Effiziente neuronale Differenzierung mit einzelzellischer Kultur menschlicher embryonaler Stammzellen

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Hier wird ein Protokoll zur Erzeugung einer einzelzelligen Kultur menschlicher embryonaler Stammzellen und deren anschließende Differenzierung in neuronale Vorläuferzellen vorgestellt. Das Protokoll ist einfach, robust, skalierbar und eignet sich für Arzneimittelscreenings und anwendungen in der regenerativen Medizin.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Jeon, K., Park, K., Jetten, A. M. Efficient Neural Differentiation using Single-Cell Culture of Human Embryonic Stem Cells. J. Vis. Exp. (155), e60571, doi:10.3791/60571 (2020).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Die In-vitro-Differenzierung menschlicher embryonaler Stammzellen (hESCs) hat die Fähigkeit verändert, die menschliche Entwicklung sowohl auf biologischer als auch auf molekularer Ebene zu untersuchen, und Zellen für den Einsatz in regenerativen Anwendungen bereitgestellt. Standardansätze für die hESC-Kultur, die Koloniekultur verwendet, um undifferenzierte hESCs und embryoiden Körper (EB) und Rosettenbildung zur Differenzierung in verschiedene Keimschichten aufrechtzuerhalten, sind ineffizient und zeitaufwändig. Hier wird eine Einzelzellkulturmethode vorgestellt, die hESCs anstelle einer Koloniekultur verwendet. Diese Methode ermöglicht die Aufrechterhaltung der charakteristischen Merkmale undifferenzierter hESCs, einschließlich der Expression von hESC-Markern auf Ebenen, die mit Kolonietyp-hESCs vergleichbar sind. Darüber hinaus stellt das Protokoll eine effiziente Methode für die Generierung von neuronalen Vorläuferzellen (NPC) aus einzelligen hESCs dar, die NPCs innerhalb einer Woche produziert. Diese Zellen exprimieren in hohem Maße mehrere NPC-Markergene und können sich in verschiedene neuronale Zelltypen differenzieren, einschließlich dopaminergen Neuronen und Astrozyten. Dieses einzellige Kultursystem für hESCs wird nützlich sein, um die molekularen Mechanismen dieser Prozesse, Studien zu bestimmten Krankheiten und Drogenentdeckungs-Screens zu untersuchen.

Introduction

Menschliche embryonale Stammzellen (hESCs) haben das Potenzial, sich in die drei primären Keimschichten zu differenzieren, die sich dann in verschiedene multipotente Vorläuferzelllinien differenzieren. Diese Abstammungen führen in der Folge zu allen Zelltypen im menschlichen Körper. In-vitro-hESC-Kultursysteme haben die Fähigkeit, die menschliche embryonale Entwicklung zu untersuchen, verändert und als wertvolles Instrument gedient, um neue Erkenntnisse darüber zu erhalten, wie diese Prozesse auf biologischer und molekularer Ebene reguliert werden. In ähnlicher Weise liefern Studien mit induzierten pluripotenten Stammzellen (iPSCs), die aus der Reprogrammierung sammatischer Zellen, die von menschlichen Patienten isoliert wurden, generiert wurden, neue Einblicke in verschiedene Krankheiten. Darüber hinaus können Vorläufer und differenzierte Zellen, die aus hESCs gewonnen werden, für die Forschung mit Stammzelltherapie und Arzneimittelscreening1,2,3,4nützlich sein.

hESCs können induziert werden, um sich in neuronale Vorläuferzellen (NPCs) zu differenzieren, die Multipotentialzellen mit einer umfangreichen Selbsterneuerungskapazität sind. Anschließend können diese Zellen in Neuronen, Astrozyten und Oligodendrozyten 5,6unterschieden werden. NPCs bieten auch ein zelluläres System für In-vitro-Studien der Neuroentwicklungsbiologie und verschiedeneneurologische Erkrankungen. Die derzeitigen Koloniekulturmethoden, die hESCs und ihre Differenzierung in NPCs beinhalten, sind jedoch ineffizient und beinhalten häufig Kokultur sowie Embryoidenkörper (EB) und Rosettenbildung5,7,8,9. Diese Protokolle weisen niedrigere Überlebensraten und spontane Differenzierung auf und sind zeitaufwändiger.

Hier wird ein verbessertes und robustes Kultursystem vorgestellt, das leicht skalierbar ist und eine einzellige Kultur mit hoher Dichte von hESCs10verwendet. Die Einbeziehung von Rohkinase (ROCK) Inhibitor trug zur deutlich verbesserten Überlebenseffizienz während der einzelzelligen Typkultur von hESC10,11,12,13,14. In diesem Kultursystem können hESCs einfach gewartet und erweitert werden. Darüber hinaus stellt das Protokoll eine effiziente Methode zur Generierung von NPCs aus einer einzelligen Typkultur von hESCs dar, die die Produktion von hochreinen NPCs ermöglicht. Hemmung von BMP/TGF/Activin-Signalwegen mit ALK-Inhibitoren induziert effizient die Differenzierung von einzelligen HESCs in NPCs15,16, die dann induziert werden können, um sich in funktionelle neuroale Leitungen wie dopaminerische Neuronen zu differenzieren.

Zusammenfassend lässt sich sagen, dass das Einzelzelltypkulturprotokoll mit hESCs ein attraktives Modell bietet, um die Differenzierung dieser Zellen in verschiedene Linien, einschließlich NPCs, zu untersuchen. Dieses Protokoll ist leicht skalierbar und daher für die Erzeugung von Zellen für die Forschung mit regenerativer Therapie und Arzneimittelscreening geeignet.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Herstellung von hESC-qualifizierten Basement Membrane Matrix-beschichteten Platten

  1. Langsam die hESC-qualifizierte Kellermembranmatrix (siehe Materialtabelle)bei 4 °C mindestens 2–3 h oder über Nacht auftauen, um die Bildung eines Gels zu vermeiden.
  2. Zur Herstellung von Kellermembran-Matrix-beschichteten Platten die Matrix in kalter DMEM/F12 auf eine Endkonzentration von 2% verdünnen. Gut mischen und jeden Brunnen einer 6-Well-Platte mit 1 ml der verdünnten Matrixlösung beschichten.
  3. Die mit der Kellermembran beschichteten Platten bei Raumtemperatur (RT) mindestens 3 h oder über Nacht bei 4 °C inkubieren.
    HINWEIS: Platten mit Kellermembranmatrix können 1 Woche lang bei 4 °C gelagert werden, bevor die Matrixlösung entfernt und Platten verwendet werden.

2. Anpassung von Kolonietyp hESCs an einzellige hESC-Kultur

  1. Um die feederfreien Kulturen der Kolonie Typ H9 (WA09) hESCs, die auf Derkellermembranmatrix angebaut werden, zu durchdringen, aspirieren Sie das Medium aus den Brunnen (Abbildung 1A)9.
  2. 1x mit 1 ml DPBS waschen. 1 ml Dispaselösung (1 U/ml) pro Brunnen hinzufügen und bei 37 °C 20 min inkubieren.
  3. Entfernen Sie die Dispase, waschen Sie die Zellen 1x vorsichtig mit 2 ml DMEM/F12, entfernen Sie das Medium, und fügen Sie 2 ml DMEM/F12 zu jeder Platte hinzu.
  4. Trennen Sie Kolonien vorsichtig, indem Sie sanft nach oben und unten pfeifen und in ein 15 ml Rohr übertragen.
  5. Zentrifugieren Sie die Pellets für 2 min bei 370 x g und aspirieren Sie das Medium.
  6. Um die Zellpellets in Einzelzellen zu dissoziieren, fügen Sie 2 ml Zellablösung (1x Konzentration, siehe Tabelle der Materialien)hinzu und brüten bei 37 °C für 10 min.
  7. Zentrifugenzellen für 2 min bei 370 x g und entfernen Sie die Ablösungslösung.
  8. Fügen Sie frischem mTeSR1 menschlichen ESC-Medium hinzu und dissoziieren Sie die Zellen in einzelne Zellen, indem Sie sanft nach oben und unten pipetieren.
  9. Um Kolonietyp-hESCs an eine einzellige Typkultur anzupassen, platte ca. 1.5–2.0 x 106 hESCs in jeden Brunnen der Kellermembran Matrix-beschichtete 6-Well-Platte in 2 ml mTeSR1 mit 10 'M ROCK-Inhibitor für 24 h(Abbildung 1A).
  10. Ersetzen Sie nach 24 h das hESC-Medium durch frischen mTeSR1 ohne ROCK-Hemmer und lassen Sie die hESCs 3 Tage lang als einzelliges Wachstum anbauen. Ändern Sie das Medium täglich.
  11. Am 4. Tag, wenn Kulturen fast 100% Koninfluenza erreichen, dissoziieren Zellen in Ablösungslösung, dann replate wie in Schritt 2.6 beschrieben.
    HINWEIS: Der ROCK-Inhibitor verbessert das Zellüberleben während der anfänglichen 24 h der einzelligen hESC-Kultur.

3. Embryoide Körperbildung und Differenzierung in drei Keimschichten (Abbildung 2)

  1. Um EBs zu bilden, resuspendieren Sie zunächst Zellen in 3 ml mTeSR1-Medium mit 10 'M ROCK-Inhibitor während der ersten 24 h, dann über Nacht in 60 mm niedrige Befestigungsschalen in einem 37 °C-Inkubator inkubieren, um eine Aggregation zu ermöglichen.
  2. Nach 24 h werden die kleinen EBs in ein 15 ml Rohr übertragen. Lassen Sie die EBs an der Unterseite des Rohres absetzen und entfernen Sie das Medium vorsichtig mit einer Pipette. Übertragen Sie EBs in EB-Medium (Knockout-DMEM ergänzt mit 20% Knockout-Serum-Ersatz, 1x Glutamin-Ergänzung [siehe Materialtabelle], 1% NEAA [nicht-essentielle Aminosäuren; siehe Tabelle der Materialien], und 0,2% -Mercaptoethanol) und lassen Sie sie in Low Attachment Geschirr für 7 Tage zu erweitern. Das Medium kann wie oben beschrieben jeden zweiten Tag gewechselt werden (Abbildung 2A).
  3. Sammeln Sie am 7. Tag die EBs aus den Gerichten und geben Sie sie in eine 15 ml Tube. Entfernen Sie das Medium vorsichtig mit einer Pipette und übertragen Sie die EBs auf eine Kellermembran-Matrix-beschichtete 6-Well-Platte.
  4. Lassen Sie die EBs an der Platte befestigen und 12 Tage lang in EB-Medium brüten, während der sie sich in die drei Keimschichten differenzieren (Abbildung 2B). Ändern Sie das Medium jeden zweiten Tag.
    HINWEIS: Bei der Aggregation von Zellen hilft die niedrige Befestigungsschale, EB-Anhaftung zu vermeiden.

4. Differenzierung von einzelligen HESCs in NPCs (Abbildung 3)

  1. Um eine NPC-Differenzierung zu induzieren, dissoziieren Sie einzellige hESCs mit 1 ml Ablösungslösung (1x) und inkubieren Sie 10 min bei 37 °C.
  2. Zentrifugieren Sie die Zellen für 2 min bei 370 x g und entfernen Sie die Ablösungslösung Überstand. Fügen Sie 1 ml DMEM/F12 hinzu und setzen Sie Zellen durch sanftes Pipettieren wieder auf.
  3. Plattenzellen auf einer Mitschleifmembranmatrix-beschichteten 6-Well-Platte mit einer Dichte von 2 x 105 Zellen/Well in 2 ml mTeSR1 mit 10 M ROCK-Inhibitor.
  4. Ersetzen Sie nach 24 h das Kulturmedium durch ein neuronales Induktionsmedium (DMEM mit 1% B27 minus Vitamin A), ergänzt durch 1 M Dorsomorphin und 5 m SB431542.
  5. Ändern Sie das Medium jeden zweiten Tag während der ersten 4 Tage der neuronalen Induktion, dann jeden Tag bis zum Zusammenfluss an Tag 7 (Abbildung 3B).
    ANMERKUNG: (1) Dorsomorphin hemmt den BMP-Signalweg, indem es auf ALK2,3,6-Rezeptoren abzielt und auch AMPK hemmt; SB431542 ist ein Inhibitor des TGF/Activin-Signalwegs, indem er AUF ALK5,7 abzielt. (2) Das gleiche Protokoll wurde mit einer anderen ESC-Leitung (WA01) getestet, die ähnliche Ergebnisse wie WA0916lieferte. (3) Wir haben im Allgemeinen Matrigel für die Kellermembranmatrix verwendet; Zellen können jedoch auf Geltrex kultiviert und dann in NPCs mit sehr ähnlichen Ergebnissen differenziert werden, wie durch die Expression mehrerer NPC-Marker angegeben (Abbildung 4D,E). Behandeln Sie Geltrex auf die gleiche Weise wie Matrigel (siehe Abschnitt 1).

5. NPC-Erweiterung und Kryokonservierung

  1. Nach 7 Tagen neuronaler Induktion die Zellen mit 1 ml Ablösungslösung (1x) zu dissoziieren und 10 min bei 37 °C zu inkubieren.
  2. Zentrifugieren Sie die Zellen für 2 min bei 370 x g und entfernen Sie die Ablösungslösung Überstand. Fügen Sie 1 ml NPC-Erweiterungsmedium hinzu (siehe Materialtabelle) und setzen Sie Zellen durch sanftes Pipettieren wieder auf.
  3. Platte 1 x 105 Zellen in 2 ml NPC-Ausdehnungsmedium auf Kellermembranmatrix-beschichteten 6 Brunnenplatten.
  4. Passage NPCs mehrmals, wenn die Kulturen erreichen fast 90% Konfluenz. Während der ersten 3–4 Passagen, fügen Sie 10 'M ROCK-Hemmer während der anfänglichen 24 h, um den Zelltod zu verhindern. Nach diesen Passagen können Zellen ohne ROCK-Hemmer durchgangen und kultiviert werden. Ändern Sie das Medium jeden zweiten Tag während der Erweiterung.
  5. Kryopreserve NPCs, wenn Kulturen konfluenz erreichen.
    1. Zur Kryokonservierung die Zellen in 1 ml Ablösungslösung (1x) für 5 min bei 37 °C, dann Zentrifugensuspension für 2 min bei 370 x g, um die Ablösungslösung zu entfernen.
    2. Fügen Sie eine Zellgefrierlösung (siehe Materialtabelle) zu dissoziierten NPCs mit 1 x 106 Zellen/ml hinzu und verteilen Sie 1 ml Aliquots an Kryovials.
    3. Die Kryovials in den Gefrierbehälter geben und über Nacht in einem -80 °C Gefrierschrank aufbewahren.
  6. Bewahren Sie die Kryovials im flüssigen Stickstoff auf.

6. Herstellung von Poly-L-Ornithin (PLO) und Lamin-beschichteten Platten

  1. Zur Herstellung von PLO/lamininbeschichteten Platten die PLO-Lagerlösung in PBS oder Wasser auf eine Endkonzentration von 10 g/ml verdünnen. Gut mischen und jeden Brunnen einer 6-Well-Platte mit 1 ml verdünnter PLO-Lösung beschichten.
  2. Mindestens 2 h bei 37 °C oder über Nacht bei 4 °C inkubieren.
  3. Waschen Sie jeden gut mit PBS.
  4. Verdünnen Sie die Lamininstofflösung in kaltem PBS oder Wasser bei 10 g/ml. Mischen Sie die Lamininlösung gut. Entfernen Sie die PBS und beschichten Sie sofort jeden Brunnen mit 1 ml der Lamininlösung. Platten bei 4 °C aufbewahren und innerhalb von 1 Woche verwenden. Mit PBS waschen und sofort Kulturmedium hinzufügen.
    HINWEIS: Lassen Sie die PLO/lamininbeschichteten Platten nicht austrocknen.

7. Differenzierung von hESC-abgeleiteten NPCs in dopaminerge Neuronen (Abbildung 6A)

  1. Platten-NPCs in PLO/lamininbeschichteten Schalen in NPC-Ausdehnungsmedium mit einer Dichte von ca. 50%.
  2. Nach 24 h, ändern Sie das Medium auf DA1 Medium (neurobasales Medium mit 2 mM Glutamin-Ergänzung, 1x NEAA, 1x B27, 200 ng/mL SHH und 100 ng/mL FGF8) und ändern Sie das Medium jeden zweiten Tag.
  3. Durchgangskulturen, wenn sie die Durchflusse erreichen. Zerlegen Sie Zellen mit 1 ml Ablösungslösung (1x) und inkubieren Sie 10 min bei 37 °C.
  4. Zentrifugieren Sie die Zellen für 2 min bei 370 x g und entfernen Sie die Ablösungslösung Überstand. Fügen Sie 1 ml DA1 Medium hinzu und setzen Sie die Zellen durch sanftepipettierende Leitungen wieder auf.
  5. Platte 1 x 105 Zellen in 2 ml DA1 Medium auf PLO/lamininbeschichteten 6 Brunnenplatten.
  6. Nach 10 Tagen in DA2-Medium (neurobasales Medium mit 2 mM Glutamin-Ergänzung, 1x NEAA, 1x B27, 200 M Ascorbinsäure, 20 ng/mL BDNF und 20 ng/ml GNDF) wechseln und Medium jeden zweiten Tag für weitere 20 Tage wechseln (Abbildung 6A).
    HINWEIS: Fügen Sie dem DA2-Medium täglich frische Ascorbinsäure hinzu. Innerhalb der ersten 14 Tage sollten die differenzierten Zellen übergeben werden, wenn sie 90% Konfluenz erreichen, aber nicht mehr danach.

8. Differenzierung von ESC-abgeleiteten NPCs in Astrozyten

  1. Plattenneurale Vorläuferzellen auf PLO/lamininbeschichteten Platten im NPC-Ausdehnungsmedium mit einer Dichte von ca. 50%.
  2. Nach 24 h das Medium in ein Astrozytenmedium (DMEM/F12 medium einschließlich 1:100 N2, 1:100 B27, 200 ng/mL IGF, 10 ng/mL Activin A, 10 ng/ml heregulin -1 und 8 ng/mL bFGF) ändern und das Medium jeden zweiten Tag ändern.
  3. Durchgangskulturen, wenn sie die Durchflusse erreichen. Zerlegen Sie Zellen mit 1 ml Ablösungslösung (1x) und inkubieren Sie 10 min bei 37 °C.
  4. Zentrifugieren Sie die Zellen für 2 min bei 370 x g und entfernen Sie die Ablösungslösung Überstand. Fügen Sie 1 ml Astrozytenmedium hinzu und suspendieren Sie die Zellen durch sanftes Pipettieren.
  5. Platte 1 x 105 Zellen in 2 ml Astrozytenmedium auf PLO/Laminin-beschichteten 6 Brunnenschalen.
  6. Lassen Sie die Differenzierung für insgesamt 5–6 Wochen fortsetzen (Abbildung 6B).

9. Immunfluoreszenz Färbung

  1. Kulturzellen in 35-mm-Schalen, wie oben beschrieben für jeden Zelltyp. Aspirieren Sie das Medium und fügen Sie 1 ml 4% PFA-Lösung pro Schale und inkubieren für 20 min bei RT.
  2. 2x für 5 min mit PBS waschen.
    HINWEIS: Sobald die Zellen fixiert sind, können die Assayplatten mit Parafilm versiegelt und bei 4 °C gelagert werden. Stain mit einem Antikörper innerhalb von 1 Woche nach der Fixierung.
  3. Fügen Sie 300 l Blockierlösung (Ziegen- oder Eselsserum in PBS) pro Schale hinzu und brüten Bei RT für 30–60 min.
  4. Waschen Sie die Schale 2x mit PBS für 5 min.
  5. Fügen Sie 300 l Primärantikörper(Tabelle 1) Lösung (in Blockierlösung verdünnt) und inkubieren bei RT für 1,5 h oder über Nacht bei 4 °C.
  6. 2x mit PBS für 10 min waschen.
  7. Fügen Sie 300 l fluoreszierend konjugierten Sekundärantikörper (Tabelle 1) in die Blockierlösung und inkubieren im Dunkeln für 1 h bei RT.
  8. Waschen Sie die Zellen 2x für 10 min mit PBS.
  9. Hoechst-Färbelösung (1 M Endkonzentration in PBS) zu Fleckenkernen hinzufügen. Inkubieren Sie die Zellen im Dunkeln für 5 min bei RT.
  10. Waschen Sie Zellen 1x mit PBS für 5 min und fügen Sie dann 500 l PBS hinzu. Halten Sie Geschirr im Dunkeln, dann beobachten Sie fluoreszenz mit einem konfokalen Mikroskop (Abbildung 2B, Abbildung 5C, Abbildung 6Aund Abbildung 7B).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Hier wird ein verbessertes Protokoll zur Erhaltung und Erweiterung der einzelligen Typkultur von hESCs und deren effizienter Differenzierung in neuronale Vorläuferzellen vorgestellt, die sich anschließend in verschiedene nachgeschaltete neuronale Linien differenzieren. einschließlich dopaminergen Neuronen und Astrozyten.

Repräsentative Phasenkontrastbilder zeigen die Zellmorphologie in verschiedenen Schritten während der Anpassung von Kolonietyp hESCs an die einzellige Typkultur (Abbildung 1A). Durch den zustand der einzelligen Kultur wurde festgestellt, dass die angepassten hESCs in der Lage waren, mit hoher Dichte zu halten und dann beim Erreichen der Konfluenz einfach und effizient subkultiviert zu werden (Abbildung 1A,B). Diese Zellen behielten die Zellzykluseigenschaften (d. h. eine kurze G1-Phase und einen hohen Anteil von Zellen in der S-Phase) auf, die typisch für Kolonietyp hESCs sind (Abbildung 1C,D). Sie drückten auch die ESC-Marker (d. h. OCT4, TRA 1-81, SOX2 und NANOG) in Einem Niveau aus, das mit denen von Kolonietyp hESCs vergleichbar ist, wie durch QRT-PCR und Immunstaining-Analyse angegeben (Abbildung 7, Tabelle 2). Darüber hinaus wurde gezeigt, dass einzellige hESCs in der Lage waren, embryoiden Körper zu bilden, die Zellen aus allen drei Keimschichten enthalten: Endoderm (SOX17-Expression), Mesoderm (SMA-Expression) und Ektoderm (Tuj-1-Expression) (Abbildung 2).

Als nächstes wurde gezeigt, dass einzellige HESCs mit Hilfe eines NPC-Protokolls (Abbildung 3A), wie durch den Verlust der typischen hESC-Morphologie und das Auftreten der NPC-Morphologie (Abbildung 3B)16, effizient in neuronale Vorläuferzellen differenziert wurden. Die NPC-Differenzierung wurde durch die erhöhte Expression der Signatur-NPC-Marker (d. h. SOX1, OTX2, ZIC1 und OTX1; Abbildung 5A, Tabelle 2) und bestätigt durch Immunostainierung und FACS-Analyse. Die gleiche Analyse zeigte auch, dass mehr als 90% der Zellen positiv für SOX1, PAX6 und NCAM-Protein gefleckt wurden (Abbildung 5B,C). Um die Fähigkeit von einzelzelligen hESC-abgeleiteten NPCs zu untersuchen, sich in verschiedene nachgeschaltete neuronale Linien zu differenzieren, wurde die Differenzierung dieser Zellen in dopaminerge Neuronen und Astrozyten untersucht. Wie in Abbildung 6A,Bdargestellt, konnten sich einzellige hESC-abgeleitete NPCs in dopaminerge Neuronen und Astrozyten unterscheiden, wie das Auftreten charakteristischer Morphologien und die Expression von linienspezifischen dopaminergen Markern (d. h. TH; Abbildung 6A) und Astrozytenmarker (d. h. GFAP und S100B; Abbildung 6B).

Figure 1
Abbildung 1: Anpassung von Kolonietyp hESCs an die Einzelzelltypkultur. (A) Repräsentative Phasenkontrastbilder von Einzelzellkulturen von H9-HESCs zu unterschiedlichen Zeiten nach der Beschichtung auf 2% Kellermembranmatrix-beschichteten Schalen. Niedrige (linke) und hohe (rechte) Vergrößerung. Oberseite des Panels: repräsentatives Bild von Kolonietyp hESCs. Andere Panels zeigen repräsentative Bilder von Kulturen zu unterschiedlichen Zeiten während der Anpassung an einzellige hESCs. Skalenbalken = 200 m. (B) Wachstumskurven von H9-HESCs wurden in 2% Kellermembran-Matrix-beschichteten Platten mit 10 M ROCK-Inhibitor für die ersten 24 h während der einzelzelligen Kulturbedingung überwacht. (C,D) Zellzyklusanalyse des Kolonietyps (C) und des einzelzelligen Typs (D) H9 hESCs durch Durchflusszytometrie. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 2
Abbildung 2: In-vitro-Differenzierung angepasster einzelliger hESCs in drei Keimschichten. (A) Repräsentative Phasenbilder embryonaler Körper (EB), die vom einzelzelligen Typ von hESCs abgeleitet wurden. Skalenbalken = 100 m. (B) Immunfluoreszenzbilder differenzierter hESCs, die für die Expression der drei verschiedenen Keimschichtmarker analysiert wurden: SOX17 (Endoderm), SMA (Mesoderm) und Tuj-1 (Ektoderm). Kerne wurden mit DAPI befleckt. Skalenbalken = 50 m. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 3
Abbildung 3: Differenzierung von einzelligen hESCs in neuronale Vorläuferzellen durch direkte Differenzierung. (A) Schemat des Differenzierungsprotokolls von hESCs in neuronale Vorläuferzellen (NPCs). hESCs wurden 1 Tag nach der Beschichtung mit Dorsomorphin (DMH) und SB431542 (SB) behandelt. (B) Repräsentative Phasenkontrastbilder der Zellmorphologie während der neuronalen Differenzierung. Skalenbalken = 200 m. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 4
Abbildung 4: hESC-Kultur auf verschiedenen Kellermembran-Matrix-Produkten. (A) hESCs, die auf Matrigel oder Geltrex kultiviert wurden, zeigten eine Fähigkeit, zu wachsen und sich in NPCs zu differenzieren, die der Einzelzellkultur ähnelten. Die Zellen wurden mit einem NESTIN-Antikörper befleckt. Kerne wurden mit DAPI befleckt. Skalenbalken = 50 m. (B) hESCs, die auf Matrigel oder Geltrex kultiviert wurden, zeigten ein ähnliches Potenzial, sich in NPCs zu differenzieren, wie durch den Prozentsatz der NESTIN- und PAX6-positiven Zellen angegeben. Die Zellen wurden durch Durchflusszytometrie an Tag 7 der NPC-Differenzierung analysiert. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 5
Abbildung 5: Ausdruck von NPC-Markern. (A) Nach 7 Tagen neuronaler Differenzierung wurde die Expression von NPC-Markergenen (d. h. OTX1, OTX2, SOX1 und ZIC1) mit QRT-PCR analysiert. Die Werte wurden auf GAPDH normalisiert und relativ zu den Werten von hESCs (p < 0,05) berechnet. (B) Der Prozentsatz der SOX1-, NESTIN-, SOX2- und NCAM-positiven Zellen wurde durch Durchflusszytometrie am 7. Tag der NPC-Differenzierung bestimmt. (C) Bei Tag 7 NPC-Differenzierung wurden Zellen mit Antikörpern gegen die neuronalen Marker SOX1, NESTIN, NCAM, OTX2 und PAX6 gefärbt. Kerne wurden mit DAPI befleckt. Skalenbalken = 100 m. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 6
Abbildung 6: Dopaminerge Neuron- und Astrozytendifferenzierung von NPCs, die von einzelligen HESCs abgeleitet sind. (A) Repräsentatives Phasenkontrastbild von dopaminergen Neuronen (oberes Panel). Skalenbalken = 100 m. Differenzierte Zellen wurden mit Antikörpern gegen den dopaminergen Neuronenmarker TH (Tyrosinhydroxylase) gefärbt, wie angegeben. Kerne wurden mit DAPI befleckt. Skalenbalken = 50 m. (B) Repräsentatives Phasenkontrastbild von Astrozyten (oberes Panel). Skalenbalken = 100 m. Differenzierte Zellen wurden mit Antikörpern gegen den Astrozytenmarker GFAP (glial fibrilläres saures Protein) und S100-B (S100 Calciumbindungsprotein B) gefärbt, wie angegeben. Kerne wurden mit DAPI befleckt. Skalenbalken = 50 m. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 7
Abbildung 7: Charakterisierung von hESCs des typs Einzelzellen. (A) hESCs, die an die Einzelzelltypkultur angepasst sind, wurden für die Expression von ESC-Markern (d. h. OCT4, NANOG und SOX2) durch QRT-PCR analysiert. Die Werte wurden auf GAPDH (p < 0,05) normalisiert. (B) Immunfluoreszenzbilder von hESCs, die für die Expression der Pluripotenzmarker OCT4, TRA-1-81 und SSEA-1 gebeizt werden. Kerne wurden mit DAPI befleckt. Skalenbalken = 50 m. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Primäre Antikörper Spezies Verdünnung Katalognummer Unternehmen
OKT4 Maus 1:1000 sc-5279 Santa Cruz
TRA 1-81 Maus 1:500 sc-21706 Santa Cruz
SSEA-1 Maus 1:500 sc-21702 Santa Cruz
SOX1 Ziege 1:500 AF-3369 F&E
SOX2 Kaninchen 1:1,000 sc-20088 Santa Cruz
Sma Kaninchen 1:500 ab-5694 Abcam
Tuj1 Maus 1:1000 T8578 Sigma
NESTIN Maus 1:1000 ab-22035 Abcam
OTX2 Maus 1:250 ab-21990 Abcam
hNCAM Maus 1:200 sc-106 Santa Cruz
hPAX6 Maus 1:250 561664 Bd
Th Maus 1:500 T1299 Sigma
S100b Maus 1:250 ab4066 Abcam
GFAP Kaninchen 1:1,000 ab7260 Abcam
Sekundäre Antikörper
Anti-Maus Ziege 1:1,000 AF 488 oder 647 Life Technologies
Anti-Kaninchen Ziege 1:1,000 AF 488 oder 647 Life Technologies

Tabelle 1: Antikörper, die in der Immunzytochemie und FACS-Analyse eingesetzt werden.

Primername Primer-Sequenz
OKT4 F: GGAAGGTATTCAGCCAAACG
R: CTCCAGGTTGCCTCTCACTC
Nanog F: GGTTCCAGAACCAGAGAATGA
R: ATTGGAAGGTTCCCAGTCG
SOX1 F: CCTTAGGTTTCCCCTCGCTTT
R: CAGGCTGAATTCGGTTCTCATT
OTX1 F: AAGATCAACCTGCCGGAGTCT
R: CGTGAATTGGCCACTGCTTT
OTX2 F: TGGAAGCACTGTTTGCCAAG
R: TAAACCATACCTGCACCCTCG
ZIC1 F: AACCCCAAAAAGTCGTGCAAC
R: TCCTCCCAGAAGCAGATGTGA
GAPDH F: CCCATCACCATCTTCCAGGAG
R: CTTCTCCATGGTGGTGAAGACG

Tabelle 2: Liste der in der QRT-PCR-Analyse verwendeten Primer.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Skalierbare und effiziente Methoden zur Differenzierung von hESCs in verschiedene Linien und die Erzeugung einer ausreichenden Anzahl differenzierter Zellen sind wichtige Kriterien für das Arzneimittelscreening und die Stammzelltherapie. Verschiedene einzellige Passmethoden wurden veröffentlicht, bei denen Zellen in Gegenwart von ROCK-Hemmern oder anderen kleinen Molekülen kultiviert werden, um das Überleben zu verbessern, aber die Endprodukte dieser Kulturmethoden sind Kolonietyp hESCs17,18,19,20,21. Das einzellige ESC-Protokoll, das teilweise auf den zuvor veröffentlichten Methoden19,20,21,22basiert, generiert und verwaltet erfolgreich einzellige hESC-Kulturen und verhindert die Kolonietyp hESC-Kultur. Es umfasst eine einzellige Beschichtung mit hoher Dichte, eine mehrzellige Assoziation, einschichtiges Wachstum und eine effiziente Subkultur (Abbildung 1). Letzteres wurde durch die Zugabe von ROCK-Hemmern während der anfänglichen 24 h einzelligen Typkultur von hESCs erreicht, die das Zellüberleben17,18,19,20,21verbessert. Dieses Protokoll ist einfacher skalierbar und ermöglicht die Erweiterung dieser Zellen für therapeutische Anwendungen im Arzneimittelscreening und Indenzellen.

Es wird ferner gezeigt, dass einzellige hESCs ohne Verwendung einer Zwischenstufe wie EB und Rosettenbildung23,24,25effizient zur NPC-Linie differenzieren können ( Abbildung3). Eine hohe neuronale Umwandlung von einzelligen HESCs wurde durch die Hemmung von BMP/TGF/Activin-Signalwegen durch Behandlung mit den ALK-Inhibitoren Dorsomorphin und SB43154215,16,26erreicht. Mit diesem Protokoll können die angepassten einzelzelligen HESCs effizient in NPCs differenzieren, ohne dass EB und Rosettenbildung erforderlich sind (Abbildung 5) und induziert werden, sich in dopaminerge Neuronen und Astrozyten zu differenzieren (Abbildung 6).

Zusammenfassend lässt sich sagen, dass die einzellige Typkultur von hESCs ein schnelles und effizientes System zur Untersuchung der molekularen Mechanismen bietet, die die mehrstufige Differenzierung zu verschiedenen Linien regulieren. Insbesondere nutzte dieses Protokoll NPCs und beschrieb ihre anschließende Differenzierung in zusätzliche neuronale Linien, wie Astrozyten und dopaminerge Neuronen. Das Protokoll bietet eine Plattform für die einfache, robuste und skalierbare Produktion von Vorläufer- und differenzierten Zellen, die für Basisstudien, Arzneimittelscreenings und Anwendungen in der regenerativen Medizin geeignet sind.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren erklären keine Interessenkonflikte.

Acknowledgments

Wir danken Dr. Carl D. Bortner (NIEHS) für seine Unterstützung bei der FACS-Analyse. Diese Forschung wurde durch das Intramural Research Program des National Institute of Environmental Health Sciences, der National Institutes of Health, Z01-ES-101585 bis AMJ unterstützt.

Materials

Name Company Catalog Number Comments
35 mm m-dishes ibidi 81156 Cell culture dish
6-well plates Corning 3516
Accutase Innovative Cell Technologies AT104-500 Cell detachment solution
Activin A R&D system 338-AC-050
Ascorbic Acid Sigma Aldrich A4403
B27 supplement Thermo Fisher 17504044
B27 supplement (-Vit A) Thermo Fisher 12587010
BDNF Applied Biological Materials Z100065
bFGF Peprotech 100-18C
Centrifuge DAMON/ICE 428-6759
CO2 incubator Thermo Fisher 4110
Corning hESC-qulified Matrix (Magrigel) Corning 354277 Basement membrane matrix (used for most of the protocol here)
Cryostor CS 10 Stemcell Technologies 7930 Cell freezing solution
Dispase Stemcell Technologies 7923
DMEM Thermo Fisher 10569-010
DMEM/F12 Thermo Fisher 10565-018
Dorsomorphin Tocris 3093
EGF Peprotech AF-100-16A
Fetal Bovine Serum Fisher Scientific SH3007003HI
FGF8 Applied Biological Materials Z101705
GDNF Applied Biological Materials Z101057
Geltrex matrix Thermo Fisher A1569601 Basement membrane matrix
GlutaMax Thermo Fisher 35050061 Glutamine supplement, 100X
H9 (WA09) human embryonic stem cell line WiCell WA09
Heregulin b-1 Peprotech 100-3
IGF Peprotech 100-11
Knockout DMEM Thermo Fisher 10829018
Knockout Serum Replacement Thermo Fisher 10828028
Laminin Sigma Aldrich L2020
mTeSR1 Stemcell Technologies 85850 hESC culture medium
N2 supplement Thermo Fisher 17502001
NEAA Thermo Fisher 11140050
Neurobasal Thermo Fisher 21103049
Poly-L-ornithine Sigma Aldrich P3655
ROCK inhibitor Tocris 1254
SB431542 Tocris 1614
SHH Applied Biological Materials Z200617
Stemdiff Neural Progenitor medium Stemcell Technologies 5833 NPC expansion medium

DOWNLOAD MATERIALS LIST

References

  1. Thomson, J. A., et al. Embryonic stem cell lines derived from human blastocysts. Science. 282, (5391), 1145-1147 (1998).
  2. Rosler, E. S., et al. Long-term culture of human embryonic stem cells in feeder-free conditions. Developmental Dynamics. 229, (2), 259-274 (2004).
  3. Mallon, B. S., Park, K. Y., Chen, K. G., Hamilton, R. S., McKay, R. D. Toward xeno-free culture of human embryonic stem cells. The International Journal of Biochemistry & Cell Biology. 38, (7), 1063-1075 (2006).
  4. Hoffman, L. M., Carpenter, M. K. Characterization and culture of human embryonic stem cells. Nature Biotechnology. 23, (6), 699-708 (2005).
  5. Yan, Y., et al. Efficient and rapid derivation of primitive neural stem cells and generation of brain subtype neurons from human pluripotent stem cells. Stem Cells Translational Medicine. 2, (11), 862-870 (2013).
  6. Goncalves, J. T., Schafer, S. T., Gage, F. H. Adult Neurogenesis in the Hippocampus: From Stem Cells to Behavior. Cell. 167, (4), 897-914 (2016).
  7. Watanabe, K., et al. A ROCK inhibitor permits survival of dissociated human embryonic stem cells. Nature Biotechnology. 25, (6), 681-686 (2007).
  8. International Stem Cell Initiative. Characterization of human embryonic stem cell lines by the International Stem Cell Initiative. Nature Biotechnology. 25, (7), 803-816 (2007).
  9. Hartung, O., Huo, H., Daley, G. Q., Schlaeger, T. M. Clump passaging and expansion of human embryonic and induced pluripotent stem cells on mouse embryonic fibroblast feeder cells. Current Protocols in Stem Cell Biology. 14, (1), Chapter 1 Unit 1C 10 (2010).
  10. Chen, K. G., et al. Non-colony type monolayer culture of human embryonic stem cells. Stem Cell Research. 9, (3), 237-248 (2012).
  11. Chen, G., Hou, Z., Gulbranson, D. R., Thomson, J. A. Actin-myosin contractility is responsible for the reduced viability of dissociated human embryonic stem cells. Cell Stem Cell. 7, (2), 240-248 (2010).
  12. Li, X., Krawetz, R., Liu, S., Meng, G., Rancourt, D. E. ROCK inhibitor improves survival of cryopreserved serum/feeder-free single human embryonic stem cells. Human Reproduction. 24, (3), 580-589 (2009).
  13. Ohgushi, M., et al. Molecular pathway and cell state responsible for dissociation-induced apoptosis in human pluripotent stem cells. Cell Stem Cell. 7, (2), 225-239 (2010).
  14. Pakzad, M., et al. Presence of a ROCK inhibitor in extracellular matrix supports more undifferentiated growth of feeder-free human embryonic and induced pluripotent stem cells upon passaging. Stem Cell Reviews and Reports. 6, (1), 96-107 (2010).
  15. Chambers, S. M., et al. Highly efficient neural conversion of human ES and iPS cells by dual inhibition of SMAD signaling. Nature Biotechnology. 27, (3), 275-280 (2009).
  16. Jeon, K., et al. GLIS3 Transcriptionally Activates WNT Genes to Promote Differentiation of Human Embryonic Stem Cells into Posterior Neural Progenitors. Stem Cells. 37, (2), 202-215 (2019).
  17. Emre, N., et al. The ROCK inhibitor Y-27632 improves recovery of human embryonic stem cells after fluorescence-activated cell sorting with multiple cell surface markers. PLoS ONE. 5, (8), e12148 (2010).
  18. Hanna, J., et al. Human embryonic stem cells with biological and epigenetic characteristics similar to those of mouse ESCs. Proceedings of the National Academy of Sciences of the United States of America. 107, (20), 9222-9227 (2010).
  19. Saha, K., et al. Surface-engineered substrates for improved human pluripotent stem cell culture under fully defined conditions. Proceedings of the National Academy of Sciences of the United States of America. 108, (46), 18714-18719 (2011).
  20. Tsutsui, H., et al. An optimized small molecule inhibitor cocktail supports long-term maintenance of human embryonic stem cells. Nature Communications. 2, 167 (2011).
  21. Xu, Y., et al. Revealing a core signaling regulatory mechanism for pluripotent stem cell survival and self-renewal by small molecules. Proceedings of the National Academy of Sciences of the United States of America. 107, (18), 8129-8134 (2010).
  22. Ungrin, M. D., Joshi, C., Nica, A., Bauwens, C., Zandstra, P. W. Reproducible, ultra high-throughput formation of multicellular organization from single cell suspension-derived human embryonic stem cell aggregates. PLoS ONE. 3, (2), e1565 (2008).
  23. Kim, D. S., et al. Highly pure and expandable PSA-NCAM-positive neural precursors from human ESC and iPSC-derived neural rosettes. PLoS ONE. 7, (7), e39715 (2012).
  24. Sun, Y., Hu, J., Zhou, L., Pollard, S. M., Smith, A. Interplay between FGF2 and BMP controls the self-renewal, dormancy and differentiation of rat neural stem cells. Journal of Cell Science. 124, (Pt 11), 1867-1877 (2011).
  25. Zhou, J. M., Chu, J. X., Chen, X. J. An improved protocol that induces human embryonic stem cells to differentiate into neural cells in vitro. Cell Biology International. 32, (1), 80-85 (2008).
  26. Smith, J. R., et al. Inhibition of Activin/Nodal signaling promotes specification of human embryonic stem cells into neuroectoderm. Developmental Biology. 313, (1), 107-117 (2008).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics