इंट्रावाजिनल एचआईवी एक्सपोजर और एचआईवी संक्रमण के उपचार के लिए मानवीकृत NOG चूहों

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

हमने स्टेम सेल ट्रांसप्लांट, इंट्रोवर्जिनल ह्यूमन इम्यूनोडेफिशिएंसी वायरस एक्सपोजर और ड्रॉपलेट डिजिटल पीसीआर आरएनए के आधार पर एक मानवीय और मानव इम्यूनोडेफिशिएंसी वायरस संक्रमित एनओजी माउस मॉडल के उत्पादन और मूल्यांकन के लिए एक प्रोटोकॉल विकसित किया है । मात्राकरण।

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Andersen, A. H. F., Nielsen, S. S. F., Olesen, R., Mack, K., Dagnæs-Hansen, F., Uldbjerg, N., Østergaard, L., Søgaard, O. S., Denton, P. W., Tolstrup, M. Humanized NOG Mice for Intravaginal HIV Exposure and Treatment of HIV Infection. J. Vis. Exp. (155), e60723, doi:10.3791/60723 (2020).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

मानवीकृत चूहे मानव इम्यूनोडेफिशिएंसी वायरस (एचआईवी) वायरोलॉजी का अध्ययन करने और एंटीवायरल दवाओं का परीक्षण करने के लिए एक परिष्कृत मंच प्रदान करते हैं। यह प्रोटोकॉल वयस्क NOG चूहों में एक मानव प्रतिरक्षा प्रणाली की स्थापना का वर्णन करता है। यहां, हम गर्भनाल रक्त के अलगाव से सभी व्यावहारिक कदम ों की व्याख्या मानव CD34 + कोशिकाओं और चूहों में उनके बाद नसों प्रत्यारोपण, एचआईवी संक्रमण के माध्यम से मॉडल के हेरफेर के लिए, संयोजन एंटीरेट्रोवाइरल थेरेपी ( कला), और रक्त नमूना। लगभग 75,000 hCD34 + कोशिकाओं को चूहों में नसों में इंजेक्ट किया जाता है और मानव कल्पना के स्तर, जिसे मानवीकरण के रूप में भी जाना जाता है, परिधीय रक्त में प्रवाह साइटोमेट्री द्वारा महीनों के लिए देशीय रूप से अनुमान लगाया जाता है। कुल 75,000 hCD34+ कोशिकाओं परिधीय रक्त में 20%-50% मानव CD45 + कोशिकाओं की पैदावार। चूहों एचआईवी और रक्त के साथ intravaginal संक्रमण के लिए अतिसंवेदनशील होते है विश्लेषण के लिए एक बार साप्ताहिक नमूना किया जा सकता है, और दो बार विस्तारित अवधि के लिए मासिक । यह प्रोटोकॉल ड्रॉपलेट डिजिटल पीसीआर (डीडीपीसीआर) का उपयोग करके प्लाज्मा वायरल लोड की मात्रा के लिए एक परख का वर्णन करता है। हम दिखाते हैं कि चूहों को आहार में मानक-देखभाल कला आहार के साथ प्रभावी ढंग से कैसे इलाज किया जा सकता है। नियमित माउस चाउ के रूप में कैआरटी का वितरण प्रायोगिक मॉडल का एक महत्वपूर्ण शोधन है। इस मॉडल का उपयोग प्रणालीगत और सामयिक प्री-एक्सपोजर प्रोफिलैक्सिस यौगिकों के साथ-साथ उपन्यास उपचार और एचआईवी इलाज रणनीतियों के परीक्षण के लिए प्रीनैदानिक विश्लेषण के लिए किया जा सकता है।

Introduction

मानव इम्यूनोडेफिशिएंसी वायरस (एचआईवी)दुनियाभर में 37 मिलियन से अधिक संक्रमित व्यक्तियों के साथ एक पुराना संक्रमण है। कॉम्बिनेशन एंटीवायरल थेरेपी (cART) एक जीवन रक्षक चिकित्सा है, लेकिन एक इलाज अभी भी आवश्यक है । इस प्रकार, एचआईवी में निरंतर अनुसंधान को सुविधाजनक बनाने के लिए मानव प्रतिरक्षा प्रणाली और इसकी प्रतिक्रियाओं को प्रतिबिंबित करने वाले पशु मॉडलों की आवश्यकता है। मानव कोशिकाओं को गंभीर रूप से इम्यूनोडिफिजेंट चूहों2में प्रत्यारोपित करके कई प्रकार के मानवीकृत चूहों को विकसित किया गया है जो कोशिका ओं और ऊतकों के engraftment का समर्थन करने में सक्षम हैं। इस तरह के मानवीकृत चूहों एचआईवी संक्रमण के लिए अतिसंवेदनशील होते हैं और अमानवीय रहनुमा सिमियन इम्यूनोडेफिशिएंसी वायरस मॉडल के लिए एक महत्वपूर्ण विकल्प प्रदान करते हैं, क्योंकि वे गैर-मानव वानरों की तुलना में उपयोग करने के लिए सस्ता और सरल हैं। मानवीकृत चूहों ने एचआईवी वायरल ट्रांसमिशन, रोगजनन, रोकथाम औरउपचार3,4,5,6,7,8,9,10,11में अनुसंधान की सुविधा प्रदान की है।

हम एचआईवी अनुसंधान के लिए एक लचीला मानवीय मॉडल प्रणाली प्रस्तुत गर्भनाल रक्त संवित मानव स्टेम कोशिकाओं को संक्षेप में चूहों में प्रत्यारोपण द्वारा विकसित की है । सीजी-पीआरकेडीसीसिडआईएल2आरजीtm1Sug/JicTac(NOG) पृष्ठभूमि । गैर-भ्रूण मूल के होने के अलावा, रक्त-यकृत-थाइमस (बीबीटी) के निर्माण के प्रत्यारोपण में शामिल माइक्रोसर्जिकल प्रक्रियाओं की तुलना में इन चूहों की व्यावहारिक बायोइंजीनियरिंग तकनीकी रूप से कम मांग कर रही है।

हम दिखाते हैं कि इंट्रावेजिनल ट्रांसमिशन के माध्यम से एचआईवी संक्रमण को कैसे स्थापित किया जाए और संवेदनशील ड्रॉपलेट डिजिटल पीसीआर (डीडीपीसीआर) आधारित सेटअप के साथ प्लाज्मा वायरल लोड की निगरानी कैसे की जाए। बाद में, हम दैनिक माउस आहार के हिस्से के रूप में दिए गए मानक कला की स्थापना का वर्णन करते हैं। इन संयुक्त तरीकों का उद्देश्य जानवरों के लिए तनाव को कम करना और बड़े पैमाने पर प्रयोगों की सुविधा देना है जहां प्रत्येक जानवर को संभालने में समय सीमित12है ।

मनुष्यों में, एक सीसीआर532/wt या CCR532/32 जीनोटाइप ट्रांसमीटर/संस्थापक वायरस13के साथ एचआईवी संक्रमण के लिए संवेदनशीलता को कम करता है, और कुछ सावधानियां तब बरतनी चाहिए जब एचआईवी अध्ययन के उद्देश्य से स्टेम सेल के साथ बायोइंजीनियरिंग चूहों को मानवीय बनाया जाता है । यह हमारे क्षेत्र में विशेष रूप से सच है क्योंकि CCR5 जीन में स्वाभाविक रूप से होने वाले वेरिएंट, विशेष रूप से 32 विलोपन, स्कैंडिनेवियाई और बाल्टिक देशी आबादी में दुनिया के बाकी हिस्सों की तुलना में अधिक प्रचलित हैं14,15। इस प्रकार, हमारे प्रोटोकॉल में प्रत्यारोपण से पहले CCR5 वेरिएंट के लिए दाता हेमेटोपोइटिक स्टेम सेल की स्क्रीनिंग के लिए एक आसान, उच्च थ्रूपुट परख शामिल है।

इंट्रावजिनल एक्सपोजर के लिए हमने ट्रांसमीटर/संस्थापक R5 वायरस RHPA4259 को चुना, जो संक्रमण के प्रारंभिक चरण में एक महिला से अलग था जो संक्रमित संक्रमित16था । हमने चूहों को एक वायरल खुराक के लिए उजागर किया जो चूहों के बहुमत में सफल संचरण प्राप्त करने के लिए पर्याप्त था, लेकिन 100% पारेषण दर से नीचे। इस तरह की खुराक का चयन ट्रांसमिशन दर में पर्याप्त गतिशील रेंज को सक्षम बनाता है जैसे कि दवा उम्मीदवार के एंटीवायरल प्रभाव एचआईवी रोकथाम प्रयोगों में संरक्षित जानवरों में परिणाम दे सकते हैं और उपचार अध्ययन के लिए वायरल लोड में कमी आ सकती है।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

सभी गर्भनाल रक्त के नमूनों को स्थानीय रूप से अनुमोदित प्रोटोकॉल के अनुसार सख्त ी से प्राप्त किया गया था, जिसमें माता-पिता द्वारा गुमनाम दान की सूचित सहमति शामिल थी । सभी पशु प्रयोगों को मंजूरी दे दी और लाइसेंस 2017-15-0201-01312 के तहत डेनिश राष्ट्रीय नियमों के अनुसार सख्त अनुसार प्रदर्शन किया गया ।

सावधानी: अत्यधिक सावधानी के साथ एचआईवी उजागर चूहों और रक्त को संभालें। उन सभी सतहों और तरल पदार्थों को दूषित करें जो एचआईवी के संपर्क में रहे हैं, जो एक पुष्ट एचआईवी कीटाणुनाशक(सामग्री की तालिका) केसाथ हैं।

1. मानव CD34 + स्टेम सेल का अलगाव

  1. नियोजित सीजेरियन वर्गों या योनि जन्मों के बाद और स्थानीय नैतिक अनुमोदनों के अनुसार EDTA-लेपित रक्त संग्रह ट्यूबों में गर्भनाल रक्त नमूने एकत्र करें।
  2. निर्माता के प्रोटोकॉल के अनुसार घनत्व-ढाल जुदाई द्वारा गर्भनाल रक्त से पीएमबीसी को अलग करें।
  3. परिपक्व कोशिकाओं के लिए आम मार्कर के खिलाफ एंटीबॉडी के साथ पहले प्री-समृद्ध द्वारा PBMC आबादी से CD34 + कोशिकाओं को अलग करें, जो लाल रक्त कोशिकाओं के साथ अवांछित वंश की कोशिकाओं को क्रॉसलिंकिंग के लिए प्रेरित करता है। निर्माता के प्रोटोकॉल के अनुसार, चुंबकीय मोतियों का उपयोग करके इसके बाद CD34 + सेल संवर्धन होता है।
    1. ट्राइपैन ब्लू के 90 माइक्रोन में सेल निलंबन के 10 माइक्रोन को फिर से निलंबित करके मानक ट्राइपैन ब्लू बहिष्कार द्वारा लाइव सेल काउंट निर्धारित करें। निर्माता के प्रोटोकॉल के अनुसार, हेमैमेटोमीटर में इस समाधान के 10 माइक्रोन जोड़ें और गैर-नीली कोशिकाओं की गणना करें।
    2. माउस प्रत्यारोपण के दिन तक भ्रूण गोजातीय सीरम (एफबीएस) में 10% DMSO के 1 mL में viably क्रायोसंरक्षित CD34 + कोशिकाओं।
    3. सीडी 34 + स्टेम सेल शुद्धता (प्रत्येक नमूने की ~ 30,000 कोशिकाओं) का आकलन करने के लिए अलग-अलग (सीडी34 +) और प्रवाह-थ्रू कोशिकाओं (सीडी34-) दोनों के एक छोटे से अंश को अलग-अलग रूप से क्रायोरिकेप करें। वैकल्पिक रूप से, हौसले से समृद्ध कोशिकाओं पर शुद्धता का परीक्षण करें (नीचे चरण 2 देखें)।
    4. सीसीआर 5ए32 स्थिति के निर्धारण के लिए गैर-पेलेफ्लो-थ्रू (सीडी34-) का एक अंश फ्रीज करें। कोशिकाओं को वातानुकूलित ठंड समाधान के बिना सीधे जमे हुए किया जा सकता है, लेकिन गोली में लाल रक्त कोशिकाओं की उपस्थिति बाद की पीसीआर को बाधित कर सकती है यदि प्रवाह के माध्यम से गोली लगी है।

2. प्रवाह साइटोमेट्री के माध्यम से CD34 + स्टेम सेल शुद्धता का आकलन

  1. अलग कोशिकाओं (CD34 +) और प्रवाह के माध्यम से कोशिकाओं (CD34-) गल । कमरे के तापमान (आरटी) FACS बफर के 9 मिलील में प्रत्येक शीशी से कोशिकाओं को फिर से निलंबित करके कोशिकाओं को धोएं, जिसमें फॉस्फेट-बफर्ड लवण (पीबीएस) में 2% भ्रूण गोजातीय सीरम (एफबीएस) शामिल हैं।
  2. आरटी पर 300 x ग्राम पर 5 मिन के लिए अपकेंद्रित्र गोली कोशिकाओं के लिए।
  3. अधिनेता को बंद करें, शेष तरल में कोशिकाओं को फिर से निलंबित करें और FACS ट्यूबों में स्थानांतरित करें। FACS बफर के 3 mL के साथ धोने के कदम दोहराएं। दूसरे केंद्रीकरण के बाद, अधिनेत को बंद कर दें और शेष तरल में कोशिकाओं को फिर से निलंबित करें।
  4. एफसी रिसेप्टर ब्लॉकिंग समाधान(सामग्री की तालिका)के 5 μL जोड़ें और आरटी में 10 min के लिए छोड़ दें । एफसी रिसेप्टर अवरुद्ध समाधान को धोने से न धोएं।
  5. मानव सीडी 3 (क्लोन SK7) BUV395, CD34 (क्लोन AC136), FITC, और CD45 (क्लोन 2D1) एपीसी(तालिका 1)के खिलाफ एंटीबॉडी की पूर्व निर्धारित मात्रा वाले मिश्रण जोड़ें। अंधेरे में आरटी में 30 मिन के लिए कोशिकाओं को छोड़ दें । फ्लोरोफोरस को उन मापदंडों के आधार पर चुना जाना चाहिए जिनका आकलन मुआवजे के मैट्रिक्स की आवश्यकता के बिना उपलब्ध प्रवाह साइटोमीटर के साथ किया जा सकता है।
  6. कोशिकाओं को एफएसीएस बफर के 3 एल से धोएं।
  7. कोशिकाओं को गोली देने के लिए आरटी पर 300 x ग्राम पर 5 मिन के लिए सेंट्रलाइज।
  8. अधिनेता को बंद करें और शेष तरल में कोशिकाओं को फिर से निलंबित करें।
    1. सभी अनबाउंड एंटीबॉडी को हटा दिया गया है सुनिश्चित करने के लिए इस वाशिंग स्टेप 2x को दोहराएं।
  9. प्रवाह साइटोमीटर(सामग्री की तालिका)पर नमूनों को रिकॉर्ड करें और उपयुक्त सॉफ्टवेयर के साथ डेटा विश्लेषण करें। गेटिंग रणनीति चित्रा 1ए-एफमें प्रस्तुत की गई है ।

3. कॉर्ड ब्लड में सीसीआर532 वेरिएंट के लिए जेनेटिक स्क्रीनिंग

  1. गैर-पैलेट फ्लो-थ्रू का इनक्यूबेट 1.25 माइक्रोन इनक्यूबट इनक्यूबेटेड 1.25 माइक्रोन- पीसीआर मिक्स के 11.25 माइक्रोन के साथ डीएनटीपी मिक्स का 200 माइक्रोन, 0.01 यू/माइक्रोन हाई फिडेलिटी डीएनए पॉलीमरेज, और टेबल 2में विस्तृत फॉरवर्ड और रिवर्स प्राइमर।
    1. प्रत्येक पीसीआर प्रतिक्रिया के लिए न्यूकलीज-मुक्त पानी के साथ मात्रा को लगभग 12.5 माइक्रोन में समायोजित करें।
  2. टेबल 3में विस्तृत पीसीआर साइकिलिंग कार्यक्रम के साथ जीनोमिक टुकड़ों को बढ़ाना ।
  3. पीसीआर उत्पादों को 2% अगारोज जेल13पर अलग करें।
    1. जंगली प्रकार के एलल्स और 32 एलील्स से पीसीआर उत्पाद क्रमशः 196 बेस जोड़े और 164 बेस जोड़े बैंड के पीसीआर टुकड़े उत्पन्न करते हैं, जिससे वे जेल इलेक्ट्रोफोरिस13 (चित्रा 1जी)द्वारा आसानी से अलग हो जाते हैं।

4. नसों में स्टेम सेल प्रत्यारोपण

नोट: एक व्यक्ति होने प्रयोगशाला में कोशिकाओं को तैयार करने और एक और व्यक्ति चूहों और प्रत्यारोपण के लिए कार्यक्षेत्र तैयार एक कुशल दृष्टिकोण है ।

  1. पशु सुविधा में, स्टेम सेल के नियोजित प्रत्यारोपण से पहले 4-6 घंटे, 6-7 सप्ताह पुरानी महिला NOD किरणित । सीजी-पीआरकेडीसीसिड आईएल2आरजीtm1Sug/JicTac(NOG) चूहों(सामग्री की मेज)एक सीएस१३७ स्रोत के साथ ०.७५ Gy के साथ । सबसे अच्छी प्रीकंडीशनिंग खुराक माउस उम्र, विकिरण के स्रोत और अन्य कारकों के आधार पर भिन्न हो सकती है। यह प्रक्रिया मानव स्टेम कोशिकाओं के साथ सफल एनग्राफमेंट के लिए जानवरों की स्थिति है।
  2. एक पशु सुविधा में, चूहों या कोशिकाओं को कार्यक्षेत्र में लाने से पहले प्रवाह पीठ कार्यक्षेत्र और सभी अभिकर्मकों को तैयार करें।
    1. प्रवाह पीठ की काम करने वाली सतह को कवर करने के लिए एक बाँझ नीला पैड रखें। बाँझ धुंध और एक शार्प्स कंटेनर तैयार करें।
    2. गर्मी के नीचे एक खाली बाँझ माउस पिंजरे के साथ प्रवाह बेंच में 70% इथेनॉल से कीटाणुरहित एक हीटिंग लैंप रखें।
  3. प्रयोगशाला में, अलग सीडी 34 + कोशिकाओं गल और उन्हें 37 डिग्री सेल्सियस सादे RPMI के 9 मिलील में पतला।
  4. आरटी में 5 मिन के लिए 350 x ग्राम पर कोशिकाओं को केंद्रित करें, आकांक्षा द्वारा अधिनायक को त्यागें, और 37 डिग्री सेल्सियस पर सादे आरपीएमआई के 1 एमआईएल में गोली को फिर से निलंबित करें।
  5. ट्राइपैन ब्लू अपवर्जन द्वारा सेल गिनती निर्धारित करें, और प्रति माउस 200 माइक्रोन करने के लिए मात्रा समायोजित करें। बाद में हैंडलिंग चरणों के कारण संभावित नुकसान को ध्यान में रखने के लिए अतिरिक्त बनाएं।
    1. प्रत्येक माउस में प्रति 200 माइक्रोन 75,000 सीडी34 + कोशिकाओं को प्रत्यारोपित करने के लिए तैयार करें।
    2. ट्रांसप्लांट से पहले पशु सुविधा तक परिवहन के दौरान कोशिकाओं को 4 डिग्री सेल्सियस रखा जा सकता है। एकत्रीकरण या झुरमुट को कम करने के लिए बर्फ पर कोशिकाओं को रखने से बचें।
  6. पशु सुविधा में, चूहों के साथ पिंजरे को प्रवाह पीठ में लाएं और चूहों को रक्त वाहिकाओं को फैलाने के लिए हीटिंग लैंप के नीचे पिंजरे में स्थानांतरित करें। पिंजरे के एक छोर को गर्मी के स्रोत से दूर छोड़ दें ताकि चूहे गर्म होने पर गर्मी से दूर जा सकें। चूहों कि पिंजरे के अंत में चले गए हैं, गर्मी स्रोत से दूर, एक सफल पूंछ नस इंजेक्शन के लिए पर्याप्त रूप से गर्म कर रहे हैं ।
  7. निलंबित सीडी 34 + कोशिकाओं के साथ 800 माइक्रोन मार्क से ऊपर 1 मिलीग्राम चिकनाई सिरिंज लोड करें। एक चिकनाई 1 mL सिरिंज का उपयोग नाटकीय रूप से नसों में इंजेक्शन कम और इस तकनीक की परिशुद्धता में वृद्धि होगी।
  8. एक 30 जी 13 मिमी सुई संलग्न करें और इंजेक्शन के लिए सुई और सिरिंज तैयार करें। ऑपरेशन का यह आदेश सिरिंज को जल्दी लोड करने की अनुमति देता है, जबकि कोशिकाओं की अखंडता की रक्षा करने के लिए संभावित क्षति है कि इस तरह के एक छोटे गेज सुई के माध्यम से कोशिकाओं की तेजी से आकांक्षा के दौरान हो सकता है दिया प्रत्यारोपित किया जाएगा । प्लंजर दबाकर सुई हब को तरल से भरें और सुई के 200 माइक्रोन मार्क तक तरल को हटा दें।
  9. चतुर्थ इंजेक्शन देने के लिए उपयोग किए जाने वाले निरोधक में एक गर्म माउस (चरण 4.6) रखें। माउस की पूंछ की नस में सेल निलंबन के 200 माइक्रोन को ध्यान से इंजेक्ट करें। 2 एस डुबकी प्रदर्शन खर्च करते हैं और इंजेक्शन के पूरा होने के बाद लगभग 2 एस के लिए डाली गई सुई रखें। यह सुनिश्चित करता है कि कोशिकाओं को सुई को हटाने से पहले इंजेक्शन साइट से पर्याप्त रूप से दूर चले गए हैं ।
  10. आवश्यक के रूप में, किसी भी दिखाई रक्त को दूर करने के लिए बाँझ धुंध के साथ माउस पूंछ पोंछ। माउस को वापस अपने गैर गर्म घर पिंजरे में रखो। शेष चूहों के साथ इंजेक्शन प्रक्रिया दोहराएं।

5. विश्लेषण के लिए रक्त संग्रह और प्रसंस्करण

नोट: परिधीय रक्त में मानव कोशिका engraftment मानव स्टेम सेल प्रत्यारोपण के बाद प्रवाह साइटोमेट्री 3-5 महीने के माध्यम से मूल्यांकन किया जा सकता है ।

  1. स्थानीय आईएसएसी-अनुमोदित तकनीकों का उपयोग करके चूहों से रक्त के नमूने ड्रा करें।
  2. रक्त के जमाव से बचने के लिए 0.5 मीटर ईटीए (पीएच = 8.0) के 10 माइक्रोनयुक्त बाँझ पीसीआर माइक्रोसेंट्रोफ्यूज ट्यूबों में कुल रक्त का अधिकतम 70-100 माइक्रोनल एकत्र करें।

6. प्रवाह साइटोमेट्री के माध्यम से मानव engraftment का मूल्यांकन

  1. 40-50 माइक्रोन रक्त को एफएसीएस ट्यूबों में स्थानांतरित करें।
  2. एंटीबॉडी के गैर विशिष्ट बाध्यकारी को रोकने के लिए एफसी रिसेप्टर ब्लॉकिंग समाधान के 5 μL जोड़ें और आरटी में 10 min के लिए छोड़ दें ।
  3. सीडी 4 (क्लोन SK3) बीयूवी 496, सीडी 8 (क्लोन आरपीए-टी8) BV421 युक्त माउस एंटी-ह्यूमन एंटीबॉडी मिश्रण जोड़ें, सीडी 3 (क्लोन ओकेटी3) एफईसी, सीडी19 (क्लोन sj25c1) पीई-Cy7, CD45 (क्लोन 2D1) एपीसी(टेबल 4)और 30 मिन के लिए आरटी में अंधेरे में दाग करने के लिए छोड़ दें । फ्लोरोफोरस को उन मापदंडों के आधार पर चुना जाना चाहिए जिनका आकलन मुआवजे के मैट्रिक्स की आवश्यकता के बिना उपलब्ध प्रवाह साइटोमीटर के साथ किया जा सकता है ।
  4. लाल रक्त कोशिकाओं को जीवंत करने के लिए प्रत्येक ट्यूब में एक उपयुक्त लाल रक्त कोशिका लिजिंग बफर का 2 एमएल जोड़ें। लाल रक्त कोशिका लिसिस से पहले एंटीबॉडी धुंधला के लिए विशेष रूप से तैयार किए गए लिसिस बफर का उपयोग करें (सामग्री की तालिकामें एक उपयुक्त उदाहरण दिया गया है)। भंवर संक्षेप में lysing समाधान में कोशिकाओं के समान वितरण सुनिश्चित करने के लिए और आरटी में 10 min के लिए छोड़ दें । कोशिकाओं का समान वितरण महत्वपूर्ण है ।
  5. lysis प्रतिक्रिया को रोकने के लिए FACS बफर के 2 mL जोड़ें।
  6. कोशिकाओं को गोली देने के लिए आरटी पर 300 x ग्राम पर 5 मिन के लिए सेंट्रलाइज।
  7. जब तक कोशिकाओं को फिर से निलंबित न किया जाए तब तक सुपरनेटेंट और भंवर धीरे से बंद करें।
  8. आरटी में 300 x ग्राम पर 5 मिन के लिए एफएसीएस बफर और सेंट्रलाइज के 3 एमसीएल जोड़ें।
  9. अधिनेता को बंद करें और कोशिकाओं को फिर से निलंबित करें।
  10. नमूनों को उपयुक्त प्रवाह साइटोमीटर पर रिकॉर्ड करें और उपयुक्त सॉफ्टवेयर(सामग्री की तालिका)का उपयोग करके विश्लेषण करें। प्रतिनिधि विश्लेषण और परिणाम चित्रा 2 और चित्रा 3में चित्रित कर रहे हैं ।

7. इंट्रावाजिनल एचआईवी एक्सपोजर

नोट: चूहों के इंट्रावाजिनल एक्सपोजर के लिए इस्तेमाल किए जाने वाले वायरस को पहले प्रकाशित प्रोटोकॉल17का उपयोग करके उत्पादित किया जा सकता है । वायरस को -80 डिग्री सेल्सियस पर रखा जाता है और स्थानीय रूप से अनुमोदित प्रोटोकॉल के बाद सूखी बर्फ पर संग्रहीत करते हुए स्थानों के बीच ले जाया जाता है। वायरस चूहों के संपर्क से तुरंत पहले तक सूखी बर्फ पर संग्रहीत किया जाता है। वायरस को सादे आरपीएमआई में पतला किया जा सकता है (आरपीएमआई से बचें जिसमें एंटीबायोटिक्स या सीरम योजक हैं) एक्सपोजर से तुरंत पहले उचित एकाग्रता प्राप्त करने के लिए (इस IVAG एक्सपोजर के लिए 21,400 आईयू का उपयोग किया गया था)। एक बार उत्पन्न होने के बाद, फ्रीज-गल चक्र ों से बचने के लिए प्रक्रिया में गीली बर्फ पर पतला स्टॉक रखें जो तब हो जाएगा जब पतला वायरस एक बार गल जाने के बाद सूखी बर्फ पर वापस रखा गया था।

  1. चूहों या वायरस को प्रवाह पीठ (चरण 4.2) में लाने से पहले चित्रा 4 में प्रस्तुत सभी उपकरण और प्रवाह बेंच कार्यक्षेत्र तैयार करें।
    1. हीटिंग लैंप फोकस को कार्यक्षेत्र के केंद्र में रखें जहां माउस एचआईवी एक्सपोजर प्रक्रिया के दौरान स्थित होगा। हीटिंग लैंप चूहों के शरीर के तापमान में कोई कमी सुनिश्चित करेगा। तापमान को नियंत्रित करने वाले अन्य उपकरणों का भी उपयोग किया जा सकता है, (उदाहरण के लिए स्थानीय आईएसयूसी नियमों18के अनुसार, एक गर्म जेल पैड या एक परिसंचारी गर्म पानी कंबल)।
    2. बाँझ 20 μL पिपेट युक्तियां और बेंच में एक उपयुक्त पिपेट लाओ । वायरस के संपर्क में आने वाली सामग्रियों और तरल पदार्थों को तत्काल निष्क्रिय करने के लिए बेंच में तरल कीटाणुनाशक(सामग्री की तालिका)के साथ एक कंटेनर रखें।
  2. माउस को 3% आइसोफ्लोरीन गैस और पेपर तौलिए के साथ एक कक्ष में रखें। गैस का यह प्रतिशत 2-4 मिनट के भीतर जानवरों को एनेस्थेटाइज करेगा। इम्यूनोडिफिएंट चूहों के साथ उपयोग की जाने वाली अन्य सभी सामग्रियों के साथ, संज्ञाहरण तंत्र का उपयोग करने से पहले ठीक से कीटाणुरहित होना चाहिए।
  3. एक बार एनेस्थेटाइज्ड होने के बाद माउस को हीटिंग लैंप के नीचे बाँझ नीले पैड पर ट्रांसफर करें। संज्ञाहरण को बनाए रखने के लिए निरंतर 3% आइसोफ्लोरीन गैस की आपूर्ति करने वाले मास्क में माउस स्नाउट डालें। पूंछ के आधार पर माउस पकड़ो, पेट का सामना करना पड़ रहा है, अपने हाथ के साथ माउस वापस समर्थन के रूप में चित्रित 4में चित्रित किया ।
  4. एक बाँझ पिपेट टिप के साथ, गुदा की ओर धीरे से ऊपर की ओर पथपाकर द्वारा जननांग क्षेत्र को उत्तेजित करने के लिए मलाशय के खाली प्रेरित, योनि पर दबाव से राहत ।
  5. ध्यान से अपनी उंगलियों के पार माउस पूंछ लपेटकर योनि खोलने नंगे इस तरह है कि योनी स्वाभाविक रूप से खुलता है, शायद मामूली नज के साथ एक बाँझ पिपेट टिप का उपयोग कर ।
  6. बुलबुले पैदा किए बिना माउस योनि में वायरस के पिपेट टिप और पिपेट 20 माइक्रोन को बदलें। योनि में गहरी नोक न डालें। बल्कि, योनी के साथ खोला, योनि खोलने के स्तर पर पिपेट टिप जगह, टीका प्रक्रिया के दौरान घर्षण के लिए क्षमता को खत्म करने के लिए गहरी जाने से बचें, वायरस जारी है, और गुरुत्वाकर्षण योनि में वायरस खींचने के लिए अनुमति देते हैं । वैकल्पिक रूप से, वेसेलिनोविच एट अल6में वर्णित 22 जी 1.25 मिमी कुंद-अंत, सीधी सुई का उपयोग करें।
  7. वायरस निलंबन के गुरुत्वाकर्षण प्रेरित रिसाव से बचने के लिए जोखिम के बाद 5 मिन के लिए सामना करना पड़ योनि के साथ इस स्थिति में माउस बनाए रखें ।
    1. माउस को घर के पिंजरे में सावधानी से रखें, माउस को अपनी पीठ पर रखने का ख्याल रखें।

8. वायरल लोड विश्लेषण से पहले रक्त के नमूनों की प्रसंस्करण

  1. ऊपर धारा 5 में वर्णित रक्त एकत्र करें।
  2. प्लाज्मा और कोशिकाओं को अलग करने के लिए आरटी में 500 x ग्राम पर 500 x ग्राम पर 5 00 x के लिए रक्त के नमूनों को केंद्रित करें।
  3. वायरल लोड मापन के लिए प्लाज्मा के 40 μL को एक नई बाँझ पीसीआर-अनुमोदित माइक्रोसेंटरिफ्यूज ट्यूब में एकत्र करें और अगले प्रसंस्करण तक कम से कम 1 घंटे के लिए -80 डिग्री सेल्सियस पर स्टोर करें। आरएनए निष्कर्षण से पहले सभी नमूनों को फ्रीज करना महत्वपूर्ण है ताकि आरएनए अलगाव से पहले जमे हुए नमूनों में आरएनए अलगाव से पहले जमे हुए नमूनों में आरएनए के स्तर की तुलना करने से पूर्वाग्रह के जोखिम से बचा जा सके।
  4. निलंबन मीडिया के ४० μL (२.५% गोजातीय सीरम एल्बुमिन, ५० U/mL पेनिसिलिन जी और स्ट्रेप्टोमाइसिन के साथ पीबीएस, और 10 U/mL DNase, बाँझ-०.२२ माइक्रोन पर फ़िल्टर) के साथ मूल मात्रा में वापस रक्त की मात्रा समायोजित करें ।
  5. समायोजित रक्त की मात्रा के 15 μL को एक नई पीसीआर-अनुमोदित माइक्रोसेंट्रोफ्यूज ट्यूब में स्थानांतरित करें।
  6. आरटी में 10 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 000 000 000 000 000 0000 000000000000000000000000000000000000000000000
  7. 1 मिन के लिए 9,600 x ग्राम पर आरटी पर गोली कोशिकाओं के लिए केंद्र।
  8. Aspirate supernatant और केवल छोटे सफेद सेल गोली छोड़ दें, क्योंकि लाल रक्त कोशिका संदूषण पीसीआर को बाधित कर सकते हैं ।
  9. अगले प्रसंस्करण तक कम से कम 1 घंटे के लिए -80 डिग्री सेल्सियस पर गोली स्टोर करें।
    नोट: वैकल्पिक रूप से, चरण 8.4 से किसी भी शेष रक्त का उपयोग प्रवाह साइटोमेट्री विश्लेषण के लिए किया जा सकता है, जैसा कि चरण 6 में ऊपर वर्णित है।

9. प्रोटीन के निष्कर्षण विधि का उपयोग करडीएनए निष्कर्षण

  1. परिधीय कोशिका छर्रों (चरण 8.8 में उत्पन्न) से डीएनए निकालें एक प्रोटीन के निष्कर्षण विधि का उपयोग करके नीचे वर्णित है। इस विधि को रक्त की एक छोटी मात्रा से उच्चतम डीएनए उपज निकालने के लिए प्रदर्शित किया गया है जैसे कि इस अध्ययन19में उपयोग किए जाने वाले धारावाहिक रक्त संग्रह के लिए आवश्यक है ।
  2. 0.1 M Tris बफर के 1 mL में प्रोटीनके 25 μL (20 μg/mL) जोड़ें ।
  3. भंवर प्रोटीन के समाधान संक्षेप में।
  4. पचाने के लिए प्रत्येक सेल पैलेट में प्रोटीनके समाधान के 50 माइक्रोन जोड़ें।
  5. ऊपर और नीचे पाइपिंग द्वारा मिश्रण और सेल गोली के पुनर्निलंबन की पुष्टि करें।
  6. यदि आवश्यक हो तो 1 एच टेप ट्यूबों को जगह में रखने के लिए 56 डिग्री सेल्सियस पर 400 आरपीएम (उपकरण के आधार पर) पर थर्मोशेमर(सामग्री की तालिका)पर हिलाएं।
  7. तुरंत और उसी थर्मोशेखर में, तापमान 95 डिग्री सेल्सियस तक स्थानांतरित होने के साथ प्रोटीन के को निष्क्रिय करें जबकि झटकों में अतिरिक्त 20 न्यूनतम के लिए जारी है।
  8. भंवर प्रत्येक नमूना।
  9. प्रत्येक नमूने को न्यूनतम 30 न्यूनतम के लिए -80 डिग्री सेल्सियस पर रखें।
  10. गल, तो 17,000 x ग्राम पर 17,000 x ग्राम पर आरटी पर 1 मिन के लिए अवांछित सेलुलर टुकड़े गोली के लिए नमूने अपकेंद्रित्र।
  11. डीएनए युक्त सुपरनेटेंट को एक नई माइक्रोसेन्ट्राइज ट्यूब में रखें।
  12. पीसीआर के लिए डीएनए टेम्पलेट तैयार है। डीएनए टेम्पलेट्स को -80 डिग्री सेल्सियस पर स्टोर किया जा सकता है।

10. आरएनए निष्कर्षण, सीडीएनए संश्लेषण, और वायरल आरएनए की डीडीपीसीआर मात्रा

  1. निर्माता के प्रोटोकॉल(सामग्री की तालिका)के बाद वायरस आरएनए आइसोलेशन किट के साथ गल माउस प्लाज्मा से आरएनए को अलग करें।
  2. कॉलम में नमूने को जोड़ने के बाद, प्लाज्मा नमूने में सभी डीएनए को हटाने सुनिश्चित करने के लिए एक ऑन-कॉलम DNase उपचार कदम जोड़ें।
    1. प्रत्येक नमूने के लिए, कॉलम में RNase-मुक्त DNase समाधान (मिक्स 2 μL RNAse-मुक्त DNase और 98 μL प्रतिक्रिया बफर) के 95 माइक्रोन जोड़ें और आरटी में 15 मिन के लिए इनक्यूबेट करें।
  3. आरएनए के नमूनों को आगे की प्रक्रिया से पहले कम से कम 1 घंटे के लिए -80 डिग्री सेल्सियस पर स्टोर करें। आरएनए निष्कर्षण के बाद सभी नमूनों को फ्रीज करना महत्वपूर्ण है, जब उन नमूनों की तुलना करते समय पूर्वाग्रह के जोखिम से बचें जो जमे हुए नमूनों से जमे हुए नहीं हैं।
  4. पहले20वर्णित अभिकर्मकों का उपयोग करके रिवर्स ट्रांसक्रिप्टेज़ चरण का उपयोग करके सीडीएनए का संश्लेषण करें। आरएनए के क्षरण से बचने के लिए सीडीएनए प्रतिक्रिया में आरएनएसई अवरोधक के 0.5 माइक्रोन जोड़ना सुनिश्चित करें।
    1. तालिका 5में विस्तृत कार्यक्रम के साथ सीडीएनए संश्लेषण करें।
  5. सीडीएनए के नमूनों को कम से कम 1 घंटे के लिए -80 डिग्री सेल्सियस पर स्टोर करें। यह सीडीएनए संश्लेषण के बाद सभी नमूनों फ्रीज करने के लिए महत्वपूर्ण है पूर्वाग्रह के जोखिम से बचने के लिए जब नमूनों कि जमे हुए थे करने के लिए जमे हुए नहीं किया गया है की तुलना ।
  6. 20के बाद डीडीपीसीआर के लिए नमूने तैयार करें -
    1. डीपीसीआर जांच मिश्रण (कोई dUTP)20, 250एनएम माइनर ग्रूम-बाध्यकारी जांच के 11 माइक्रोन के साथ सीडीएनए नमूने के 3 माइक्रोन मिलाएं, और तालिका 6में विस्तृत रूप से प्रत्येक फॉरवर्ड और रिवर्स प्राइमर के 900 एनएम।
    2. कुल पीसीआर वॉल्यूम को न्यूलीज-फ्री पानी के साथ 22 माइक्रोन में एडजस्ट करें।
  7. निर्माता के प्रोटोकॉल और पिछले विवरण20के अनुसार एक बूंद जनरेटर पर जांच के लिए बूंद पीढ़ी के तेल के साथ पीसीआर घोला जा सकता है ।
  8. टेबल 7में विस्तृत रूप में पीसीआर कार्यक्रम चलाएं ।
    नोट: यहां प्रदर्शित प्राइमर/प्रोब दृश्यों और पीसीआर कार्यक्रमों को विशेष रूप से एचआईवी तनाव RHPA4259 के संवेदनशील पता लगाने के लिए डिजाइन और अनुकूलित किया गया है । प्राइमर और प्रोब दृश्यों को आसानी से पसंद के किसी भी अन्य एचआईवी तनाव का पता लगाने के लिए समायोजित किया जा सकता है।
  9. एक बूंद पाठक पर नमूनों से बूंद फ्लोरेसेंस का पता लगाएं, और निर्माता के प्रोटोकॉल के अनुसार उपयुक्त सॉफ्टवेयर के साथ परिणामों का विश्लेषण करें।

11. cART युक्त चाउ के साथ उपचार

  1. चूहों को एक मानक कला आहार युक्त छर्रों के साथ खिलाएं जिसमें ४,८०० मिलीग्राम/किलो राल्टेग्राविर (आरएएल), ७२० मिलीग्राम/किलो टेनोफोविर डिसोप्रोक्सिल फ्यूमैरेट (टीडीएफ), और ५२० मिलीग्राम/किलो एट्रिसिटाबिन (एफटीसी)21 (टेबल 8)होते हैं । इन खुराकों को यह मानते हुए निर्धारित किया गया था कि एक माउस का वजन 25 ग्राम है और प्रति दिन चाउ के 4 ग्राम खाता है। यह ७६८ मिलीग्राम/किलो आरएएल, २.८८ मिलीग्राम/किलोटीडी डीडीएफ और ८३ मिलीग्राम/किलोग्राम एफटीसी21की दैनिक खुराक से मेल खाती है ।
  2. एक cART आहार है कि पर्चे दवाओं के एक बाहरी विक्रेता (सामग्री की तालिकादेखें) द्वारा तैयार किया गया है का प्रयोग करें । अन्य कंपनियां संभवतः भी इस आहार का उत्पादन कर सकती हैं । साधारण माउस चाउ से आसानी से अलग करने के लिए लाल रंग का एक कला आहार का उपयोग करें।
    1. आसान अंतर के लिए एक मानक भूरे रंग में cART के बिना एक नियंत्रण चाउ आहार का उत्पादन।
  3. CART की शुरुआत के लिए, cART युक्त चाउ आहार के अलावा के साथ बाँझ माउस पिंजरों तैयार है, और फिर पुराने पिंजरे से चूहों नए पिंजरे में स्थानांतरित ।
    1. चूहों के वजन और दृश्य निरीक्षण द्वारा cART युक्त चाउ की खपत की निगरानी सुनिश्चित करने के लिए कि चूहों परिवर्तन के लिए समायोजित कर रहे हैं ।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

स्टेम सेल शुद्धता के विश्लेषण के लिए गेटिंग रणनीति को चित्रा 1में दर्शाया गया है । चित्रा 1ए-सी शुद्ध CD34 + जनसंख्या और चित्रा 1डी-एफ CD34-प्रवाह के माध्यम से यह स्पष्ट करने के लिए उपयोग किया जाता है कि CD34 + जनसंख्या की न्यूनतम मात्रा अलगाव प्रक्रिया में खो जाती है। अलग सीडी 34 + स्टेम सेल की शुद्धता 1% से कम टी-सेल संदूषण के साथ 85%-95% के बीच थी। चित्रा 1जी CCR5A32/wt जीनोटाइप के साथ एक वयस्क मानव नियंत्रण दाता से CCR5 बैंड दर्शाया गया है, दो CCR5wt/wt और एक CCR5से बैंड के बाद स्टेम सेल दाताओं । 19 दानदाताओं के समूह में जीनोटाइप CCR5132/wt की आवृत्ति 15.8% थी(चित्रा 1एच)। यह डेनमार्क में जांच किए गए व्यक्तियों के 23.6% तक में जीनोटाइप की रिपोर्टिंग करने वाले बड़े महामारी विज्ञान अध्ययन14,15 के साथ समझौते में है।

मानव सीडी 34 + स्टेम कोशिकाओं के प्रत्यारोपण के 3-5 महीने बाद चूहों परिधीय रक्त में मानव सीडी 45 + स्तरों का मूल्यांकन प्रवाह साइटोमेट्री के माध्यम से किया गया था। गेटिंग रणनीति चित्रा 2ए-ईमें प्रस्तुत की गई है। चित्रा 3 और चित्रा 3बी दो अलग-अलग दानदाताओं से स्टेम सेल प्राप्त करने वाले 10 और 16 व्यक्तिगत चूहों के बीच परिवर्तनशीलता को दर्शाते हैं। 75,000 hCD34 + कोशिकाओं के प्रत्यारोपण परिधीय रक्त में 20%-50% मानव CD45 + मिले। सभी चूहों ने सीडी 4 और सीडी 8 + टी कोशिकाओं सहित मानव बी और टी कोशिकाओं का विकास किया।

अदर्दनाक इंट्रावेजिनल एक्सपोजर के लिए, चित्र4 में चित्रित सेटअप का उपयोग किया गया था। चूहों को एक बंद कक्ष में एनेस्थेटाइज्ड किया गया था और एक्सपोजर के दौरान संज्ञाहरण के तहत रखा गया था। चूहों को म्यूकोसल सतहों के साथ वायरस समाधान सगाई सुनिश्चित करने के लिए जोखिम के बाद 5 मिन के लिए सामना करना पड़ योनि के साथ आयोजित किया गया ।

चित्रा 5 इस मॉडल का उपयोग करके देखी गई 64% एचआईवी ट्रांसमिशन सफलता दर दिखाती है। चूहों को RHPA4259 intravaginally की 21,400 संक्रामक इकाइयों (आईयू) के साथ चुनौती दी गई थी। इस खुराक के परिणामस्वरूप 64% चूहे योनि जोखिम के बाद एचआईवी संक्रमित हो गए। तुलना के लिए, नसों के मार्ग के माध्यम से उजागर चूहों के दो अलग-अलग साथियों के डेटा शामिल हैं। जैसा कि उम्मीद थी, चूहों का 100% आरएचपीए की समान खुराक और इस मार्ग का उपयोग करके एक अतिरिक्त तनाव (YU2) के साथ एचआईवी + बन गया।

चित्रा 5बी तीन चूहों से प्रतिनिधि परिणाम ों को दर्शाया गया है जो एचआईवी से संक्रमित थे और मानक CART युक्त आहार में बदल गए थे। चूहों को कैआरटी के 40 दिनों के बाद नियमित माउस चाउ में वापस बंद कर दिया गया था। इस परख सेटअप में वायरल लोड डिटेक्शन की सीमा 725 प्रतियां/एमएएल थी। वायरल लोड सभी CART के 4 सप्ताह के बाद पता लगाने की सीमा से नीचे थे । CART की समाप्ति के बाद, वायरस रिबाउंड, नैदानिक डेटा22mirroring । CART पर चूहों आहार में परिवर्तन के रूप में अच्छी तरह से चित्रा 5सीमें संकेत बर्दाश्त ।

Figure 1
चित्रा 1: स्टेम सेल शुद्धता और CCR5 दाता संस्करण स्थिति के सत्यापन के लिए प्रतिनिधि प्रवाह साइटोमेट्री गेटिंग रणनीति। (A-C) अलग CD34 + सेल आबादी के लिए उपयोग की जाने वाली गेटिंग रणनीति। डबल्स और मलबे को क्रमशः पैनल और बी (एफएससी-ए बनाम एफएससी-एच और एफएससी-ए बनाम एसएससी-ए) में बाहर रखा गया है। (ग)CD34 + स्टेम सेल और CD3 + टी सेल संदूषण की आवृत्ति । (D-एफ) CD34-प्रवाह के माध्यम से गेटिंग रणनीति । फाटकों में प्रतिशत की गणना माता-पिता की आबादी के एक अंश के रूप में की जाती है। (जी) सीसीआर5के परिणाम ों को पीसीआर विश्लेषण। लेन 1: एक मानव CCR5से डीएनए32/wt दाता, लेन 2 और 3: दो CCR5wt/wt मानव स्टेम सेल दाताओं, लेन 4: एक CCR532/ 19स्टेम सेल नमूनों के हमारे समूह में जीनोटाइप CCR532/wt की आवृत्ति 15.8% है। कृपया इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें ।

Figure 2
चित्रा 2: मानव कोशिका एनग्राफमेंट और भेदभाव के सत्यापन के लिए फ्लो साइटोमेट्री गेटिंग रणनीति। मानवीकृत चूहों से कुल मोनोन्यूक्लियर सेल आबादी का विश्लेषण फ्लो साइटोमेट्री के माध्यम से किया गया था। (क)मानव सीडी45 + कोशिकाओं का प्रतिशत कुल दर्ज की गई घटनाओं के एक अंश के रूप में निर्धारित किया गया था । (ख)बाद में एफएससी-ए/एफएससी-एच गेटिंग के आधार पर डबल्स को बाहर रखा गया । (ग)आकार और दानेदारता के आधार पर सही लिम्फोसाइट आबादी को परिभाषित किया गया था । (D)लिम्फोसाइट्स को तब सीडी 3 + (टी कोशिकाएं) या सीडी 19 + (बी कोशिकाओं) के रूप में चिह्नित किया गया था। (ई)सीडी 3 + टी कोशिकाएं या तो सीडी 4 + टी कोशिकाएं या सीडी 8 + टी कोशिकाएं थीं। फाटकों में प्रतिशत की गणना माता-पिता की आबादी के एक अंश के रूप में की गई थी । कृपया इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें ।

Figure 3
चित्रा 3: प्रतिनिधि मानवीकरण का स्तर 4-5 महीने के बाद स्टेम सेल प्रत्यारोपण के बाद 10 और 16 चूहों के लिए सेल उपप्रकार अंशों के साथ स्टेम सेल प्रत्यारोपण दो अलग मानव दाताओं से उत्पन्न । (क)10 से मोनोन्यूक्लियर सेल जनसंख्या (एमएनसी) और(ख)16 मानवीकृत चूहों का प्रवाह साइटोमेट्री के माध्यम से विश्लेषण किया गया और चित्रा 2में प्रस्तुत किया गया था । मानव सीडी45 + कोशिकाओं के अंश को % एचसीडी45 (कुल एमएनसी का) और % बी और% टी कोशिकाओं को एचसीडी45 के एक अंश के रूप में प्रस्तुत किया जाता है। टी कोशिकाओं को बाद में % सीडी 4 और % सीडी 8 में विभाजित किया गया था। प्रत्येक डेटा प्वाइंट एक माउस का प्रतिनिधित्व करता है। डेटा को मतलब ± एसडी के रूप में प्रस्तुत किया जाता है। कृपया इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें ।

Figure 4
चित्रा 4: चूहों के इंट्रावाजिनल एक्सपोजर के लिए प्रायोगिक प्रयोगशाला बेंच सेटअप। इंट्रावाजिनल मार्ग के माध्यम से मानवीकृत चूहों के एचआईवी एक्सपोजर के लिए प्रायोगिक सेटअप। प्रक्रिया एक प्रवाह पीठ में किया जाता है जहां उपयोग करने से पहले सभी अभिकर्मकों और सतहों को निष्फल कर दिया गया है। कृपया इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें ।

Figure 5
चित्रा 5: विभिन्न एक्सपोजर मार्गों के माध्यम से एचआईवी तनाव संचरण की दर और प्रभावकारिता और वायरल दमन में cART युक्त चाउ की सुरक्षा । (A)मानवीकृत एनओजी चूहों को या तो नसों में या नसों में मार्ग के माध्यम से एचआईवी के दो विभिन्न उपभेदों से सफलतापूर्वक संक्रमित किया गया था । चूहों को RHPA4259 intravaginally के 21,400 आईयू के साथ उजागर किया गया था, 5,157 आईयू चतुर्थ RHPA4259 के साथ, या YU2 के साथ 3,000 आईयू चतुर्थ। मानवीकृत चूहों के चतुर्थ जोखिम के बारे में विवरण इस प्रोटोकॉल में शामिल नहीं हैं। एचआईवी संक्रमण सफलतापूर्वक माउस चाउ के माध्यम से दिया एक कला आहार के साथ इलाज किया गया । (ख)सीटीएआर पर तीनों चूहों के लिए वायरल लोड कम हो गया और सीआरटी की समाप्ति के बाद खुशहाली आई । बिंदीदार रेखा 725 प्रतियों/mL पर परिमाणीकरण की सीमा को इंगित करती है। CART चाउ के साथ खिलाया चूहों एक ही समय अवधि के दौरान गैर cART चाउ पर रखे चूहों के रूप में इसी तरह के वजन विकास था, कोई स्वाद वरीयता या cART आहार के साइड इफेक्ट का संकेत है । (ग)बाट सीआरटी की शुरुआत की तुलना में गुना परिवर्तन के रूप में प्रस्तुत किए जाते हैं । प्रत्येक डेटा प्वाइंट तीन जानवरों ± एसडी के मतलब का प्रतिनिधित्व करता है । कृपया इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें ।

एंटीबॉडी लक्ष्य क्लोन फ्लोरोफोर
सीडी3 क्लोन SK7 BUV395
सीडी34 क्लोन AC136 फिटेसी
सीडी45 क्लोन 2D1 Apc

तालिका 1: स्टेम सेल शुद्धता के निर्धारण के लिए उपयोग किए जाने वाले एंटीबॉडी। स्टेम सेल शुद्धता के मूल्यांकन के लिए बहुरंगी प्रवाह साइटोमेट्री पैनल का सुझाव दिया। सूचीबद्ध एंटीबॉडी लक्ष्य, क्लोन, और फ्लोरोफोर हैं।

CCR5132 का पता लगाना प्राइमरों
फॉरवर्ड प्राइमर 5'CTTCATTACACCTGCAGCT'3
रिवर्स प्राइमर 5'TGAAaaGCCTCAGCC'3

तालिका 2: CCR5Τ32 वैरिएंट डिटेक्शन पीसीआर प्राइमर। सीसीआर5 जीन में 32 बीपी हटाने का पता लगाने के लिए इस्तेमाल किए जाने वाले फॉरवर्ड और रिवर्स प्राइमर।

नहीं. चक्र ों की 1 45 1
तापमान (डिग्री सेल्सियस) 98 98/63/72 72 10
समय 30 एस 10/30 एस/15 एस 5 मिन

तालिका 3: CCR5Τ32 वैरिएंट डिटेक्शन पीसीआर प्रोग्राम। पीसीआर साइकिल िंग कार्यक्रम CCR5 जीन के प्रवर्धन के लिए इस्तेमाल किया ।

एंटीबॉडी लक्ष्य क्लोन फ्लोरोफोर
सीडी4 एसके3 बीयूवी 496
सीडी8 आरपीए-टी8 BV421
सीडी3 ओकेटी3 फिटेसी
सीडी19 sj25c1 पीई-Cy7
सीडी45 2D1 Apc

तालिका 4: माउस मानवीकरण के निर्धारण के लिए उपयोग किए जाने वाले एंटीबॉडी। मानवीकरण के लिए बहुरंगी प्रवाह साइटोमेट्री पैनल का सुझाव दिया। सूचीबद्ध एंटीबॉडी लक्ष्य, क्लोन, और फ्लोरोफोर हैं।

नहीं. चक्र ों की 1 1
तापमान (डिग्री सेल्सियस) 51 80 4
समय 45 मिन 15 मिन

तालिका 5: सीडीएनए प्रवर्धन कार्यक्रम। वायरल आरएनए के लिए पूरक स्ट्रैंड डीएनए के प्रवर्धन के लिए उपयोग किया जाने वाला कार्यक्रम।

एचआईवी क्वांटिफिकेशन प्राइमरों
फॉरवर्ड प्राइमर 5'AGGGCAGCATAGAGAAAa'3
रिवर्स प्राइमर 5'CAAAGGAATGGGTGTTCTTCTT'3
एफएएम जांच 5'ATCCCCACTTCAACAGATGC'3

तालिका 6: एचआईवी डीडीपीसीआर प्राइमर। वायरल सीडीएनए के डीडीपीसीआर प्रवर्धन के लिए उपयोग किए जाने वाले प्राइमर और जांच।

नहीं. चक्र ों की 1 39 1
तापमान (डिग्री सेल्सियस) 95 95/54.5 98 4
समय 10 मिन 30 एस/1 मिन 10 मिन

तालिका 7: एचआईवी डीडीपीसीआर कार्यक्रम। पीसीआर साइकिल कार्यक्रम वायरल आरएनए के प्रवर्धन के लिए इस्तेमाल किया ।

राल्टेग्रावीर (आरएएल) 4800 मिलीग्राम प्रति किलो
टेनोफोविर डिसोप्रोक्सिल फ्यूमैरेट (टीडीएफ) 720 मिलीग्राम/किलो
एम्ट्रिसिटाबिन (एफटीसी) 520 मिलीग्राम/किलो

तालिका 8: माउस cART चाउ आहार। माउस चाउ आहार पहले प्रकाशित21के रूप में तैयार किया गया था । चाउ आहार मानक माउस चाउ के आधार पर बनाया गया था, और उत्पादन के बाद, भोजन 25 केजी और डबल-बैग के साथ विकिरणित किया गया था। चाउ को उपयोग तक -20 डिग्री सेल्सियस पर संग्रहित किया गया था।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

गंभीर रूप से इम्यूनोसमझौता माउस तनाव NOD। सीजी-पीआरकेडीसीसिडआईएल2आरजीtm1Sug/JicTac(NOG) मानव कोशिकाओं और ऊतकों के प्रत्यारोपण के लिए बहुत अच्छी तरह से अनुकूल है । इन चूहों में जन्मजात और अनुकूली प्रतिरक्षा मार्ग दोनों से समझौता किया जाता है। NOG और NSG चूहों एक Prkdcसिड उत्परिवर्तन है कि दोषपूर्ण टी और बी सेल समारोह में परिणाम बंदरगाह । इसके अलावा, इन चूहों में एक कार्यात्मक इंटरल्यूकिन-2 रिसेप्टर-चेन (सामान्य गामा चेन, आईएल2आरजी) की कमी है जो आईएल-2, आईएल-4, आईएल-7, आईएल-9, आईएल-15 और आईएल-21 जैसे कई प्रमुख साइटोकिन्स के बाध्यकारी परिसरों में अपरिहार्य है। मानव प्रतिरक्षा प्रणाली के साथ प्रत्यारोपित एनओजी जैसे इम्यूनोडिफिजेंट चूहे एचआईवी संचरण और इम्यूनोलॉजी के अध्ययन के लिए एक शक्तिशाली उपकरण हैं। मानवीकृत चूहों का उपयोग करके किए गए इन क्षेत्रों में योगदानकी2, 23,24,25,26की व्यापक समीक्षा की गई है . मानव जन्मजात प्रतिरक्षा प्रतिक्रियाओं का अध्ययन करने के लिए इन चूहों के उपयोग पर भी ध्यान दिया जा रहाहै

इस पांडुलिपि का उद्देश्य एक भोली माउस से एचआईवी संचरण और उपचार डेटा के लिए जाने के लिए माउस और ddPCR प्रक्रियाओं का एक व्यापक प्रोटोकॉल की आपूर्ति करना है। हमारे सिस्टम ने वायरल आरएनए और डीएनए की मात्रा के लिए डीडीपीसीआर का उपयोग किया। एक ddPCR प्रतिक्रिया में, प्रतिक्रियाकर्ताओं को 20,000 बूंदों में विभाजित किया जाता है, जिनमें से प्रत्येक में एकल, अलग माइक्रो पीसीआर प्रतिक्रिया होती है। एक बूंद के अंदर एक लक्ष्य का प्रवर्धन उस बूंद के लिए एक सकारात्मक फ्लोरोसेंट संकेत की ओर जाता है। इस प्रकार, रीडआउट बाइनरी है और पॉइससन सांख्यिकीय विश्लेषण ों को लागू करके, सकारात्मक प्रतिक्रियाओं की संख्या का मूल नमूने में कई टेम्पलेट प्रतियों में सीधे अनुवाद किया जा सकता है। डीडीपीसीआर का लाभ एक मानक वक्र से स्वतंत्र लक्ष्य को सीधे निर्धारित करने की क्षमता में निहित है। आरएनए नमूनों का विश्लेषण करते समय यह विशेष रूप से आकर्षक होता है जो उनके लेबिक नेचर29के कारण पीसीआर मानक घटता के रूप में उपयोग करना चुनौतीपूर्ण है । इसके अलावा, एक ही नमूने की कई प्रतिकृतियों का विश्लेषण करके और अंतिम नमूना मात्रा के लिए व्यक्तिगत डेटा बिंदुओं को मिलाकर, डीडीपीसीआर की बाइनरी प्रकृति नमूना29के प्रति एमएमएल टेम्पलेट प्रतियों की पता लगाने की सीमा को कम करना संभव बनाती है। यह एक मानवीय माउस सेटिंग में विशेष रूप से महत्वपूर्ण है, जहां केवल सीमित नमूना सामग्री उपलब्ध है और उच्च संवेदनशीलता की आवश्यकता है।

मानवीकृत चूहों के लिए CART का प्रशासन या तो मौखिक गावज या इंट्रापेरिटोनियल इंजेक्शन द्वारा सीएआर30,31,32के समाधान के साथ किया जा सकता है, और जैसा कि हाल ही में दिखाया गया है, आहार21में तैयार करके। हमारे प्रमुख उद्देश्यों में से एक माउस आहार में एक कला आहार का कार्यान्वयन था ताकि अन्य दवा वितरण विधियों में निहित अतिरिक्त हैंडलिंग चरणों के कारण जानवरों पर संभावित तनाव को कम किया जा सके। माउस जो दवा खाएगा, उसकी खुराक चूहों33के औसत दैनिक भोजन के सेवन के आधार पर सही अनुमान लगाया जा सकता है। आहार के माध्यम से मौखिक वितरण जानवर के लिए न्यूनतम तनाव और हैंडलर के लिए न्यूनतम कार्यभार दोनों के साथ सबसे आसान वितरण मार्ग के रूप में कार्य करता है। हमने मानवीकृत चूहों21,30में पिछले प्रकाशित अध्ययनों पर एंटीवायरल दवाओं के संयोजन को आधार बनाया । इसके अलावा, हमारी कला रणनीति चिकित्सकीय रूप से प्रासंगिक है कि चिकित्सकीय रूप से उपयोग की जाने वाली दवा संयोजन दुनिया भर के रोगियों द्वारा ऑर्कियल प्रशासित किया जाता है।

NOG चूहों के उपयोग के बारे में कुछ सीमाएं नोट की जाती हैं। महत्वपूर्ण बात, इन चूहों में मानव टी कोशिकाओं को एक माउस थाइमिक वातावरण में खेती की जाती है, जैसा कि मानव पर्यावरण के विपरीत होता है। हाल ही में ध्यान xenorecipient उपभेदों कि मजबूत मानव प्रतिरक्षा प्रतिक्रियाओं के विकास के लिए एक अनुकूल वातावरण है पैदा करने पर है । इन नए उपभेदों में इम्यूनोडिफिजेंट चूहे शामिल हैं जो मानव एमएचसी अणुओं के लिए ट्रांसजेनिक हैं, जैसे A2। ये मॉडल एचएलए-प्रतिबंधित एंटीजन टी-सेल प्रतिक्रियाओं को सक्षम करते हैं जिसके परिणामस्वरूप अनुकूली प्रतिरक्षा प्रणाली34की बेहतर परिपक्वता और प्रभावक कार्य होते हैं। एक अन्य दृष्टिकोण माउस जीन को आईएल-3/जीएम-सीएसएफ३५,आईएल-६३६,आईएल-१५३७,टीपीओ, एम-सीएसएफ३८और आईएल-7/टीएसएलपी३१के लिए प्रमुख मानव साइटोकिन्स के साथ प्रतिस्थापित करना है । इस तरह के मॉडलों ने जन्मजात सेल प्रकारों के बेहतर भेदभाव उत्पन्न करने की उनकी क्षमता के लिए ध्यान बढ़ाया है। हमारा प्रोटोकॉल इस तरह के किसी भी उन्नत आनुवंशिक पृष्ठभूमि इम्यूनोडिफिजेंट तनाव का उपयोग कर चूहों के मानवीकरण और एचआईवी संक्रमण के लिए आसानी से अनुकूलनीय है।

संक्षेप में, वर्णित दृष्टिकोण की आसानी और उपयोगिता वीवो में एचआईवी से संबंधित क्षेत्रों में अनुसंधान की सुविधा प्रदान करती है। मानवीकृत चूहों बेहतर अनुसंधान परिकल्पना पैदा करने की दिशा में अनुसंधान मार्गदर्शक में एक बहुत शक्तिशाली उपकरण हो सकता है। मानव ट्रांसजीन के साथ अधिक "मानव" मानवीय चूहों की पीढ़ी के साथ, हमारा मानना है कि हमारा मानकीकृत प्रोटोकॉल विभिन्न अनुसंधान वातावरण में प्रयोगात्मक प्रक्रियाओं को व्यवस्थित करने में योगदान देगा।

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखक हितों के टकराव की घोषणा नहीं करते ।

Acknowledgments

लेखक आरोहस विश्वविद्यालय में बायोमेडिसिन पशु सुविधा कर्मचारियों, विशेष रूप से कॉलोनी रखरखाव के प्रयासों के लिए और माउस वजन पर नज़र रखने के लिए सुश्री जानी Kær का शुक्रिया अदा करना चाहते हैं । लेखक ों को मानक की देखभाल cART के विकास के लिए और मार्गदर्शन के लिए प्रोफेसर फ्लोरियन क्लीन शुक्रिया अदा करना चाहते हैं । निम्नलिखित अभिकर्ता NIH एड्स अभिकर्ता कार्यक्रम, एड्स के प्रभाग, NIAID, NIH: pRHPA.c/2635 (बिल्ली # ११७४४) डॉ जॉन Kappes और डॉ क्रिस्टीना Ochsenbauer से प्राप्त किया गया था ।

Materials

Name Company Catalog Number Comments
Blue pad VWR 56616-031 Should be sterilized prior to use
Bovine serum albumin (BSA) Sigma A8022
CD19 (clone sj25c1) PE-Cy7 BD Bioscience 557835
CD3 (clone OKT3) FITC Biolegend 317306
CD3 (clone SK7) BUV395 BD Bioscience 564001
CD34 (clone AC136) FITC Miltenyi 130-113-740
CD4 (clone SK3) BUV 496 BD Bioscience 564652/51
CD45 (clone 2D1) APC Biolegend 368511/12
CD8 (clone RPA-T8) BV421 BD Bioscience 562428
ddPCR Supermix for probes (no dUTP) Bio-Rad 1863025
DMSO Merck 10,02,95,21,000
DNAse Sigma D4263 For suspension buffer
dNTP mix Life Technologies R0192
Dulbeccos phosphate-buffered saline (PBS) Biowest L0615-500
EasySep Human Cord Blood CD34 Positive Selection Kit II Stemcell 17896
EDTA Invitrogen 15575-038
FACS Lysing solution 10X BD 349202 Dilute 1:10 in dH20 immediately before use
FACS tubes (Falcon 5 mL round-botton) Falcon 352052
Fc Receptor blocking solution (Human Trustain FcX) Biolegend 422302
Fetal bovine serum Sigma F8192-500
Ficoll-Paque PLUS GE Healthcare 17144002
Flowjo v.10
Gauze Mesoft 157300 Should be sterilized prior to use
Heating lamp Custom made
Hemacytometer (Bürker-Türk) VWR DOWC1597418
Isoflurane gas Orion Pharma 9658
LSR Fortessa X20 flow cytometer BD
Microcentrifuge tubes, PCR-PT approved Sarstedt 72692405
Mouse cART food ssniff Spezialdiäten GmbH Custom made product
Mouse restrainer Custom made product
Needle, Microlance 3, 30G ½" BD 304000
NOG mice NOD.Cg-Prkdcscid Il2rgtm1Sug/JicTac Taconic NOG-F
Nuclease-free water VWR chemicals 436912C
Nucleospin 96 Virus DNA and RNA isolation kit Macherey-Nagel 740691
PCR-approved microcentrifuge tubes Sarstedt 72.692.405
Penicillin-Streptomycin solution 100X Biowest L0022-100
Phusion Hot Start II DNA polymerase Life Technologies F549S
Pipette tips, sterile, ART 20P Barrier ThermoScientific 2149P
Proteinase K NEB 100005398
QuantaSoft software Bio-Rad
QX100 Droplet Generator Bio-Rad 1886-3008
QX100 Droplet Reader Bio-Rad 186-3003
RBC lysis solution Biolegend 420301
RNase-free DNAse size F + reaction buffer Macherey-Nagel 740963
RNAseOUT Recombinant Ribonuclease inhibitor ThermoScientific 10777-019
RPMI Biowest L0501-500 Dissolve in H20
Softject 1 mL syringe Henke Sass Wolf 5010-200V0
Superscript III Reverse Transcriptase ThermoFisher Scientific 18080044
Thermoshaker VWR 89370-910
Trypane blue Sigma T8154
Ultrapure 0.5 EDTA, pH 8.0 ThermoFisher Scientific 15575-020
Virkon S (virus disinfectant) Dupont 7511

DOWNLOAD MATERIALS LIST

References

  1. WHO. GHO | By category | Antiretroviral therapy coverage - Data and estimates by WHO region (2018). World Health Organization. Available from: http://apps.who.int/gho/data/node.main.626 (2018).
  2. Skelton, J. K., Ortega-Prieto, A. M., Dorner, M. A Hitchhiker's guide to humanized mice: new pathways to studying viral infections. Immunology. 154, (1), 50-61 (2018).
  3. Denton, P. W., Krisko, J. F., Powell, D. A., Mathias, M., Kwak, Y. T. Systemic Administration of Antiretrovirals Prior to Exposure Prevents Rectal and Intravenous HIV-1 Transmission in Humanized BLT Mice. PLoS ONE. 5, (1), 8829 (2010).
  4. Zou, W., et al. Nef functions in BLT mice to enhance HIV-1 replication and deplete CD4 + CD8 + thymocytes. Retrovirology. 9, (1), 44 (2012).
  5. Berges, B. K., Akkina, S. R., Folkvord, J. M., Connick, E., Akkina, R. Mucosal transmission of R5 and X4 tropic HIV-1 via vaginal and rectal routes in humanized Rag2 -/- γc -/- (RAG-hu) mice. Virology. 373, (2), 342-351 (2008).
  6. Veselinovic, M., Charlins, P., Akkina, R. Modeling HIV-1 Mucosal Transmission and Prevention in Humanized Mice. Methods Mol Biol. 203-220 (2016).
  7. Neff, C. P., Kurisu, T., Ndolo, T., Fox, K., Akkina, R. A topical microbicide gel formulation of CCR5 antagonist maraviroc prevents HIV-1 vaginal transmission in humanized RAG-hu mice. PLoS ONE. 6, (6), 20209 (2011).
  8. Neff, P. C., Ndolo, T., Tandon, A., Habu, Y., Akkina, R. Oral pre-exposure prophylaxis by anti-retrovirals raltegravir and maraviroc protects against HIV-1 vaginal transmission in a humanized mouse model. PLoS ONE. 5, (12), 15257 (2010).
  9. Veselinovic, M., et al. HIV pre-exposure prophylaxis: Mucosal tissue drug distribution of RT inhibitor Tenofovir and entry inhibitor Maraviroc in a humanized mouse model. Virology. 464-465, 253-263 (2014).
  10. Akkina, R., et al. Humanized Rag1-/-γc-/- mice support multilineage hematopoiesis and are susceptible to HIV-1 infection via systemic and vaginal routes. PLoS ONE. 6, (6), 20169 (2011).
  11. Zhou, J., et al. Systemic administration of combinatorial dsiRNAs via nanoparticles efficiently suppresses HIV-1 infection in humanized mice. Molecular Therapy. 19, (12), 2228-2238 (2011).
  12. Balcombe, J. P., Barnard, N. D., Sandusky, C. Laboratory routines cause animal stress. Contemporary Topics in Laboratory Animal Science. 43, (6), 42-51 (2004).
  13. Trecarichi, E. M., et al. Partial protective effect of CCR5-Delta 32 heterozygosity in a cohort of heterosexual Italian HIV-1 exposed uninfected individuals. AIDS Research and Therapy. 3, (1), (2006).
  14. Novembre, J., Galvani, A. P., Slatkin, M. The geographic spread of the CCR5 Δ32 HIV-resistance allele. PLoS Biology. 3, (11), 1954-1962 (2005).
  15. Solloch, U. V., et al. Frequencies of gene variant CCR5-Δ32 in 87 countries based on next-generation sequencing of 1.3 million individuals sampled from 3 national DKMS donor centers. Human Immunology. 78, (11-12), 710-717 (2017).
  16. Ochsenbauer, C., et al. Generation of Transmitted/Founder HIV-1 Infectious Molecular Clones and Characterization of Their Replication Capacity in CD4 T Lymphocytes and Monocyte-Derived Macrophages. Journal of Virology. 86, (5), 2715-2728 (2012).
  17. Andersen, A. H. F., et al. Long-Acting, Potent Delivery of Combination Antiretroviral Therapy. ACS Macro Letters. 7, (5), 587-591 (2018).
  18. Caro, A. C., Hankenson, F. C., Marx, J. O. Comparison of thermoregulatory devices used during anesthesia of C57BL/6 mice and correlations between body temperature and physiologic parameters. Journal of the American Association for Laboratory Animal Science JAALAS. 52, (5), 577-583 (2013).
  19. Gatlin, J., Padgett, A., Melkus, M. W., Kelly, P. F., Garcia, J. V. Long-term engraftment of nonobese diabetic/severe combined immunodeficient mice with human CD34+ cells transduced by a self-inactivating human immunodeficiency virus type 1 vector. Human Gene Therapy. 12, (9), 1079-1089 (2001).
  20. Leth, S., et al. HIV-1 transcriptional activity during frequent longitudinal sampling in aviremic patients on antiretroviral therapy. AIDS. 30, (5), 713-721 (2016).
  21. Halper-Stromberg, A., et al. Broadly neutralizing antibodies and viral inducers decrease rebound from HIV-1 latent reservoirs in humanized mice. Cell. 158, (5), 989-999 (2014).
  22. Rothenberger, M. K., et al. Large number of rebounding/founder HIV variants emerge from multifocal infection in lymphatic tissues after treatment interruption. Proceedings of the National Academy of Sciences. 112, (10), 1126-1134 (2015).
  23. Rongvaux, A., et al. Human Hemato-Lymphoid System Mice: Current Use and Future Potential for Medicine. Annual Review of Immunology. 31, (1), 635-674 (2013).
  24. Walsh, N. C., et al. Humanized Mouse Models of Clinical Disease. Annual Review of Pathology: Mechanisms of Disease. 12, (1), 187-215 (2017).
  25. Denton, P. W., García, J. V. Humanized mouse models of HIV infection. AIDS Reviews. 13, (3), 135-148 (2011).
  26. Denton, P. W., Søgaard, O. S., Tolstrup, M. Using animal models to overcome temporal, spatial and combinatorial challenges in HIV persistence research. Journal of Translational Medicine. 14, (1), (2016).
  27. Andersen, A. H. F., et al. cAIMP administration in humanized mice induces a chimerization-level-dependent STING response. Immunology. 157, (2), 163-172 (2019).
  28. Tanaka, S., et al. Development of Mature and Functional Human Myeloid Subsets in Hematopoietic Stem Cell-Engrafted NOD/SCID/IL2r KO Mice. The Journal of Immunology. 188, (12), 6145-6155 (2012).
  29. Quan, P. L., Sauzade, M., Brouzes, E. DPCR: A technology review. Sensors (Switzerland). 18, (4), (2018).
  30. Denton, P. W., et al. Generation of HIV Latency in Humanized BLT Mice. Journal of Virology. 86, (1), 630-634 (2012).
  31. Li, Y., et al. A human immune system mouse model with robust lymph node development. Nature Methods. 15, (8), 623-630 (2018).
  32. Satheesan, S., et al. HIV Replication and Latency in a Humanized NSG Mouse Model during Suppressive Oral Combinational Antiretroviral Therapy. Journal of Virology. 92, (7), 02118 (2018).
  33. Bachmanov, A. A., Reed, D. R., Beauchamp, G. K., Tordoff, M. G. Food intake, water intake, and drinking spout side preference of 28 mouse strains. Behavior Genetics. 32, (6), 435-443 (2002).
  34. Shultz, L. D., et al. Generation of functional human T-cell subsets with HLA-restricted immune responses in HLA class I expressing NOD/SCID/IL2r null humanized mice. Proceedings of the National Academy of Sciences. 107, (29), 13022-13027 (2010).
  35. Willinger, T., et al. Human IL-3/GM-CSF knock-in mice support human alveolar macrophage development and human immune responses in the lung. Proceedings of the National Academy of Sciences. 108, (6), 2390-2395 (2011).
  36. Hanazawa, A., et al. Generation of human immunosuppressive myeloid cell populations in human interleukin-6 transgenic NOG mice. Frontiers in Immunology. 9, FEB (2018).
  37. Huntington, N. D., et al. IL-15 trans-presentation promotes human NK cell development and differentiation in vivo. The Journal of Experimental Medicine. 206, (1), 25-34 (2009).
  38. Rongvaux, A., et al. Development and function of human innate immune cells in a humanized mouse model. Nature Biotechnology. 32, (4), 364-372 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics