İnsan Embriyonik Kök Hücrelerinin Tek Hücre Kültürünü Kullanarak Etkin Nöral Farklılaşma

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Burada sunulan insan embriyonik kök hücrelerinin tek hücreli kültür ve nöral progenitor hücrelere sonraki farklılaşma için bir protokoldür. Protokol basit, sağlam, ölçeklenebilir ve ilaç tarama ve rejeneratif tıp uygulamaları için uygundur.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Jeon, K., Park, K., Jetten, A. M. Efficient Neural Differentiation using Single-Cell Culture of Human Embryonic Stem Cells. J. Vis. Exp. (155), e60571, doi:10.3791/60571 (2020).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

İnsan embriyonik kök hücrelerinin (HESC' ler) in vitro farklılaşması, insan gelişimini hem biyolojik hem de moleküler düzeylerde inceleme yeteneğini dönüştürmüş ve rejeneratif uygulamalarda kullanılmak üzere hücreler sağlamıştır. Farklılaşmamış hESC'leri ve embriyoid gövdeyi (EB) korumak için koloni tipi kültürünü kullanan hESC kültürü için standart yaklaşımlar ve farklı mikrop katmanlarına farklılaşma için rozet oluşumu verimsiz ve zaman alıcıdır. Burada sunulan bir koloni tipi kültür yerine hESCs kullanarak tek hücreli bir kültür yöntemidir. Bu yöntem, koloni tipi hESC'lere benzer düzeylerde hESC belirteçlerinin ekspresyonu da dahil olmak üzere, farklılaşmamış hESC'lerin karakteristik özelliklerinin sürdürülmesini sağlar. Buna ek olarak, protokol 1 hafta içinde NPC'ler üreten tek hücreli tip hESC'lerden nöral progenitor hücre (NPC) üretimi için etkili bir yöntem sunar. Bu hücreler son derece çeşitli NPC marker genleri ifade ve çeşitli nöral hücre tipleri ayırt edebilirsiniz, dopaminerjik nöronlar ve astrositler de dahil olmak üzere. HSS'ler için bu tek hücreli kültür sistemi, bu süreçlerin moleküler mekanizmalarının, bazı hastalıkların çalışmalarının ve ilaç keşif ekranlarının araştırılmasında yararlı olacaktır.

Introduction

İnsan embriyonik kök hücreleri (hESCs) daha sonra çeşitli çok güçlü progenitor hücre soyları ayırt üç birincil mikrop katmanları, ayırt etme potansiyeline sahip. Bu soylar daha sonra insan vücudunda tüm hücre tipleri neden. In vitro hESC kültür sistemleri insan embriyonik gelişimini inceleme yeteneğini dönüştürmüş ve bu süreçlerin biyolojik ve moleküler düzeyde nasıl düzenlendiğine dair yeni bilgiler edinmek için değerli bir araç olarak hizmet vermiştir. Benzer şekilde, insan hastalardan izole edilen somatik hücrelerin yeniden programlanmasından elde edilen indüklenen pluripotent kök hücrelerin (iPSCs) çalışmaları çeşitli hastalıklar hakkında yeni bilgiler sağlamaktadır. Buna ek olarak, atave ve hESCtt türetilen farklılaşmış hücreler kök hücre tedavisi ve ilaç tarama içeren araştırma için yararlı olabilir1,2,3,4.

hESC'ler, geniş bir kendini yenileme kapasitesine sahip çok potansiyelli hücreler olan nöral progenitor hücrelere (NPC) farklılaşmak için indüklenebilir. Daha sonra, bu hücreler nöronlar, astrositler ve oligodendrocytes5,6içine ayırt edilebilir. NDC'ler ayrıca nörogelişimsel biyoloji ve çeşitli nörolojik hastalıkların in vitro çalışmaları için bir hücresel sistem sunuyoruz. Ancak, hESCs ve NPCs içine farklılaşma içeren mevcut koloni tipi kültür yöntemleri verimsiz ve genellikle coculture yanı sıra embriyoid vücut (EB) ve rozet oluşumu5,7,8,9içerir. Bu protokoller daha düşük sağkalım oranları ve spontan farklılaşma sergiler ve daha fazla zaman alır.

Burada sunulan kolayca ölçeklenebilir ve hESCs10yüksek yoğunluklu tek hücreli türü kültür kullanan gelişmiş ve sağlam bir kültür sistemidir. Roh-kigaz (ROCK) inhibitörü dahil hESC10,11,12,13,14tek hücre tipi kültür sırasında önemli ölçüde geliştirilmiş sağkalım verimliliği katkıda bulunmuştur. Bu kültür sisteminde, HESC'ler kolayca korunabilir ve genişletilebilir. Buna ek olarak, protokol hESC'lerin tek hücreli tip kültüründen NCD oluşturmak için etkili bir yöntem sunar, son derece saf NPCs üretimine olanak sağlar. ALK inhibitörleri ile BMP / TGFβ / aktivin sinyal yollarının inhibisyonu verimli npcs içine tek hücreli tip hESCs farklılaşmasıneden15,16, daha sonra dopaminerjik nöronlar ve astrositler gibi fonksiyonel nöral soyları, ayırt etmek için indüklenebilir.

Özetle, hESC'ler kullanarak tek hücreli tip kültür protokolü, bu hücrelerin NP'ler de dahil olmak üzere çeşitli soylara farklılaşmasını incelemek için cazip bir model sunar. Bu protokol kolayca ölçeklenebilir ve bu nedenle rejeneratif tedavi ve ilaç tarama içeren araştırma için hücre oluşturmak için uygundur.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. HESC nitelikli Bodrum Membran Matris Kaplı Plakaların Hazırlanması

  1. Bir jel oluşumunu önlemek için hESC nitelikli bazal membran matrisini (Bkz. Malzeme Tablosu)çözeltisini en az 2-3 saat veya bir gecede 4 °C'de yavaşça eritin.
  2. Bodrum membran matris kaplı plakalar hazırlamak için, soğuk DMEM/F12'de seyreltik matris %2 nihai konsantrasyona kadar. İyi bir şekilde karıştırın ve seyreltilmiş matris çözeltisinin 1 mL'si ile 6 kuyulu bir plakanın her kuyusunu kaplayın.
  3. Bodrum membran matris kaplı plakaları oda sıcaklığında (RT) en az 3 saat veya gece boyunca 4 °C'de kuluçkaya yatırın.
    NOT: Bazal membran matrisli plakalar, matris çözeltisi çıkarılmadan ve plakalar kullanılmadan önce 1 hafta boyunca 4 °C'de saklanabilir.

2. Koloni tipi hESC'lerin Tek Hücreli HESC Kültürüne Uyarlamı

  1. Bazal membran matrisi üzerinde yetişen koloni tipi H9 (WA09) hESC'lerin besleyicisiz kültürlerini geçişiçin, kuyulardan ortayı aspire etmek(Şekil 1A)9.
  2. 1 mL DPBS ile 1x yıkayın. Kuyu başına 1 mL dispase çözeltisi (1 U/mL) ekleyin ve 37 °C'de 20 dk kuluçkaya yatırın.
  3. Dispase'yi çıkarın, hücreleri 2 mL DMEM/F12 ile 1 x hafifçe yıkayın, ortamı çıkarın ve her tabağa 2 mL DMEM/F12 ekleyin.
  4. Kolonileri yavaşça yukarı ve aşağı borular oluşturarak ayırın ve 15 mL'lik bir tüpe aktarın.
  5. 370 x g 2 dakika pelet santrifüj ve orta aspire.
  6. Hücre peletlerini tek hücrelere ayırmak için 2 mL hücre dekolmanı çözeltisi (1x konsantrasyonu, bkz. Malzeme Tablosu)ekleyin ve 37 °C'de 10 dakika kuluçkaya yatırın.
  7. 370 x g 2 dakika için santrifüj hücreleri ve ayırma çözeltisi kaldırın.
  8. Taze mTeSR1 insan ESC ortamını ekleyin ve hücreleri yukarı ve aşağı hafif borular oluşturarak tek hücrelere ayırın.
  9. Koloni tipi hESC'leri tek hücreli tip kültüre uyarlamak için, 2 mTeSR1'de 2 mL'lik 10 μM ROCK inhibitörü içeren bodrum membran matris kaplı 6 kuyu plakasının her kuyusuna yaklaşık 1,5-2.0 x 106 hESC'yi plakalayın (Şekil 1A).
  10. 24 saat sonra, hESC ortamını ROCK inhibitörü olmadan taze mTeSR1 ile değiştirin ve hESC'lerin 3 gün boyunca tek hücreli tip olarak büyümesine izin verin. Orta yı günlük olarak değiştirin.
  11. 4. günde, kültürler yaklaşık %100 biraraya geldiğinde, ayırma çözeltisi hücreleri ayrıştırın, sonra adım 2.6'da açıklandığı gibi yeniden plakalanır.
    NOT: ROCK inhibitörü tek hücreli tip hESC kültürünün ilk 24 saat sırasında hücre sağkalımını artırır.

3. Embriyoid Cisim Oluşumu ve Üç Mikrop Tabakasına Farklılaşması (Şekil 2)

  1. EB'ler oluşturmak için, ilk 24 saat boyunca 10 μM ROCK inhibitörü ile mTeSR1 orta 3 mL hücreleri resuspend, daha sonra bir gecede 60 mm düşük ek yemekleri içine kuluçka 37 °C inkuvatör toplama izin vermek.
  2. 24 saat sonra küçük EB'ler 15 mL'lik bir tüpe aktarılır. EB'ler tüpün dibine yerleşin ve bir pipetle ortamı nazikçe çıkarın. EB'leri EB ortamına aktarın (nakavt-DMEM %20 nakavt serum replasmanı, 1x glutamin takviyesi [Bkz. Malzeme Tablosu], %1 NEAA [esansiyel olmayan amino asitler; bkz. Malzeme Tablosu], ve %0.2 β-mercaptoetanol) ve düşük ek tabaklarda 7 gün boyunca genişlemelerine izin verin. Ortam, yukarıda açıklandığı gibi her gün değiştirilebilir (Şekil 2A).
  3. 7. günde, eB'leri tabaklardan toplayın ve 15 mL'lik bir tüpe aktarın. Hafifçe bir pipet ile orta çıkarın ve bir bodrum membran matris kaplı 6 kuyu plaka eBs aktarın.
  4. EB'lerin tabağa bağlanmasına ve EB ortamda 12 gün kuluçkaya yatırmalarına izin verin ve bu süre zarfında üç mikrop tabakasına ayrılacaktır(Şekil 2B). Her gün orta değiştirin.
    NOT: Hücrelerin toplanması sırasında, düşük eki çanak EB eki önlemeye yardımcı olur.

4. Tek hücreli Tip hESC'lerin NPC'lere Farklılaşması (Şekil 3)

  1. NPC farklılaşmasını sağlamak için, tek hücreli tip hESC'leri 1 mL dekolmanı çözeltisi (1x) ile ayırın ve 37 °C'de 10 dakika kuluçkaya yatırın.
  2. 370 x g 2 dakika hücreleri santrifüj ve ayırma çözeltisi supernatant kaldırın. 1 mL DMEM/F12 ekleyin ve hücreleri nazik pipetleme ile yeniden askıya alın.
  3. 10 μM ROCK inhibitörü içeren mTeSR1 2 mL'de 2 x 105 hücre/kuyu yoğunlukta 6 kuyu plakalı bir taban membran matris kaplı plaka hücreleri.
  4. 24 saat sonra kültür ortamını 1 μM dorsomorfin ve 5 μM SB431542 ile takviye edilmiş nöral indüksiyon ortamını (DMEM %1 B27 eksi A vitamini ile) değiştirin.
  5. Nöral indüksiyonun ilk 4 günü boyunca her gün ortayı değiştirin, sonra 7. günde birleştiğizamana kadar her gün(Şekil 3B).
    NOT: (1) Dorsomorfin ALK2,3,6 reseptörlerini hedefleyerek BMP yolunu inhibe eder ve ampk'yi inhibe eder; SB431542, ALK5,7'yi hedefleyerek TGFβ/Activin yolunun bir inhibitörüdür. (2) Aynı protokol wa0916gibi benzer sonuçlar verdi başka bir ESC hattı (WA01) ile test edildi. (3) Biz genellikle bodrum membran matris için Matrigel kullandık; ancak, hücreler Geltrex üzerinde kültürlenebilir ve daha sonra birkaç NPC belirteçleri(Şekil 4D,E)ifadesi ile gösterildiği gibi çok benzer sonuçlar ile NPC'ler içine ayırt edilebilir. Geltrex'i Matrigel ile aynı şekilde ele alın (bölüm 1'e bakın).

5. NPC Genişleme ve Kriyopreservation

  1. 7 günlük nöral indüksiyondan sonra hücreleri 1 mL dekolmanı çözeltisi (1x) ile ayırın ve 37 °C'de 10 dakika kuluçkaya yatırın.
  2. 370 x g 2 dakika hücreleri santrifüj ve ayırma çözeltisi supernatant kaldırın. 1 mL NPC genişletme ortamı ekleyin (bkz. Malzemeler Tablosu)ve hücreleri nazik pipetleme ile yeniden askıya alın.
  3. Taban membran matris kaplı 6 kuyu plakası üzerinde 2 mL NPC genleşme ortamında plaka 1 x 105 hücre.
  4. Geçiş NP'leri, kültürlerin yaklaşık %90 biraraya gelmesiyle, gerektiğinde birden çok kez. İlk 3-4 pasajlar sırasında, hücre ölümünü önlemek için ilk 24 saat boyunca 10 μM ROCK inhibitörü ekleyin. Bu pasajlardan sonra hücreler ROCK inhibitörü olmadan geçiş ve kültürlenebilir. Genişletme sırasında ortamı her gün değiştirin.
  5. Kültürler birleştiğinde Kriyokoru NPT'leri.
    1. Kriyopreservation için, 37 °C'de 5 dakika için 1 mL dekolmanı çözeltisi (1x) hücreleri ayırmak, sonra ayırma çözeltisini kaldırmak için 2 dakika 370 x g santrifüj süspansiyon.
    2. 1 x 106 hücre/mL'de ayrıştırılatan NP'lere hücre dondurma çözeltisi (bkz.
    3. Cryovials dondurucu konteyner içine yerleştirin ve bir gecede saklayın -80 °C dondurucuda.
  6. Cryovials sıvı nitrojen saklayın.

6. Poli-L-ornitin (FKÖ) ve Laminin Kaplı Plakaların hazırlanması

  1. PLO/laminin kaplı plakalar hazırlamak için FKÖ stok çözeltisini PBS'ye veya suya 10 μg/mL'lik son konsantrasyona seyreltin. İyi bir şekilde karıştırın ve 1 mL seyreltilmiş PLO çözeltisi ile 6 kuyulu bir plakanın her kuyusunu kaplayın.
  2. 37 °C'de en az 2 saat veya 4 °C'de geceleme.
  3. Her biriyi PBS ile yıkayın.
  4. Lamina stok çözeltisi soğuk PBS veya su da seyreltin 10 μg/mL. Laminin çözeltisini iyice karıştırın. PBS'yi çıkarın ve her kuyuyu 1 mL laminin çözeltisi ile hemen kaplayın. Plakaları 4 °C'de tutun ve 1 hafta içinde kullanın. PBS ile yıkayın ve hemen kültür ortamı ekleyin.
    NOT: FKÖ/laminin kaplı plakaların kurumasına izin vermeyin.

7. HESC türetilmiş NP'lerin Dopaminerjik Nöronlara Farklılaşması (Şekil 6A)

  1. Yaklaşık %50 yoğunlukta NPC genişletme ortamında PLO/laminin kaplı tabaklarda plaka NPC'ler.
  2. 24 saat sonra ortayı DA1 ortamına (2 mM glutamin takviyesi, 1x NEAA, 1x B27, 200 ng/mL SHH ve 100 ng/mL FGF8 içeren nörobazal ortam) değiştirin ve her gün ortayı değiştirin.
  3. Biraraya geldiklerinde geçiş kültürleri. 1 mL dekolmanı çözeltisi (1x) ile hücreleri ayırın ve 37 °C'de 10 dakika kuluçkaya yatırın.
  4. 370 x g 2 dakika hücreleri santrifüj ve ayırma çözeltisi supernatant kaldırın. 1 mL DA1 orta ekleyin ve nazik pipetleme ile hücreleri yeniden askıya alın.
  5. Plo/laminin kaplı 6 kuyu plakasında 2 mL DA1 orta plaka1 x 105 hücre.
  6. 10 gün sonra, DA2 ortamına (2 mM glutamin takviyesi içeren nörobazal ortam, 1x NEAA, 1x B27, 200 μM askorbik asit, 20 ng/mL BDNF ve 20 ng/mL GNDF) değiştirin ve her gün 20 gün boyunca orta yı değiştirin(Şekil 6A).
    NOT: DA2 ortamına günlük taze askorbik asit ekleyin. İlk 14 gün içinde, farklılaşmış hücreler %90 biraraya geldiklerinde geçirilmelidir, ancak bundan sonra değil.

8. ESC kaynaklı NCD'lerin Astrositlere Farklılaşması

  1. Yaklaşık %50 yoğunlukta NPC genleşme ortamında Plo/laminin kaplı plakalarda plaka nöral progenitor hücreleri.
  2. 24 saat sonra ortayı astrosit ortamına (1:100 N2, 1:100 B27, 200 ng/mL IGF, 10 ng/mL activin A, 10 ng/mL heregulin β-1 ve 8 ng/mL bFGF dahil) değiştirin ve her gün ortayı değiştirin.
  3. Biraraya geldiklerinde geçiş kültürleri. 1 mL dekolmanı çözeltisi (1x) ile hücreleri ayırın ve 37 °C'de 10 dakika kuluçkaya yatırın.
  4. 370 x g 2 dakika hücreleri santrifüj ve ayırma çözeltisi supernatant kaldırın. Astrosit orta 1 mL ekleyin ve nazik pipetleme ile hücreleri yeniden askıya alın.
  5. Plo/laminin kaplı 6 kuyu da 2 mL astrosit ortamda plaka 1 x 105 hücre.
  6. Diferansiyasyonun toplam 5-6 hafta devam etmesine izin verin(Şekil 6B).

9. İmmünofluoresan Boyama

  1. Her hücre tipi için yukarıda açıklandığı gibi 35 mm μ-tabaklarda kültür hücreleri. Orta aspire ve çanak başına% 4 PFA çözeltisi 1 mL ekleyin ve RT 20 dakika kuluçka.
  2. PBS ile 5 dakika boyunca 2x yıkayın.
    NOT: Hücreler sabitlendikten sonra, ataşme plakaları parafilm ile kapatılabilir ve 4 °C'de saklanabilir. Fiksasyondan sonra 1 hafta içinde antikor ile leke.
  3. Çanak başına 300 μL bloklama çözeltisi (PBS'de keçi veya eşek serumu) ekleyin ve 30-60 dakika boyunca RT'de kuluçkaya yatırın.
  4. 5 dakika PBS ile çanak 2x yıkayın.
  5. 300 μL primer antikor(Tablo 1) çözeltisi (bloklama çözeltisinde seyreltilmiş) ekleyin ve RT'de 1,5 saat veya geceleme 4 °C'de inkübül.
  6. 10 dakika PBS ile 2x yıkayın.
  7. Bloklama çözeltisindeki 300 μL floresan konjuge sekonder antikor(Tablo 1)ekleyin ve RT'de 1 saat boyunca karanlıkta kuluçkaya yatırın.
  8. PBS ile 10 dakika boyunca hücreleri 2x yıkayın.
  9. Çekirdekleri lekelemek için Hoechst boyama çözeltisini (PBS'de 1 μM son konsantrasyon) ekleyin. RT 5 dakika boyunca karanlıkta hücreleri kuluçkaya yatırın.
  10. Hücreleri 5 dakika Boyunca PBS ile 1 kat yıkayın ve ardından 500 μL PBS ekleyin. Yemekleri karanlıkta tutun, sonra bir konfokal mikroskop ile floresan gözlemlemek (Şekil 2B, Şekil 5C, Şekil 6A, ve Şekil 7B).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Burada sunulan bakım ve hESC'lerin tek hücreli tip kültürünün genişletilmesi ve nöral progenitor hücrelere verimli farklılaşma için geliştirilmiş bir protokol, daha sonra çeşitli downstream nöral soylar halinde ayırt, dopaminerjik nöronlar ve astrositler de dahil olmak üzere.

Temsili faz kontrast görüntüleri, koloni tipi hESC'lerin tek hücreli tip kültüre uyarlaması sırasında hücre morfolojisini farklı basamaklarda göstermektedir(Şekil 1A). Tek hücreli kültür koşulu sayesinde, uyarlanmış hESC'lerin yüksek yoğunlukta korunabildiği, daha sonra birleştiğinde kolayca ve verimli bir şekilde alt kültüre alınabildiği bulunmuştur(Şekil 1A,B). Bu hücreler hücre döngüsü özelliklerini (yani, kısa bir G1 fazı ve S fazındaki hücrelerin yüksek oranı) koloni tipi hESC'lere özgü(Şekil 1C,D)korudular. Ayrıca, QRT-PCR ve immünboyama analiziile belirtildiği gibi koloni tipi hESC'lere benzer seviyelerde ESC belirteçlerini (şekil7, Tablo 2)ifade ettiler. Ayrıca, tek hücreli hESC'lerin her üç mikrop katmanından hücreler içeren embriyoid cisimler oluşturabildiği gösterilmiştir: endoderm (SOX17 ekspresyonu), mezoderm (SMA ekspresyonu) ve ektoderm (Tuj-1 ekspresyonu)(Şekil 2).

Daha sonra, tek hücreli tip hESC'lerin nöral progenitor hücrelere nöral progenitor hücrelere etkin bir şekilde bir NPC protokolü(Şekil 3A)kullanılarak farklılaştırDığı ve tipik hESC morfolojisinin kaybı ve NPC morfolojisinin görünümüile gösterildiği gösterilmiştir (Şekil 3B)16. NPC farklılaşması, imza NPC işaretçilerin (yani, SOX1, OTX2, ZIC1 ve OTX1; Şekil 5A, Tablo 2) ve immünboyama ve FACS analizi ile doğrulanın. Aynı analiz de hücrelerin % 90'ından fazlasının SOX1, PAX6 ve NCAM proteini(Şekil 5B,C)pozitif olduğunu göstermiştir. Tek hücreli hESC türetilmiş NDC'lerin çeşitli downstream nöral soylara farklılaşma yeteneğini incelemek için, bu hücrelerin dopaminerjik nöronlar ve astrositlere farklılaşması incelendi. Şekil 6A,B'degösterildiği gibi, tek hücreli hESC türetilmiş NDC'ler karakteristik morfolojilerin görünümü ve soya özgü dopaminerjik belirteçlerin (yani TH; Şekil 6A) ve astrosit belirteçleri (örneğin, GFAP ve S100B; Şekil 6B).

Figure 1
Şekil 1: Koloni tipi hESC'lerin tek hücreli tip kültürüne uyarlamı. (A) % 2'lik bazal membran matris kaplı tabaklarda kaplama dan sonra farklı zamanlarda H9 hESC'lerin tek hücreli kültürlerin temsili faz kontrast görüntüleri. Düşük (sol) ve yüksek (sağ) büyütme. Üst panel: koloni tipi hESC'lerin temsili görüntüsü. Diğer paneller, tek hücreli tip hESC'lere adaptasyon sırasında farklı zamanlarda kültürlerin temsili görüntülerini gösterir. Ölçek çubuğu = 200 μm. (B) H9 hESC'lerin büyüme eğrileri tek hücreli kültür durumu sırasında ilk 24 saat için 10 μM ROCK inhibitörü ile %2'lik bazal membran matris kaplı plakalarda izlendi. (C,D) Hücre döngüsü analizi koloni tipi (C) ve tek hücreli tip (D) H9 hESCs akış sitometrisi. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Figure 2
Şekil 2: Adapte edilmiş tek hücreli tip hESC'lerin üç mikrop katmanına in vitro farklılaşması. (A) Embriyonik cisimlerin (EB) temsili faz görüntüleri tek hücreli hESC'lerden türetilmiştir. Ölçek çubuğu = 100 μm. (B) Üç farklı mikrop tabakası belirteçlerinin ekspresyonu için analiz edilen farklılaştırılmış hESC'lerin immünfloresan görüntüleri: SOX17 (endoderm), SMA (mezoderm) ve Tuj-1 (ektoderm). Çekirdekler DAPI ile lekelendi. Ölçek çubuğu = 50 μm. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Figure 3
Şekil 3: Tek hücreli tip hESC'lerin nöral progenitor hücrelere doğrudan farklılaşma ile farklılaşması. (A) HESC'lerin nöral progenitor hücrelere (NPC) ayırım protokolü şeması. hESC'ler kaplamadan 1 gün sonra dorsomorfin (DMH) ve SB431542 (SB) ile tedavi edildi. (B) Nöral farklılaşma sırasında hücre morfolojisinin temsili faz kontrast görüntüleri. Ölçek çubuğu = 200 μm. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Figure 4
Şekil 4: farklı bazal membran matris ürünlerinde hESC kültürü. (A) Matrigel veya Geltrex üzerinde kültürlenen hESCs büyümek ve tek hücre kültürü benzer NPT'ler içine ayırt yeteneği sergiledi. Hücreler NESTIN antikoru ile lekelenmiş. Çekirdekler DAPI ile lekelendi. Ölçek çubuğu = 50 μm. (B) Matrigel veya Geltrex üzerinde yetiştirilen hESCs NESTIN yüzdesi ile belirtildiği gibi NPC'ler içine ayırt etmek için benzer bir potansiyel gösterdi- ve PAX6-pozitif hücrelerin yüzdesi. Hücreler NPC farklılaşmasının 7. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Figure 5
Şekil 5: NPC işaretçilerin ifadesi. (A) 7 günlük nöral farklılaşmadan sonra NPC marker genlerinin (yani OTX1, OTX2, SOX1 ve ZIC1) ekspresyonu QRT-PCR tarafından analiz edildi. Değerler GAPDH olarak normalleştirildi ve hESC'lerin değerlerine göre hesaplandı (p < 0.05). (B) SOX1-, NESTIN-, SOX2-, ve NCAM-pozitif hücrelerin yüzdesi NPC farklılaşmasının 7. (C) 7. gün NPC farklılaşmasında hücreler SOX1, NESTIN, NCAM, OTX2 ve PAX6 sinir belirteçlerine karşı antikorlarla boyandı. Çekirdekler DAPI ile lekelendi. Ölçek çubuğu = 100 μm. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Figure 6
Şekil 6: Tek hücreli tip hESC'lerden elde edilen NCD'lerin dopaminerjik nöron ve astrosit farklılaşması. (A) Dopaminerjik nöronların temsili faz kontrast görüntüsü (üst panel). Ölçek çubuğu = 100 μm. Diferansiye hücreler dopaminerjik nöron belirteci TH (tirozin hidroksilaz) karşı antikorlar ile boyandı. Çekirdekler DAPI ile lekelendi. Ölçek çubuğu = 50 μm. (B) Astrositlerin temsili faz kontrast görüntüsü (üst panel). Ölçek çubuğu = 100 μm. Diferansiye hücreler, belirtildiği gibi astrosit belirteç GFAP (glial fibrillary asidik protein) ve S100-B (S100 kalsiyum bağlayıcı protein B) karşı antikorlarla boyandı. Çekirdekler DAPI ile lekelendi. Ölçek çubuğu = 50 μm. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Figure 7
Şekil 7: Tek hücre tipi hESC'lerin karakterizasyonu. (A) tek hücreli tip kültüre uyarlanmış hESC'ler QRT-PCR tarafından ESC belirteçlerinin (yani, OCT4, NANOG ve SOX2) ekspresyonu için analiz edildi. Değerler GAPDH (p < 0.05) olarak normalleştirildi. (B) PLURIPotency belirteçlerinin ifade için boyanmış hESC'lerin immünofloresan görüntüleri OCT4, TRA-1-81 ve SSEA-1. Çekirdekler DAPI ile lekelendi. Ölçek çubuğu = 50 μm. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Primer Antikorlar Tür Seyreltme Katalog Numarası Şirket
EKIM4 Fare 1:1000 sc-5279 Santa Cruz
TRA 1-81 Fare 1:500 sc-21706 Santa Cruz
SSEA-1 Fare 1:500 sc-21702 Santa Cruz
SOX1 Keçi 1:500 AF-3369 Ar-Ge
SOX2 Tavşan 1:1,000 sc-20088 Santa Cruz
Sma Tavşan 1:500 ab-5694 Abcam
Tuj1 Fare 1:1000 T8578 Sigma
NESTIN Fare 1:1000 ab-22035 Abcam
OTX2 Fare 1:250 ab-21990 Abcam
hNCAM Fare 1:200 sc-106 Santa Cruz
hPAX6 Fare 1:250 561664 Bd
TH Fare 1:500 T1299 Sigma
S100b Fare 1:250 ab4066 Abcam
GFAP Tavşan 1:1,000 ab7260 Abcam
Sekonder Antikorlar
Fare karşıtı Keçi 1:1,000 AF 488 veya 647 Yaşam Teknolojileri
Anti-tavşan Keçi 1:1,000 AF 488 veya 647 Yaşam Teknolojileri

Tablo 1: İmmünositokimya ve FACS analizinde kullanılan antikorlar.

Astar adı Astar dizisi
EKIM4 F: GGAAGGTATTCAGCCAAACG
R: CTCCAGGTTGCCTCTACTC
NANOG F: GGTTCCAGAACCAGAGAATGA
R: ATTGGAAGGTTCCCAGTCG
SOX1 F: CCTTAGGTTTCCCCTCGCTTTT
R: CAGGCTGAATTCGGTTCTCATT
OTX1 F: AAGATCAACCTGCCGGAGTCT
R: CGTGAATTGGCCACTGCTTT
OTX2 F: TGGAAGCACTGTTTGCCAAG
R: TAAACCATACCTGCACCCTCG
ZIC1 F: AACCCCAAAAAGTCGTGCAAC
R: TCCTCCCAGAAGCAGATGTGA
GAPDH F: CCCATCACCATCTTCCAGGAG
R: CTTCTCCATGGTGGTGAAGACG

Tablo 2: QRT-PCR analizinde kullanılan astarların listesi.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

HSK'ların çeşitli soylara farklılaşması ve yeterli sayıda farklılaştırılmış hücre nin üretilmesi için ölçeklenebilir ve etkili yöntemler ilaç taraması ve kök hücre tedavisi için önemli kriterlerdir. Çeşitli tek hücreli geçiş yöntemleri, hangi hücrelerin ROCK inhibitörü veya diğer küçük moleküllerin varlığında hayatta kalmayı artırmak için kültürlü, ancak bu kültür yöntemlerinin son ürünleri koloni tipi hESCs17,18,19,20,21yayınlanmıştır. Daha önce yayınlanmış19,20,21,22gibi yöntemlere dayanan tek hücreli ESC protokolü, tek hücre tipi hESC kültürlerini başarıyla oluşturur ve korur ve koloni tipi hESC kültürünü önler. Yüksek yoğunluklu tek hücreli kaplama, çok hücreli ilişki, monolayer büyüme ve verimli alt kültür(Şekil 1)içerir. İkincisi hESCs tek hücreli tip kültürün ilk 24 saat sırasında ROCK inhibitörü eklenmesi ile elde edildi, hangi hücre sağkalım geliştirir17,18,19,20,21. Bu protokol daha kolay ölçeklenebilir ve ilaç tarama ve kök hücre terapötik uygulamalar için bu hücrelerin genişlemesine olanak sağlar.

Ayrıca, tek hücreli tip hESC'lerin, EB ve rozet oluşumu23,24,25gibi bir ara aşama kullanılmadan NPC siline(Şekil 3)verimli bir şekilde ayırt edilebildiği gösterilmiştir. AlK inhibitörleri, dorsomorfin ve SB43154215,16,26ile tedavi ile BMP/TGFβ/aktivin sinyal yollarının inhibisyonu ile tek hücreli tip hESC'lerden yüksek nöral dönüşüm sağlanmıştır. Bu protokol ile, uyarlanmış tek hücreli tip hESC'ler EB ve rozet oluşumuna(Şekil 5)gerek kalmadan NCD'lere etkin bir şekilde farklılaşabilir ve dopaminerjik nöronve astrositlere ayırt edilebilebilir (Şekil 6).

Özetle, HSK'ların tek hücreli tip kültürü, çeşitli soylara çok adımlı farklılaşmayı düzenleyen moleküler mekanizmaları incelemek için hızlı ve verimli bir sistem sağlar. Özellikle, bu protokol NCD'ler kullanılan ve ek nöral lineages içine sonraki farklılaşma açıklanan, astrositler ve dopaminerjik nöronlar gibi. Protokol, temel çalışmalar, ilaç taraması ve rejeneratif tıp uygulamaları için uygun olabilecek basit, sağlam ve ölçeklenebilir progenitor ve farklılaştırılmış hücrelerin üretimi için bir platform sağlar.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarlar çıkar çatışması beyan etmezler.

Acknowledgments

Dr. Carl D. Bortner'e (NIEHS) FACS analizine yaptığı yardımlar için teşekkür ederiz. Bu araştırma, Ulusal Çevre Sağlığı Bilimleri Enstitüsü, Ulusal Sağlık Enstitüleri, Z01-ES-101585 ve AMJ'nin Intramural Araştırma Programı tarafından desteklenmiştir.

Materials

Name Company Catalog Number Comments
35 mm m-dishes ibidi 81156 Cell culture dish
6-well plates Corning 3516
Accutase Innovative Cell Technologies AT104-500 Cell detachment solution
Activin A R&D system 338-AC-050
Ascorbic Acid Sigma Aldrich A4403
B27 supplement Thermo Fisher 17504044
B27 supplement (-Vit A) Thermo Fisher 12587010
BDNF Applied Biological Materials Z100065
bFGF Peprotech 100-18C
Centrifuge DAMON/ICE 428-6759
CO2 incubator Thermo Fisher 4110
Corning hESC-qulified Matrix (Magrigel) Corning 354277 Basement membrane matrix (used for most of the protocol here)
Cryostor CS 10 Stemcell Technologies 7930 Cell freezing solution
Dispase Stemcell Technologies 7923
DMEM Thermo Fisher 10569-010
DMEM/F12 Thermo Fisher 10565-018
Dorsomorphin Tocris 3093
EGF Peprotech AF-100-16A
Fetal Bovine Serum Fisher Scientific SH3007003HI
FGF8 Applied Biological Materials Z101705
GDNF Applied Biological Materials Z101057
Geltrex matrix Thermo Fisher A1569601 Basement membrane matrix
GlutaMax Thermo Fisher 35050061 Glutamine supplement, 100X
H9 (WA09) human embryonic stem cell line WiCell WA09
Heregulin b-1 Peprotech 100-3
IGF Peprotech 100-11
Knockout DMEM Thermo Fisher 10829018
Knockout Serum Replacement Thermo Fisher 10828028
Laminin Sigma Aldrich L2020
mTeSR1 Stemcell Technologies 85850 hESC culture medium
N2 supplement Thermo Fisher 17502001
NEAA Thermo Fisher 11140050
Neurobasal Thermo Fisher 21103049
Poly-L-ornithine Sigma Aldrich P3655
ROCK inhibitor Tocris 1254
SB431542 Tocris 1614
SHH Applied Biological Materials Z200617
Stemdiff Neural Progenitor medium Stemcell Technologies 5833 NPC expansion medium

DOWNLOAD MATERIALS LIST

References

  1. Thomson, J. A., et al. Embryonic stem cell lines derived from human blastocysts. Science. 282, (5391), 1145-1147 (1998).
  2. Rosler, E. S., et al. Long-term culture of human embryonic stem cells in feeder-free conditions. Developmental Dynamics. 229, (2), 259-274 (2004).
  3. Mallon, B. S., Park, K. Y., Chen, K. G., Hamilton, R. S., McKay, R. D. Toward xeno-free culture of human embryonic stem cells. The International Journal of Biochemistry & Cell Biology. 38, (7), 1063-1075 (2006).
  4. Hoffman, L. M., Carpenter, M. K. Characterization and culture of human embryonic stem cells. Nature Biotechnology. 23, (6), 699-708 (2005).
  5. Yan, Y., et al. Efficient and rapid derivation of primitive neural stem cells and generation of brain subtype neurons from human pluripotent stem cells. Stem Cells Translational Medicine. 2, (11), 862-870 (2013).
  6. Goncalves, J. T., Schafer, S. T., Gage, F. H. Adult Neurogenesis in the Hippocampus: From Stem Cells to Behavior. Cell. 167, (4), 897-914 (2016).
  7. Watanabe, K., et al. A ROCK inhibitor permits survival of dissociated human embryonic stem cells. Nature Biotechnology. 25, (6), 681-686 (2007).
  8. International Stem Cell Initiative. Characterization of human embryonic stem cell lines by the International Stem Cell Initiative. Nature Biotechnology. 25, (7), 803-816 (2007).
  9. Hartung, O., Huo, H., Daley, G. Q., Schlaeger, T. M. Clump passaging and expansion of human embryonic and induced pluripotent stem cells on mouse embryonic fibroblast feeder cells. Current Protocols in Stem Cell Biology. 14, (1), Chapter 1 Unit 1C 10 (2010).
  10. Chen, K. G., et al. Non-colony type monolayer culture of human embryonic stem cells. Stem Cell Research. 9, (3), 237-248 (2012).
  11. Chen, G., Hou, Z., Gulbranson, D. R., Thomson, J. A. Actin-myosin contractility is responsible for the reduced viability of dissociated human embryonic stem cells. Cell Stem Cell. 7, (2), 240-248 (2010).
  12. Li, X., Krawetz, R., Liu, S., Meng, G., Rancourt, D. E. ROCK inhibitor improves survival of cryopreserved serum/feeder-free single human embryonic stem cells. Human Reproduction. 24, (3), 580-589 (2009).
  13. Ohgushi, M., et al. Molecular pathway and cell state responsible for dissociation-induced apoptosis in human pluripotent stem cells. Cell Stem Cell. 7, (2), 225-239 (2010).
  14. Pakzad, M., et al. Presence of a ROCK inhibitor in extracellular matrix supports more undifferentiated growth of feeder-free human embryonic and induced pluripotent stem cells upon passaging. Stem Cell Reviews and Reports. 6, (1), 96-107 (2010).
  15. Chambers, S. M., et al. Highly efficient neural conversion of human ES and iPS cells by dual inhibition of SMAD signaling. Nature Biotechnology. 27, (3), 275-280 (2009).
  16. Jeon, K., et al. GLIS3 Transcriptionally Activates WNT Genes to Promote Differentiation of Human Embryonic Stem Cells into Posterior Neural Progenitors. Stem Cells. 37, (2), 202-215 (2019).
  17. Emre, N., et al. The ROCK inhibitor Y-27632 improves recovery of human embryonic stem cells after fluorescence-activated cell sorting with multiple cell surface markers. PLoS ONE. 5, (8), e12148 (2010).
  18. Hanna, J., et al. Human embryonic stem cells with biological and epigenetic characteristics similar to those of mouse ESCs. Proceedings of the National Academy of Sciences of the United States of America. 107, (20), 9222-9227 (2010).
  19. Saha, K., et al. Surface-engineered substrates for improved human pluripotent stem cell culture under fully defined conditions. Proceedings of the National Academy of Sciences of the United States of America. 108, (46), 18714-18719 (2011).
  20. Tsutsui, H., et al. An optimized small molecule inhibitor cocktail supports long-term maintenance of human embryonic stem cells. Nature Communications. 2, 167 (2011).
  21. Xu, Y., et al. Revealing a core signaling regulatory mechanism for pluripotent stem cell survival and self-renewal by small molecules. Proceedings of the National Academy of Sciences of the United States of America. 107, (18), 8129-8134 (2010).
  22. Ungrin, M. D., Joshi, C., Nica, A., Bauwens, C., Zandstra, P. W. Reproducible, ultra high-throughput formation of multicellular organization from single cell suspension-derived human embryonic stem cell aggregates. PLoS ONE. 3, (2), e1565 (2008).
  23. Kim, D. S., et al. Highly pure and expandable PSA-NCAM-positive neural precursors from human ESC and iPSC-derived neural rosettes. PLoS ONE. 7, (7), e39715 (2012).
  24. Sun, Y., Hu, J., Zhou, L., Pollard, S. M., Smith, A. Interplay between FGF2 and BMP controls the self-renewal, dormancy and differentiation of rat neural stem cells. Journal of Cell Science. 124, (Pt 11), 1867-1877 (2011).
  25. Zhou, J. M., Chu, J. X., Chen, X. J. An improved protocol that induces human embryonic stem cells to differentiate into neural cells in vitro. Cell Biology International. 32, (1), 80-85 (2008).
  26. Smith, J. R., et al. Inhibition of Activin/Nodal signaling promotes specification of human embryonic stem cells into neuroectoderm. Developmental Biology. 313, (1), 107-117 (2008).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics