige type hESCs. (A) representatief fase contrast beeld van Dopaminerge neuronen (bovenste deelvenster). Schaalbalk = 100 μm. Gedifferentieerde cellen werden gekleurd met antilichamen tegen de Dopaminerge neuron marker TH (Tyrosine hydroxylase) zoals aangegeven. Nuclei waren bevlekt met DAPI. Schaalbalk = 50 μm. B) representatieve fase contrastafbeelding van astrocyten (bovenste deelvenster). Schaalbalk = 100 μm. Gedifferentieerde cellen werden gekleurd met antilichamen tegen de astrocyten marker GFAP (glial fibrillair zuur eiwit) en S100-B (S100 calcium bindende proteïne B), zoals aangegeven. Nuclei waren bevlekt met DAPI. Schaalbalk = 50 μm. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 7
Figuur 7: karakterisering van eencellige type hESCs. A) hescs die zijn aangepast aan de eencellige type cultuur werden geanalyseerd voor de uitdrukking van ESC-markers (d.w.z. OCT4, nanog en SOX2) door QRT-PCR. Waarden werden genormaliseerd naar GAPDH (p < 0,05). B) immunofluorescentie beelden van hescs gekleurd voor de uitdrukking van de pluripotentie markers OCT4, TRA-1-81 en ssea-1. Nuclei waren bevlekt met DAPI. Schaalbalk = 50 μm. Klik hier om een grotere versie van dit cijfer te bekijken.

Primaire antilichamen Soort(en) Verdunning Catalogus nummer Bedrijf
OCT4 Muis 1:1000 SC-5279 Santa Cruz
TRA 1-81 Muis 1:500 SC-21706 Santa Cruz
SSEA-1 Muis 1:500 SC-21702 Santa Cruz
SOX1 Geit 1:500 AF-3369 R & D
SOX2 Konijn 1:1000 SC-20088 Santa Cruz
Sma Konijn 1:500 AB-5694 Abcam
Tuj1 Muis 1:1000 T8578 Sigma
NESTIN Muis 1:1000 AB-22035 Abcam
OTX2 Muis 1:250 AB-21990 Abcam
hNCAM Muis 1:200 SC-106 Santa Cruz
hPAX6 Muis 1:250 561664 Bd
Th Muis 1:500 T1299 Sigma
S100b Muis 1:250 ab4066 Abcam
GFAP Konijn 1:1000 ab7260 Abcam
Secundaire antilichamen
Anti-muis Geit 1:1000 AF 488 of 647 Life Technologies
Anti-konijn Geit 1:1000 AF 488 of 647 Life Technologies

Tabel 1: antilichamen gebruikt in immunocytochemie en FACS analyse.

Naam primer Primer sequentie
OCT4 F: GGAAGGTATTCAGCCAAACG
R: CTCCAGGTTGCCTCTCACTC
Nanog F: GGTTCCAGAACCAGAGAATGA
R: ATTGGAAGGTTCCCAGTCG
SOX1 F: CCTTAGGTTTCCCCTCGCTTT
R: CAGGCTGAATTCGGTTCTCATT
OTX1 F: AAGATCAACCTGCCGGAGTCT
R: CGTGAATTGGCCACTGCTTT
OTX2 F: TGGAAGCACTGTTTGCCAAG
R: TAAACCATACCTGCACCCTCG
ZIC1 F: AACCCCAAAAAGTCGTGCAAC
R: TCCTCCCAGAAGCAGATGTGA
GAPDH F: CCCATCACCATCTTCCAGGAG
R: CTTCTCCATGGTGGTGAAGACG

Tabel 2: lijst van primers gebruikt in QRT-PCR-analyse.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Schaalbare en efficiënte methoden voor de differentiatie van hESCs in verschillende kilometerstanden en het genereren van voldoende aantallen gedifferentieerde cellen zijn belangrijke criteria voor geneesmiddelen screening en stamceltherapie. Verschillende methoden voor het passeren van één cel zijn gepubliceerd, waarin cellen worden gekweekt in de aanwezigheid van rotsremmer of andere kleine moleculen om de overleving te verbeteren, maar de eindproducten van deze cultuur methoden zijn kolonie type hescs17,18,19,20,21. Het ESC-protocol met één cel, dat gedeeltelijk is gebaseerd op eerder gepubliceerde methoden19,20,21,22, genereert en onderhoudt een hesc-culturen van één cel en voorkomt de hesc-cultuur van het kolonie type. Het omvat hoge dichtheid eencellige plating, multicellulaire associatie, monolaag groei, en efficiënte subcultuur (Figuur 1). De laatste werd bereikt door de toevoeging van rotsremmer tijdens de eerste 24 h van eencellige type cultuur van hescs, die de overleving van cellen verbetert17,18,19,20,21. Dit protocol is gemakkelijker schaalbaar en maakt uitbreiding van deze cellen voor therapeutische toepassingen in drug screening en stamcel.

Verder is aangetoond dat eencellige type-hescs efficiënt kunnen differentiëren naar de NPC-afstamming (Figuur 3) zonder gebruik te maken van een tussen stadium, zoals eb-en Rosette-formatie23,24,25. Hoge neurale conversie van eencellige hescs werd bereikt door de remming van BMP/tgfβ/activin signalering trajecten door behandeling met de ALK-remmers, dorsomorphin, en SB43154215,16,26. Met dit protocol kunnen de aangepaste eencellige hESCs efficiënt differentiëren in Npc's zonder de noodzaak voor EB-en rozet vorming (Figuur 5) en of worden geïnduceerd om te differentiëren in Dopaminerge neuronen en astrocyten (Figuur 6).

Kortom, eencellige type cultuur van hescs biedt een snel en efficiënt systeem om de moleculaire mechanismen te bestuderen die meerstaps differentiatie aan verschillende kilometerstanden reguleren. Specifiek, dit protocol gebruikt Npc's en beschreef hun daaropvolgende differentiatie in extra neurale lijnen, zoals astrocyten en Dopaminerge neuronen. Het protocol biedt een platform voor een eenvoudige, robuuste en schaalbare productie van voorlopercellen en gedifferentieerde Celeigenschappen die geschikt kunnen zijn voor basis studies, geneesmiddelen screening en toepassingen in regeneratieve geneeskunde.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs verklaren geen belangenconflicten.

Acknowledgments

Wij danken Dr. Carl D. Bortner (NIEHS) voor zijn hulp bij de FACS analyse. Dit onderzoek werd gesteund door het intramurale onderzoeksprogramma van het National Institute of Environmental Health Sciences, de National Institutes of Health, Z01-ES-101585 to AMJ.

Materials

Name Company Catalog Number Comments
35 mm m-dishes ibidi 81156 Cell culture dish
6-well plates Corning 3516
Accutase Innovative Cell Technologies AT104-500 Cell detachment solution
Activin A R&D system 338-AC-050
Ascorbic Acid Sigma Aldrich A4403
B27 supplement Thermo Fisher 17504044
B27 supplement (-Vit A) Thermo Fisher 12587010
BDNF Applied Biological Materials Z100065
bFGF Peprotech 100-18C
Centrifuge DAMON/ICE 428-6759
CO2 incubator Thermo Fisher 4110
Corning hESC-qulified Matrix (Magrigel) Corning 354277 Basement membrane matrix (used for most of the protocol here)
Cryostor CS 10 Stemcell Technologies 7930 Cell freezing solution
Dispase Stemcell Technologies 7923
DMEM Thermo Fisher 10569-010
DMEM/F12 Thermo Fisher 10565-018
Dorsomorphin Tocris 3093
EGF Peprotech AF-100-16A
Fetal Bovine Serum Fisher Scientific SH3007003HI
FGF8 Applied Biological Materials Z101705
GDNF Applied Biological Materials Z101057
Geltrex matrix Thermo Fisher A1569601 Basement membrane matrix
GlutaMax Thermo Fisher 35050061 Glutamine supplement, 100X
H9 (WA09) human embryonic stem cell line WiCell WA09
Heregulin b-1 Peprotech 100-3
IGF Peprotech 100-11
Knockout DMEM Thermo Fisher 10829018
Knockout Serum Replacement Thermo Fisher 10828028
Laminin Sigma Aldrich L2020
mTeSR1 Stemcell Technologies 85850 hESC culture medium
N2 supplement Thermo Fisher 17502001
NEAA Thermo Fisher 11140050
Neurobasal Thermo Fisher 21103049
Poly-L-ornithine Sigma Aldrich P3655
ROCK inhibitor Tocris 1254
SB431542 Tocris 1614
SHH Applied Biological Materials Z200617
Stemdiff Neural Progenitor medium Stemcell Technologies 5833 NPC expansion medium

DOWNLOAD MATERIALS LIST

References

  1. Thomson, J. A., et al. Embryonic stem cell lines derived from human blastocysts. Science. 282, (5391), 1145-1147 (1998).
  2. Rosler, E. S., et al. Long-term culture of human embryonic stem cells in feeder-free conditions. Developmental Dynamics. 229, (2), 259-274 (2004).
  3. Mallon, B. S., Park, K. Y., Chen, K. G., Hamilton, R. S., McKay, R. D. Toward xeno-free culture of human embryonic stem cells. The International Journal of Biochemistry & Cell Biology. 38, (7), 1063-1075 (2006).
  4. Hoffman, L. M., Carpenter, M. K. Characterization and culture of human embryonic stem cells. Nature Biotechnology. 23, (6), 699-708 (2005).
  5. Yan, Y., et al. Efficient and rapid derivation of primitive neural stem cells and generation of brain subtype neurons from human pluripotent stem cells. Stem Cells Translational Medicine. 2, (11), 862-870 (2013).
  6. Goncalves, J. T., Schafer, S. T., Gage, F. H. Adult Neurogenesis in the Hippocampus: From Stem Cells to Behavior. Cell. 167, (4), 897-914 (2016).
  7. Watanabe, K., et al. A ROCK inhibitor permits survival of dissociated human embryonic stem cells. Nature Biotechnology. 25, (6), 681-686 (2007).
  8. International Stem Cell Initiative. Characterization of human embryonic stem cell lines by the International Stem Cell Initiative. Nature Biotechnology. 25, (7), 803-816 (2007).
  9. Hartung, O., Huo, H., Daley, G. Q., Schlaeger, T. M. Clump passaging and expansion of human embryonic and induced pluripotent stem cells on mouse embryonic fibroblast feeder cells. Current Protocols in Stem Cell Biology. 14, (1), Chapter 1 Unit 1C 10 (2010).
  10. Chen, K. G., et al. Non-colony type monolayer culture of human embryonic stem cells. Stem Cell Research. 9, (3), 237-248 (2012).
  11. Chen, G., Hou, Z., Gulbranson, D. R., Thomson, J. A. Actin-myosin contractility is responsible for the reduced viability of dissociated human embryonic stem cells. Cell Stem Cell. 7, (2), 240-248 (2010).
  12. Li, X., Krawetz, R., Liu, S., Meng, G., Rancourt, D. E. ROCK inhibitor improves survival of cryopreserved serum/feeder-free single human embryonic stem cells. Human Reproduction. 24, (3), 580-589 (2009).
  13. Ohgushi, M., et al. Molecular pathway and cell state responsible for dissociation-induced apoptosis in human pluripotent stem cells. Cell Stem Cell. 7, (2), 225-239 (2010).
  14. Pakzad, M., et al. Presence of a ROCK inhibitor in extracellular matrix supports more undifferentiated growth of feeder-free human embryonic and induced pluripotent stem cells upon passaging. Stem Cell Reviews and Reports. 6, (1), 96-107 (2010).
  15. Chambers, S. M., et al. Highly efficient neural conversion of human ES and iPS cells by dual inhibition of SMAD signaling. Nature Biotechnology. 27, (3), 275-280 (2009).
  16. Jeon, K., et al. GLIS3 Transcriptionally Activates WNT Genes to Promote Differentiation of Human Embryonic Stem Cells into Posterior Neural Progenitors. Stem Cells. 37, (2), 202-215 (2019).
  17. Emre, N., et al. The ROCK inhibitor Y-27632 improves recovery of human embryonic stem cells after fluorescence-activated cell sorting with multiple cell surface markers. PLoS ONE. 5, (8), e12148 (2010).
  18. Hanna, J., et al. Human embryonic stem cells with biological and epigenetic characteristics similar to those of mouse ESCs. Proceedings of the National Academy of Sciences of the United States of America. 107, (20), 9222-9227 (2010).
  19. Saha, K., et al. Surface-engineered substrates for improved human pluripotent stem cell culture under fully defined conditions. Proceedings of the National Academy of Sciences of the United States of America. 108, (46), 18714-18719 (2011).
  20. Tsutsui, H., et al. An optimized small molecule inhibitor cocktail supports long-term maintenance of human embryonic stem cells. Nature Communications. 2, 167 (2011).
  21. Xu, Y., et al. Revealing a core signaling regulatory mechanism for pluripotent stem cell survival and self-renewal by small molecules. Proceedings of the National Academy of Sciences of the United States of America. 107, (18), 8129-8134 (2010).
  22. Ungrin, M. D., Joshi, C., Nica, A., Bauwens, C., Zandstra, P. W. Reproducible, ultra high-throughput formation of multicellular organization from single cell suspension-derived human embryonic stem cell aggregates. PLoS ONE. 3, (2), e1565 (2008).
  23. Kim, D. S., et al. Highly pure and expandable PSA-NCAM-positive neural precursors from human ESC and iPSC-derived neural rosettes. PLoS ONE. 7, (7), e39715 (2012).
  24. Sun, Y., Hu, J., Zhou, L., Pollard, S. M., Smith, A. Interplay between FGF2 and BMP controls the self-renewal, dormancy and differentiation of rat neural stem cells. Journal of Cell Science. 124, (Pt 11), 1867-1877 (2011).
  25. Zhou, J. M., Chu, J. X., Chen, X. J. An improved protocol that induces human embryonic stem cells to differentiate into neural cells in vitro. Cell Biology International. 32, (1), 80-85 (2008).
  26. Smith, J. R., et al. Inhibition of Activin/Nodal signaling promotes specification of human embryonic stem cells into neuroectoderm. Developmental Biology. 313, (1), 107-117 (2008).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics