Humaniserede NOG-mus til intravaginal hiv-eksponering og behandling af hiv-infektion

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Vi har udviklet en protokol til generering og evaluering af en humaniseret og human immundefekt virus-inficeret NOG musemodel baseret på stamcelletransplantation, intravaginal human immundefekt virus eksponering, og dråbe digital PCR RNA Kvantificering.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Andersen, A. H. F., Nielsen, S. S. F., Olesen, R., Mack, K., Dagnæs-Hansen, F., Uldbjerg, N., Østergaard, L., Søgaard, O. S., Denton, P. W., Tolstrup, M. Humanized NOG Mice for Intravaginal HIV Exposure and Treatment of HIV Infection. J. Vis. Exp. (155), e60723, doi:10.3791/60723 (2020).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Humaniserede mus udgør en sofistikeret platform til at studere human immundefekt virus (HIV) virologi og til at teste antivirale lægemidler. Denne protokol beskriver etableringen af et menneskeligt immunsystem i voksne NOG-mus. Her forklarer vi alle de praktiske skridt fra isolering af navlestrengsblod afledt menneskelige CD34 + celler og deres efterfølgende intravenøse transplantation i mus, til manipulation af modellen gennem hiv-infektion, kombination antiretroviral behandling ( cART) og blodprøvetagning. Ca. 75.000 hCD34+ celler injiceres intravenøst i musene og niveauet af human kimærisme, også kendt som humanisering, i det perifere blod anslås langsgående i flere måneder ved flow cytometri. I alt 75.000 hCD34 + celler giver 20% -50% menneskelige CD45 + celler i perifere blod. Musene er modtagelige for intravaginal infektion med HIV og blod kan udtages en gang om ugen til analyse, og to gange om måneden i længere perioder. Denne protokol beskriver en analyse til kvantificering af plasmaviral belastning ved hjælp af dråbe digital PCR (ddPCR). Vi viser, hvordan musene effektivt kan behandles med en standard-of-care cART regime i kosten. Levering af cART i form af regelmæssig mus chow er en betydelig raffinement af den eksperimentelle model. Denne model kan bruges til præklinisk analyse af både systemiske og topiske præeksponeringprofylakseforbindelser samt til test af nye behandlinger og hiv-helbrede strategier.

Introduction

Human immundefekt virus (HIV) er en kronisk infektion med mere end 37 millioner smittede personer på verdensplan1. Kombination antiviral behandling (cART) er en livreddende behandling, men en kur er stadig berettiget. Der er således behov for dyremodeller, der afspejler det menneskelige immunsystem og dets reaktioner for at lette fortsat forskning i hiv. Flere typer humaniserede mus, der er i stand til at støtte celle- og vævsengraftment, er udviklet ved at transplantere humane celler til alvorligt immundefekte mus2. Sådanne humaniserede mus er modtagelige for hiv-infektion og udgør et vigtigt alternativ til ikke-menneskelige primat simian immundefekt virus modeller, da de er billigere og enklere at bruge end ikke-menneskelige primater. Humaniserede mus har faciliteret forskning i hiv-virusoverførsel, patogenese, forebyggelse og behandling3,4,5,6,7,8,9,10,11.

Vi præsenterer et fleksibelt humaniseret modelsystem til hiv-forskning udviklet ved at transplantere navlestrengsblod afledt menneskelige stamceller i mus af NOD. Cg-PrkdcscidIl2rgtm1Sug/ JicTac (NOG) baggrund. Ud over at være af ikke-føtal oprindelse, den praktiske bioengineering af disse mus er mindre teknisk krævende i forhold til de mikrokirurgiske procedurer, der er involveret i transplantation af blod-lever-thymus (BLT) konstruktion.

Vi viser, hvordan man etablerer hiv-infektion gennem intravaginal transmission, og hvordan man kan overvåge plasma viral belastning med en følsom dråbe digital PCR (ddPCR)-baserede setup. Efterfølgende beskriver vi etableringen af standard cART givet som en del af den daglige musekost. Formålet med disse kombinerede metoder er at reducere stress en dyr og lette storstilede forsøg, hvor den tid, der bruges på at håndtere hvert dyr, er begrænset12.

Hos mennesker forårsager en CCR5Δ32/wt eller CCR5Δ32/ Δ32 genotype nedsat modtagelighed for hiv-infektion med sender/stiftervirus13,og der skal træffes visse forholdsregler ved bioengineering humaniserede mus med stamceller med henblik på hiv-studier. Dette gælder især i vores region, fordi naturligt forekommende varianter i CCR5-genet, især Δ32-sletninger, er mere udbredte i skandinaviske og baltiske indfødte befolkninger sammenlignet med resten af verden14,15. Således omfatter vores protokol en nem, høj gennemløbsanalyse til screening af donorhæmatopoietiske stamceller til CCR5 varianter før transplantation.

For intravaginal eksponering valgte vi senderen / grundlægger R5 virus RHPA4259, isoleret fra en kvinde i en tidlig fase af infektion, der var smittet intravaginalt16. Vi udsatte musene for en viral dosis, der var tilstrækkelig til at give vellykket overførsel i de fleste mus, men under en 100% transmissionshastighed. Valg af en sådan dosis muliggør et tilstrækkeligt dynamisk interval i transmissionshastigheden, således at antivirale virkninger af en lægemiddelkandidat kan resultere i beskyttede dyr i hiv-forebyggelsesforsøg og nedsat virusbelastning til behandlingsundersøgelser.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alle navlestrengsblodprøver blev indhentet i nøje overensstemmelse med lokalt godkendte protokoller, herunder informeret samtykke fra forældrenes anonyme donation. Alle dyreforsøg blev godkendt og udført i nøje overensstemmelse med danske nationale bestemmelser i henhold til licensen 2017-15-0201-01312.

FORSIGTIG: Håndter hiv-eksponerede mus og blod med ekstrem forsigtighed. Dekontaminer alle overflader og væsker, der har været i kontakt med hiv med et bekræftet hiv-desinfektionsmiddel (Materialetabel).

1. Isolering af menneskelige CD34+ stamceller

  1. Indsamle navlestrengsblodprøver prøver i EDTA-belagt blodopsamling rør efter planlagtkejsersektioner eller vaginal fødsler og i henhold til lokale etiske godkendelser.
  2. Isoler PMBC'er fra navlestrengsblod ved adskillelse af massegradient i henhold til producentens protokol.
  3. Isoler CD34+ celler fra PBMC-populationen ved først at forberige med antistoffer mod almindelige markører for modne celler, hvilket fremkalder krydssammenkædning af celler af uønskede slægter med røde blodlegemer. Dette efterfølges af CD34+ celleberigelse ved hjælp af magnetiske perler, i henhold til producentens protokol.
    1. Lev celletal bestemmes efter standard trypan blå eksklusion ved at ophænge 10 μL celleaffjedring i 90 μL trypanblå. Tilføj 10 μL af denne opløsning til et hemacytometer og tælle ikke-blå celler, i henhold til producentens protokol.
    2. Viably cryopreserve CD34 + celler i 1 ml 10% DMSO i føtal kvæg serum (FBS) indtil dagen for mus transplantation.
    3. Viably cryopreserve en lille brøkdel af både isolerede (CD34+) og gennemstrømningsceller (CD34-) separat til vurdering af CD34+ stamcellerenhed (~30.000 celler i hver prøve). Alternativt kan du teste renheden på friskberigede celler (se trin 2 nedenfor).
    4. Fastfryse en brøkdel af ikke-pelleteret gennemstrømning (CD34-) til bestemmelse af CCR5Δ32-status. Celler kan fryses direkte uden konditioneret fryseopløsning, men tilstedeværelsen af røde blodlegemer i pellet kan hæmme den efterfølgende PCR, hvis gennemstrømningen er pelleteret.

2. Vurdering af CD34+ stamcellerenhed via flowcytometri

  1. Tø de isolerede celler (CD34+) og gennemløbsceller (CD34-). Cellerne vaskes igen ved at ophænge cellerne fra hvert hætteglas i 9 ml rumtemperatur (RT) FACS-buffer, bestående af 2% føtal kvægserum (FBS) i fosfatbufferet saltvand (PBS).
  2. Centrifuge i 5 min ved 300 x g ved RT til pelletceller.
  3. Hæld supernatanten af, ophæng cellerne i den resterende væske igen og overfør til FACS-rør. Gentag vasketrinnet med 3 ml FACS-buffer. Efter den anden centrifugering hældes supernatanten af og ophæng cellerne i den resterende væske igen.
  4. Der tilsættes 5 μL fc receptorblokeringsopløsning (Materialetabel)og lad den ligge 10 min på RT. Afvask ikke fc receptorens blokerende opløsning.
  5. Tilføj blandingen, der indeholder forudbestemte mængder af antistoffer mod human CD3 (klon SK7) BUV395, CD34 (klon AC136), FITC og CD45 (klon 2D1) APC (tabel 1). Lad cellerne være i 30 minutter ved RT i mørke. Fluorophorerne skal vælges på grundlag af parametre, der kan vurderes med tilgængelige flowcytometre uden at kræve en kompensationsmatrix.
  6. Cellerne vaskes med 3 ml FACS-buffer.
  7. Centrifuge i 5 min ved 300 x g ved RT for at pelletcellerne.
  8. Hæld supernatanten af og ophæng cellerne i den resterende væske igen.
    1. Gentag dette vasketrin 2x for at sikre, at alle ubundne antistoffer er blevet fjernet.
  9. Optag prøverne på flowcytometeret (Materialetabellen) og udfør dataanalyse med passende software. Gating-strategien præsenteres i figur 1A-F.

3. Genetisk screening for CCR5Δ32 varianter i navlestrengsblod

  1. Inkuber1,25 μL ikke-pelleteret gennemstrømning med 11,25 μL PCR-blanding indeholdende 200 μM dNTP-blanding, 0,01 U/μL dna-polymerase med høj nøjagtighed og de frem- og omvendte primere, der er beskrevet i tabel 2.
    1. Volumenet justeres med nukleasefrit vand til ca. 12,5 μL for hver PCR-reaktion.
  2. Forstærke de genomiske fragmenter med PCR cykelprogrammet beskrevet i tabel 3.
  3. Adskil PCR-produkterne på en 2% agarose gel13.
    1. PCR-produkter fra de vilde typealleler og Δ32-allelerne giver PCR-fragmenter af henholdsvis 196 basispar og 164 basisparbånd, hvilket gør dem let tilgængelige ved gelelektroforese13 (figur 1G).

4. Intravenøs stamcelletransplantation

BEMÆRK: At have en person forberede cellerne i laboratoriet og en anden person forberede mus og arbejdsområde til transplantationer er en effektiv tilgang.

  1. I et dyreanlæg, 4-6 timer før den planlagte transplantation af stamcellerne, bestråles 6-7 uger gamle kvindelige NOD. Cg-Prkdcscid Il2rgtm1Sug/ JicTac (NOG) mus (Tabel over materialer) med 0,75 Gy med en Cs137 kilde. Den bedste konditioneringdosis kan variere afhængigt af musealder, strålekilde og andre faktorer. Denne proces betingelser dyrene for en vellykket engraftment med menneskelige stamceller.
  2. I et dyreanlæg skal du forberede flowbænkenog alle reagenser, før musene eller cellerne bringes ind i arbejdsområdet.
    1. Placer en steril blå pude til at dække arbejdsfladen af flowbænken. Forbered steril gaze og en skarp beholder.
    2. Anbring en varmelampe desinficeret med 70% ethanol i flowbænken med et tomt sterilt musebur under varmen.
  3. I laboratoriet, tø isolerede CD34 + celler og fortynde dem i 9 ml af 37 °C plain RPMI.
  4. Centrifugerne centrifugeres ved 350 x g i 5 min ved RT, kassér supernatantet ved aspiration, og pelletpelleten suspenderes igen i 1 ml almindelig RPMI ved 37 °C.
  5. Bestem celletallet ved trypan blå ekskludering, og juster lydstyrken til 200 μL pr. mus. Gør ekstra for at tage højde for mulige tab på grund af de efterfølgende håndteringstrin.
    1. Forbered dig på at transplantere 75.000 CD34+ celler pr. 200 μL i hver mus.
    2. Cellerne kan opbevares ved 4 °C under transport en til dyreanlægget før transplantationen. Undgå at holde cellerne på is for at reducere sammenlægning eller sammenklumpning.
  6. I dyreanlægget skal buret med musene komme ind i flowbænken og overføre musene til buret under varmelampen for at spile blodkarrene. Lad den ene ende af buret væk fra varmekilden, så musene kan bevæge sig væk fra varmen, når de bliver varme. Mus, der er flyttet til enden af buret, væk fra varmekilden, er tilstrækkeligt varme til en vellykket hale vene injektion.
  7. Læg en 1 ml smurt sprøjte til over 800 μL mærket med ophængte CD34+ celler. Ved hjælp af en smurt 1 ml sprøjte vil dramatisk lette den intravenøse injektion og øge præcisionen af denne teknik.
  8. Fastgør en 30 G 13 mm nål, og gør nålen og sprøjten klar til injektion. Denne driftsrækkefølge gør det muligt at indlæse sprøjten hurtigere og samtidig beskytte cellernes integritet, der skal transplanteres i betragtning af de mulige skader, der kan opstå under cellernes hurtige aspiration gennem en så lille målenål. Fyld kanylenavet med væske ved at trykke på stemplet og fjerne væsken ned til 200 μL-mærket på nålen.
  9. Anbring en opvarmet mus (trin 4.6) i et fastholdelsestilhold, der anvendes til at give IV injektioner. Injicer forsigtigt 200 μL af celleaffjedringen i musens halevene. Tilbring 2 s udfører springet og holde nålen indsat i ca 2 s efter afslutningen af injektionen. Dette sikrer, at cellerne har migreret tilstrækkeligt langt fra injektionsstedet, før nålen fjernes.
  10. Om nødvendigt tørre musehalen med steril gaze for at fjerne synligt blod. Sæt musen tilbage i sin ikke-opvarmede hjem bur. Gentag injektionsproceduren med de resterende mus.

5. Blodtapning og behandling til analyse

BEMÆRK: Human celleengraftment i det perifere blod kan evalueres via flow cytometri 3-5 måneder efter human stamcelletransplantation.

  1. Tegn blodprøver fra musene ved hjælp af lokale IACUC-godkendte teknikker.
  2. Højst 70-100 μL totalblod i sterile PCR-mikrocentrifugerør, der indeholder 10 μL 0,5 M EDTA (pH = 8.0) for at undgå koagulation af blod.

6. Evaluering af human engraftment via flow cytometri

  1. Overfør 40-50 μL blod til FACS-rør.
  2. Der tilsættes 5 μL fc receptorblokeringsopløsning for at forhindre uspecifik binding af antistoffer og lad den ligge 10 min ved RT.
  3. Tilsæt musen anti-human antistof blanding, der indeholder CD4 (klon SK3) BUV 496, CD8 (klon RPA-T8) BV421, CD3 (klon OKT3) FITC, CD19 (klon sj25c1) PE-Cy7, CD45 (klon 2D1) APC (tabel 4) og lad det plette i mørke på RT i 30 min. Fluorophores skal vælges på grundlag af parametre, der kan vurderes med de tilgængelige flow cytometre uden at kræve en matrix kompensation.
  4. Tilføj 2 ml af en passende rød blodlegemer lysing buffer til hvert rør til lyse de røde blodlegemer. Brug en lyseisbuffer, der er specielt formuleret til antistoffarvning før rødt blodlegemers lysis (et passende eksempel findes i materialetabellen). Vortex kort for at sikre en ligelig fordeling af cellerne i lysing opløsning og lad i 10 min på RT. Lige fordeling af cellerne er vigtig.
  5. Tilføj 2 ml FACS-buffer for at stoppe lysisreaktionen.
  6. Centrifuge i 5 min ved 300 x g ved RT for at pelletcellerne.
  7. Hæld supernatanten og vortex forsigtigt af, indtil cellerne er opslæmmede igen.
  8. Der tilsættes 3 ml FACS-buffer og centrifuge i 5 min ved 300 x g ved RT.
  9. Hæld supernatanten af og ophæng cellerne igen.
  10. Registrer prøverne på et passende flowcytometer, og analysér ved hjælp af passende software (Materialetabel). Repræsentativ analyse og resultater er vist i figur 2 og figur 3.

7. Eksponering for intravaginal hiv

BEMÆRK: Den virus, der anvendes til intravaginal eksponering af musene kan produceres ved hjælp af tidligere offentliggjorte protokol17. Virussen opbevares ved -80 °C og transporteres mellem steder, mens den opbevares på tøris efter lokalt godkendte protokoller. Virussen opbevares på tøris indtil umiddelbart før musenes eksponering. Virussen kan fortyndes til almindelig RPMI (undgå RPMI, der har antibiotika eller serumtilsætningsstoffer) for at opnå den relevante koncentration umiddelbart før eksponering (21.400 II'er blev brugt til denne IVAG-eksponering). Når det er genereret, holde fortyndet bestand på våd is under hele proceduren for at undgå fryse-tø cykler, der ville opstå, hvis den fortyndede virus blev placeret tilbage på tøris, når optøet.

  1. Forbered alt udstyr og flow bænk arbejdsområde som præsenteret i figur 4, før du bringer mus eller virus i flow bænken (svarende til trin 4.2).
    1. Placer varmelampens fokus i midten af arbejdsområdet, hvor musen vil blive placeret under hiv-eksponeringsproceduren. Varmelampen sikrer ingen fald i musens kropstemperatur. Andet udstyr, der styrer temperaturen, kan også anvendes (f.eks. en opvarmet gelpude eller et cirkulerende varmtvandstæppe i henhold til lokale IACUC-bestemmelser18).
    2. Bring sterile 20 μL pipettespidser og en passende pipette ind i bænken. Anbring en beholder med flydende desinfektionsmiddel (Materialetabellen)på bænken for øjeblikkelig inaktivering af materialer og væsker, der har været i kontakt med virussen.
  2. Placer en mus i et kammer med 3% isofluran gas og papirhåndklæder. Denne procentdel af gas vil bedøve dyrene inden for 2-4 min. Som med alle andre materialer, der anvendes med immundefekte mus, skal anæstesiapparatet desinficeres korrekt før brug.
  3. Når du er blevet bestøvet, overføres musen til en steril blå pude under varmelampen. Sæt musen snude ind i en maske, der leverer kontinuerlig 3% isofluran gas til at opretholde anæstesi. Hold musen i bunden af halen, maven vender opad, med hånden støtter musen tilbage som afbildet i figur 4.
  4. Med en steril pipettespids stimuleres kønsområdet ved forsigtigt at strøg opad mod anus for at fremkalde tømning af endetarmen, lindre trykket på skeden.
  5. Forsigtigt bare vaginal åbning ved indpakning musehalen på tværs af fingrene, således at vulva naturligt åbner, måske med let nudging ved hjælp af en steril pipette spids.
  6. Skift pipettespidsen og pipette 20 μL virus atraumatisk ind i musevagina uden at skabe bobler. Skær ikke spidsen dybt ind i skeden. Snarere, med vulva åbnet, placere pipette spidsen på niveau med vaginal åbning, undgå at gå dybere for at fjerne potentialet for hudafskrabninger under podning proces, frigive virus, og tillade tyngdekraften at trække virus ind i skeden. Alternativt skal du bruge en 22 G 1,25 mm stump-ende, lige nål, som beskrevet i Veselinovic et al.6.
  7. Hold musen i denne position med skeden opad i 5 min efter udsættelse for at undgå tyngdekraft-induceret lækage af virus suspension.
    1. Placer forsigtigt musen i hjemmet bur, passe på at placere musen på ryggen.

8. Behandling af blodprøver forud for viral belastninganalyse

  1. Opsaml blod som beskrevet i afsnit 5 ovenfor.
  2. Centrifuger blodprøverne i 5 min ved 500 x g ved RT for at adskille plasma og celler.
  3. 40 μL plasma til viral belastningsmåling i et nyt sterilt PCR-godkendt mikrocentrifugerør og opbevares ved -80 °C i mindst 1 time indtil videre behandling. Det er vigtigt at fryse alle prøver før RNA-ekstraktion for at undgå risikoen for bias i at sammenligne RNA-niveauer i prøver, der ikke har været frosset før RNA-isolation, til prøver, der er frosset før RNA-isolation.
  4. Den justeres mængden af blod tilbage til det oprindelige volumen ved at tilsætte 40 μL affjedringsmedier (PBS med 2,5% kvægserumalbumin, 50 U/ml penicillin G og streptomycin og 10 U/ml DNase, sterilt filtreret ved 0,22 μm).
  5. Overfør 15 μL af den justerede blodmængde til et nyt PCR-godkendt mikrocentrifugerør.
  6. Tilføj 1 ml 1x RBC lysis opløsning (Tabel over materialer),vortex, og inkubere i 10 min på RT.
  7. Centrifuge i 1 min ved 9.600 x g ved RT til pelletceller.
  8. Aspirate supernatant og lad kun den lille hvide celle pellet, fordi røde blodlegemer forurening kan hæmme PCR.
  9. Pellet opbevares ved -80 °C i mindst 1 time indtil videre forarbejdning.
    BEMÆRK: Eventuelt kan resterende blod fra trin 8.4 bruges til flow cytometri analyse, som beskrevet ovenfor i trin 6.

9. DNA-ekstraktion ved hjælp af en proteinase K ekstraktionsmetode

  1. Uddrag DNA fra perifere cellepiller (genereret i trin 8.8) ved hjælp af en proteinase K ekstraktionsmetode som beskrevet nedenfor. Denne metode er blevet påvist at udtrække det højeste DNA-udbytte fra en lille mængde blod som den, der kræves for de seriel blodsamlinger, der anvendes i denne undersøgelse19.
  2. Der tilsættes 25 μL proteinase K (20 μg/ml) til 1 ml 0,1 M Tris buffer.
  3. Vortex proteinase K opløsningen kort.
  4. Der tilsættes 50 μL af proteinase K-opløsningen til hver cellepellet, der skal fordøjes.
  5. Bland ved pipetting op og ned og bekræfte resuspension af cellepellet.
  6. Ryst på en termoshaker(Materialetabel)ved 400 omdrejninger i minuttet (afhængigt af instrumentet) ved 56 °C for 1 time. Båndrørene nede for at holde dem på plads, hvis det er nødvendigt.
  7. Straks og i samme termoshaker, inaktiver proteinase K med et temperaturskift til 95 °C, mens rystelserfortsætter i yderligere 20 min.
  8. Vortex hver prøve.
  9. Hver prøve anbringes ved -80 °C i mindst 30 min.
  10. Tø op, derefter centrifuge prøverne på 17.000 x g i 1 min på RT til pellet uønskede cellulære fragmenter.
  11. Anbring det DNA-holdige supernatant i et nyt mikrocentrifugerør.
  12. DNA-skabelonen er klar til PCR. DNA-skabelonerne kan opbevares ved -80 °C.

10. RNA-ekstraktion, cDNA-syntese og ddPCR-kvantificering af viralt RNA

  1. Isoler RNA fra optøet museplasma med et rna-isolationssæt til virus efter producentens protokol (Materialetabel).
  2. Efter tilsætning af prøven til kolonnen, tilføje en on-kolonne DNase behandling trin for at sikre fjernelse af alt DNA i plasmaprøven.
    1. For hver prøve tilsættes 95 μL RNase-fri DNase-opløsning (bland 2 μL RNAse-fri DNase og 98 μL reaktionsbuffer) til kolonnen og inkuberes i 15 min. ved RT.
  3. RNA-prøverne opbevares ved -80 °C i mindst 1 time før videreforarbejdning. Det er vigtigt at fryse alle prøver efter RNA-ekstraktion undgå risikoen for bias, når du sammenligner prøver, der ikke er blevet frosset til prøver, der er blevet frosset.
  4. Syntetiseret cDNA ved hjælp af et omvendt transskriptionstrin ved hjælp af reagenser som beskrevet tidligere20. Sørg for at tilsætte 0,5 μL af en RNase-hæmmer til cDNA-reaktionen for at undgå nedbrydning af RNA.
    1. Udfør cDNA-syntese med det program, der er beskrevet i tabel 5.
  5. CDNA-prøverne opbevares ved -80 °C i mindst 1 time. Det er vigtigt at fryse alle prøver efter cDNA-syntese undgå risikoen for bias, når man sammenligner prøver, der ikke er blevet frosset til prøver, der blev frosset.
  6. Prøverne udsaetning til ddPCR som følger20:
    1. 3 μL af cDNA-prøven blandes med 11 μL af ddPCR-sondeblandingen (ingen dUTP)20, 250 nM mindre rillebindende sonde og 900 nM af hver af de forreste og omvendte primere som beskrevet i tabel 6.
    2. Den samlede PCR-volumen justeres til 22 μL med nukleasefrit vand.
  7. Emulgere PCR blandes med dråbegenerationolie til sonder på en dråbegenerator i henhold til producentens protokol og tidligere beskrivelser20.
  8. Kør PCR-programmet som beskrevet i tabel 7.
    BEMÆRK: De primer/ sondesekvenser og PCR-programmer, der vises her, er specielt designet og optimeret til følsom påvisning af hiv-stammen RHPA4259. Primer- og sondesekvenser kan nemt justeres for at opdage enhver anden hiv-stamme efter eget valg.
  9. Registrer dråbefluorescens fra prøverne på en dråbelæser, og analyser resultaterne med passende software i henhold til producentens protokol.

11. Behandling med cART-holdige chow

  1. Fodermus med pellets, der indeholder et standard cART regime, der indeholder 4.800 mg/kg raltegravir (RAL), 720 mg/kg tenofovir disoproxil fumarate (TDF) og 520 mg/kg emtricitabin (FTC)21 (tabel 8). Disse doser blev bestemt under forudsætning af, at en mus vejer 25 g og spiser 4 g chow om dagen. Dette svarer til en daglig dosis på 768 mg/kg RAL, 2,88 mg/kg TDF og 83 mg/kg FTC21.
  2. Brug en cART kost, der er blevet udarbejdet af en ekstern leverandør (Se Tabel over materialer)af receptpligtig medicin. Andre virksomheder kan potentielt også producere denne ordning. Brug en cART kost farvet rød til nemt at skelne det fra almindelige mus chow.
    1. Producere en kontrol chow kost uden cART i en standard brun farve for nem skelnen.
  3. Til indledning af cART, forberede sterile musebure med tilsætning af cART-holdige chow kost, og derefter overføre musene fra det gamle bur til det nye bur.
    1. Overvåg musenes vægt og indtagelse af cART-holdigchow ved visuel inspektion for at sikre, at musene tilpasser sig ændringen.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Gating-strategien for analyse af stamcellerenhed er afbildet i figur 1. Figur 1A-C viser den rensede CD34+ population og figur 1D-F den CD34-gennemstrømning, der bruges til at illustrere, at den minimale mængde af CD34+-populationen går tabt i isolationsprocessen. Renheden af isolerede CD34+ stamceller var mellem 85%-95% med mindre end 1% T-celleforurening. Figur 1G viser CCR5-bånd fra én donor af human kontrol med CCR5Δ32/wt genotype efterfulgt af bånd fra to CCR5wt/wt og en CCR5Δ32/wt stamcelledonorer. Hyppigheden af genotypen CCR5Δ32/wt i en gruppe på 19 donorer var 15,8%(figur 1H). Det sker efter større epidemiologiske undersøgelser14,15 indberetter genotypen hos op til 23,6% af de undersøgte personer i Danmark.

Human CD45 + niveauer i mus perifert blod blev vurderet via flow cytometri 3-5 måneder efter transplantation af menneskelige CD34 + stamceller. Gating-strategien præsenteres i figur 2A-E. Figur 3A og figur 3B illustrerer variabiliteten mellem 10 og 16 individuelle mus, der modtager stamceller fra to forskellige donorer. Transplantation af 75.000 hCD34+ celler gav 20%-50% human CD45+ i det perifere blod. Alle mus udviklede humane B- og T-celler, herunder både CD4- og CD8+ T-celler.

For atraumatisk intravaginal eksponering, opsætningen afbildet i figur 4 blev brugt. Mus blev anæstesiiseret i et lukket kammer og holdt under bedøvelse under eksponeringen. Mus blev holdt med skeden opad i 5 min efter eksponering for at sikre virus løsning engagement med slimhindeoverflader.

Figur 5A viser den 64% hiv-smitte succesrate observeret ved hjælp af denne model. Mus blev udfordret med 21.400 smitsomme enheder (IU) af RHPA4259 intravaginalt. Denne dosis resulterede i, at 64 % af musene blev hiv-smittede efter eksponering af vaginale. Til sammenligning medtages data fra to forskellige kohorter af mus, der eksponeres via en intravenøs rute. Som forventet, 100% af musene blev HIV + med lignende doser af RHPA og en ekstra stamme (YU2) ved hjælp af denne rute.

Figur 5B viser repræsentative resultater fra tre mus, der var inficeret med hiv og skiftede til en kost, der indeholder standard cART. Mus blev skiftet tilbage til almindelig mus chow efter 40 dages cART. I denne analyse opsætning, grænsen for viral belastning detektion var 725 eksemplarer / ml. Viral belastninger var alle under detektionsgrænsen efter 4 ugers cART. Efter ophør af cART, virus rebounded, spejling kliniske data22. Mus på cART tolererede ændringen i kosten samt angivet i figur 5C.

Figure 1
Figur 1: Repræsentativ flowcytometrigatstrategi for validering af stamcellerenhed og CCR5 donorvariantstatus. (A-C) Den gating strategi, der anvendes til den isolerede CD34 + celle population. Doublets og snavs er udelukket i henholdsvis panel A og B (FSC-A vs. FSC-H og FSC-A vs. SSC-A). C) Hyppigheden af CD34+ stamceller og CD3+ T-celleforurening. (D-F) CD34-flow-through gating strategi. Procenter i porte beregnes som en brøkdel af den overordnede population. G) Resultaterne af en CCR5Δ32/wt PCR-analyse. Bane 1: DNA fra en menneskelig CCR5Δ32/wt donor, bane 2 og 3: to CCR5wt /wt menneskelige stamcelledonorer, vognbane 4: En CCR5Δ32/wt menneskelig stamcelledonor. (H) Hyppigheden af genotype CCR5Δ32/wt i vores gruppe af 19 stamcelleprøver er 15,8%. Klik her for at se en større version af denne figur.

Figure 2
Figur 2: Flow cytometri gating strategi for validering af menneskelige celle engraftment og differentiering. Den samlede mononukleare cellepopulation fra humaniserede mus blev analyseret via flowcytometri. (A) Procentdelen af cd45+ celler blev bestemt som en brøkdel af de samlede registrerede hændelser. b) Doublets blev efterfølgende udelukket på grundlag af FSC-A/FSC-H-gating. (C) Den sande lymfocytpopulation blev defineret på grundlag af størrelse og granularitet. (D) Lymfocytter blev derefter karakteriseret som enten CD3 + (T-celler) eller CD19 + (B-celler). (E) CD3+ T-celler var enten CD4+ T-celler eller CD8+ T-celler. Procenter i porte blev beregnet som en brøkdel af den overordnede befolkning. Klik her for at se en større version af denne figur.

Figure 3
Figur 3: Repræsentative humaniseringsniveauer 4-5 måneder efter stamcelletransplantation med cellesubtypefraktioner for 10 og 16 mus fra to forskellige menneskelige donorer. A) Den ennukleare cellepopulation (MNC) fra 10 ogb) 16 humaniserede mus blev analyseret via flowcytometri og gated som vist i figur 2. Den del af cd45+-cellerne fra mennesker præsenteres som %hCD45 (af total MNC) og %B- og %T-celler som en brøkdel af hCD45. T-cellerne blev efterfølgende opdelt i %CD4 og %CD8. Hvert datapunkt repræsenterer én mus. Data præsenteres som middel ± SD. Klik her for at se en større version af dette tal.

Figure 4
Figur 4: Eksperimentel laboratoriebænk opsætning for intravaginal eksponering af mus. Eksperimentel opsætning for hiv-eksponering af humaniserede mus gennem intravaginal rute. Proceduren udføres i en flowbænk, hvor alle reagenser og overflader er blevet steriliseret før brug. Klik her for at se en større version af denne figur.

Figure 5
Figur 5: Overførsel af hiv-stammer gennem forskellige eksponeringsveje og effekten og sikkerheden af cART-holdige chow i viral undertrykkelse. (A) Humaniserede NOG mus blev med succes inficeret med to forskellige stammer af hiv gennem enten intravaginal eller intravenøs rute. Mus blev eksponeret med 21.400 IUs af RHPA4259 intravaginalt, 5.157 IUs IV med RHPA4259, eller 3.000 IUs IV med YU2. Nærmere oplysninger om IV eksponering af humaniserede mus er ikke inkluderet i denne protokol. HIV-infektioner blev behandlet med succes med en cART regime leveret gennem musen chow. (B) Den virale belastning faldt til under påvisning for alle tre mus på cART og rebound opstod efter ophør af cART. Den stiplede linje angiver kvantificeringsgrænse ved 725 kopier/ml. Mus fodret med cART chow havde lignende vægtudvikling som mus til huse på ikke-cART chow i samme periode, hvilket indikerer ingen smag-præference eller bivirkninger af cART kost. C) Vægte præsenteres som foldforandring i forhold til cART's begyndelse. Hvert datapunkt repræsenterer gennemsnitet af tre dyr ± SD. Klik her for at se en større version af dette tal.

Antistofmål Klon Fluorophore
CD3 klon SK7 BUV395
CD34 klon AC136 FITC
CD45 klon 2D1 Apc

Tabel 1: Antistoffer, der anvendes til bestemmelse af stamcellerenhed. Foreslået flerfarvet flow cytometri panel til evaluering af stamcellerenhed. Opført er antistof mål, klon, og fluorophore.

CCR5Δ32-registrering Primere
Fremad primer 5'CTTCATTACACCTGCAGCT'3
Omvendt primer 5'TGAAGATAAGCCTCACAGCC'3

Tabel 2: CCR5Δ32 variant detektion PCR primere. Frem- og tilbagevise primere, der anvendes til påvisning af 32 bp-sletningen i CCR5-genet.

Nej. af cykler 1 45 1
Temperatur (°C) 98 98/63/72 72 10
Tid 30 s. 10 s/30 s/15 s 5 min.

Tabel 3: CCR5Δ32 variant detektion PCR program. PCR cykelprogram, der anvendes til forstærkning af CCR5 genet.

Antistofmål Klon Fluorophore
CD4 kr. BUV 496
CD8 RPA-T8 BV421
CD3 OKT3 FITC
CD19 sj25c1 PE-Cy7
CD45 2D1 Apc

Tabel 4: Antistoffer, der anvendes til bestemmelse af musemenneskeligisering. Foreslået flerfarvet flow cytometri panel til humanisering. Opført er antistof mål, klon, og fluorophore.

Nej. af cykler 1 1
Temperatur (°C) 51 80 4
Tid 45 min. 15 min.

Tabel 5: cDNA forstærkningsprogram. Program, der anvendes til forstærkning af komplementære streng DNA til den virale RNA.

Hiv-kvantificering Primere
Fremad primer 5'AGGGCAGCATAGAGCAAAAA'3
Omvendt primer 5'CAAAGGAATGGGTTCTTTT'3
FAM sonde 5'ATCCCCACTTCAACAGATGC'3

Tabel 6: HIV ddPCR primere. Primere og sonder, der anvendes til ddPCR forstærkning af viral cDNA.

Nej. af cykler 1 39 1
Temperatur (°C) 95 95/54.5 98 4
Tid 10 min. 30 s/1 min. 10 min.

Tabel 7: HIV ddPCR program. PCR cykelprogram, der anvendes til forstærkning af viralRNA.

Raltegravir (RAL) 4800 mg/kg
Tenofovir disoproxil fumarate (TDF) 720 mg/kg
Emtricitabine (FTC) 520 mg/kg

Tabel 8: Mus cART chow kost. Mus chow kost blev formuleret som tidligere offentliggjort21. Chow kost en base af standard mus chow, og efter produktion, maden blev γ-bestrålet med 25 kGy og dobbelt-sække. Chow blev opbevaret ved -20 °C indtil brug.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Den alvorligt immunkompromitterede musestamme NOD. Cg-Prkdcskafil2rgtm1Sug/JicTac (NOG) er særdeles velegnet til transplantation af humane celler og væv. Både medfødte og adaptive immunveje i disse mus er kompromitteret. NOG og NSG mus har en Prkdcskaftmutation, der resulterer i defekt T- og B-cellefunktion. Desuden mangler disse mus en funktionel interleukin-2 receptor γ-kæde (fælles gammakæde, IL2rg), som er uundværlig i de bindende komplekser af mange vigtige cytokiner som IL-2, IL-4, IL-7, IL-9, IL-15 og IL-21. Immundefektmus, såsom NOG, transplanteret med et menneskeligt immunsystem er et kraftfuldt værktøj til studiet af hiv-transmission og immunologi. Bidragene på disse områder , der er foretaget ved hjælp af humaniserede mus , er blevet grundigt gennemgået2,23,24,25,26. Brugen af disse mus til at studere humane medfødte immunrespons får også øget opmærksomhed27,28.

Formålet med dette manuskript er at levere en omfattende protokol af mus og ddPCR procedurer til at gå fra en naiv mus til hiv-transmission og behandling data. Vores system udnyttede ddPCR til kvantificering af viralrna og DNA. I en ddPCR reaktion, er de reaktanter opdelt i op til 20.000 dråber, der hver indeholder en enkelt, separat mikro PCR reaktion. Forstærkningen af et mål inde i en dråbe fører til et positivt fluorescerende signal til den pågældende dråbe. Således, udlæsningen er binær og ved at anvende Poisson statistiske analyser, antallet af positive reaktioner kan direkte oversættes til en række skabelon kopier i den oprindelige prøve. Fordelen ved ddPCR ligger i dets evne til direkte at kvantificere et mål, der er uafhængigt af en standardkurve. Dette er især attraktivt, når man analyserer RNA-prøver, der er udfordrende at bruge som PCR standard kurver på grund af deres labile natur29. Ved at analysere flere kopier af den samme prøve og flette de enkelte datapunkter for den endelige stikprøvekvantificering gør ddPCR's binære karakter det desuden muligt at sænke detektionsgrænsen for skabelonkopier pr. ml prøve29. Dette er især vigtigt i en humaniseret museindstilling, hvor der kun er begrænset prøvemateriale til rådighed, og der kræves høj følsomhed.

Administration af cART til humaniserede mus kan ske enten ved oral sonde eller intraperitoneal injektioner med opløsninger af cART30,31,32, og som vist for nylig, ved formulering i kosten21. Et af vores vigtigste mål var gennemførelsen af en cART regime i musen kost for at reducere potentielle stress på dyrene på grund af de ekstra håndtering skridt iboende i andre lægemiddel leveringsmetoder. Den dosis medicin, som en mus vil spise, kan estimeres nøjagtigt ud fra det gennemsnitlige daglige fødeindtag af musene33. Oral levering gennem kosten fungerer som den nemmeste leveringsrute med både minimal stress for dyret og minimal arbejdsbyrde for handleren. Vi baserede vores kombination af antivirale lægemidler på tidligere offentliggjorte undersøgelser hos humaniserede mus21,30. Desuden er vores cART-strategi klinisk relevant, da den lægemiddelkombination, der anvendes klinisk, administreres oralt af patienter over hele verden.

Visse begrænsninger er noteret med hensyn til brugen af NOG mus. Vigtigere er det, menneskelige T-celler i disse mus dyrkes i en mus thymic miljø, i modsætning til et menneskeligt miljø. Den seneste fokus er på at generere xenorecipient stammer, der har et gunstigt miljø for udviklingen af robuste menneskelige immunrespons. Disse nye stammer omfatter immundefektmus, der er transgene for humane MHC molekyler, såsom A2. Disse modeller muliggør HLA-begrænsede t-cellereaktioner, der resulterer i bedre modnings- og effektorfunktioner i det adaptive immunsystem34. En anden tilgang er at erstatte musegener med vigtige menneskelige cytokiner for IL-3/GM-CSF35, IL-636, IL-1537, TPO, M-CSF38, og IL-7/TSLP31. Sådanne modeller har fået øget opmærksomhed for deres evne til at generere bedre differentiering af medfødte celletyper. Vores protokol er let at tilpasse til humanisering og hiv-infektion af mus ved hjælp af en sådan forbedret genetisk baggrund immundefekt stamme.

Sammenfattende letter den beskrevne fremgangsmådes lethed og nytte forskning på hiv-relaterede områder in vivo. Humaniserede mus kan være et meget kraftfuldt redskab til at lede forskning i retning af at skabe bedre forskning hypoteser. Sammen med dannelsen af mere "humaniserede" mus med menneskelige transgener, mener vi, at vores standardiserede protokol vil bidrage til strømlining af eksperimentelle procedurer på tværs af forskellige forskningsmiljøer.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne erklærer ingen interessekonflikter.

Acknowledgments

Forfatterne vil gerne takke Biomedicine Animal Facility personale på Aarhus Universitet, især Jani Kær for koloni vedligeholdelse indsats og for sporing mus vægte. Forfatterne vil gerne takke professor Florian Klein for at udvikle standard-of-care cART og for vejledning. Følgende reagens blev opnået gennem NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: pRHPA.c/2635 (kat # 11744) fra Dr. John Kappes og Dr. Christina Ochsenbauer.

Materials

Name Company Catalog Number Comments
Blue pad VWR 56616-031 Should be sterilized prior to use
Bovine serum albumin (BSA) Sigma A8022
CD19 (clone sj25c1) PE-Cy7 BD Bioscience 557835
CD3 (clone OKT3) FITC Biolegend 317306
CD3 (clone SK7) BUV395 BD Bioscience 564001
CD34 (clone AC136) FITC Miltenyi 130-113-740
CD4 (clone SK3) BUV 496 BD Bioscience 564652/51
CD45 (clone 2D1) APC Biolegend 368511/12
CD8 (clone RPA-T8) BV421 BD Bioscience 562428
ddPCR Supermix for probes (no dUTP) Bio-Rad 1863025
DMSO Merck 10,02,95,21,000
DNAse Sigma D4263 For suspension buffer
dNTP mix Life Technologies R0192
Dulbeccos phosphate-buffered saline (PBS) Biowest L0615-500
EasySep Human Cord Blood CD34 Positive Selection Kit II Stemcell 17896
EDTA Invitrogen 15575-038
FACS Lysing solution 10X BD 349202 Dilute 1:10 in dH20 immediately before use
FACS tubes (Falcon 5 mL round-botton) Falcon 352052
Fc Receptor blocking solution (Human Trustain FcX) Biolegend 422302
Fetal bovine serum Sigma F8192-500
Ficoll-Paque PLUS GE Healthcare 17144002
Flowjo v.10
Gauze Mesoft 157300 Should be sterilized prior to use
Heating lamp Custom made
Hemacytometer (Bürker-Türk) VWR DOWC1597418
Isoflurane gas Orion Pharma 9658
LSR Fortessa X20 flow cytometer BD
Microcentrifuge tubes, PCR-PT approved Sarstedt 72692405
Mouse cART food ssniff Spezialdiäten GmbH Custom made product
Mouse restrainer Custom made product
Needle, Microlance 3, 30G ½" BD 304000
NOG mice NOD.Cg-Prkdcscid Il2rgtm1Sug/JicTac Taconic NOG-F
Nuclease-free water VWR chemicals 436912C
Nucleospin 96 Virus DNA and RNA isolation kit Macherey-Nagel 740691
PCR-approved microcentrifuge tubes Sarstedt 72.692.405
Penicillin-Streptomycin solution 100X Biowest L0022-100
Phusion Hot Start II DNA polymerase Life Technologies F549S
Pipette tips, sterile, ART 20P Barrier ThermoScientific 2149P
Proteinase K NEB 100005398
QuantaSoft software Bio-Rad
QX100 Droplet Generator Bio-Rad 1886-3008
QX100 Droplet Reader Bio-Rad 186-3003
RBC lysis solution Biolegend 420301
RNase-free DNAse size F + reaction buffer Macherey-Nagel 740963
RNAseOUT Recombinant Ribonuclease inhibitor ThermoScientific 10777-019
RPMI Biowest L0501-500 Dissolve in H20
Softject 1 mL syringe Henke Sass Wolf 5010-200V0
Superscript III Reverse Transcriptase ThermoFisher Scientific 18080044
Thermoshaker VWR 89370-910
Trypane blue Sigma T8154
Ultrapure 0.5 EDTA, pH 8.0 ThermoFisher Scientific 15575-020
Virkon S (virus disinfectant) Dupont 7511

DOWNLOAD MATERIALS LIST

References

  1. WHO. GHO | By category | Antiretroviral therapy coverage - Data and estimates by WHO region (2018). World Health Organization. Available from: http://apps.who.int/gho/data/node.main.626 (2018).
  2. Skelton, J. K., Ortega-Prieto, A. M., Dorner, M. A Hitchhiker's guide to humanized mice: new pathways to studying viral infections. Immunology. 154, (1), 50-61 (2018).
  3. Denton, P. W., Krisko, J. F., Powell, D. A., Mathias, M., Kwak, Y. T. Systemic Administration of Antiretrovirals Prior to Exposure Prevents Rectal and Intravenous HIV-1 Transmission in Humanized BLT Mice. PLoS ONE. 5, (1), 8829 (2010).
  4. Zou, W., et al. Nef functions in BLT mice to enhance HIV-1 replication and deplete CD4 + CD8 + thymocytes. Retrovirology. 9, (1), 44 (2012).
  5. Berges, B. K., Akkina, S. R., Folkvord, J. M., Connick, E., Akkina, R. Mucosal transmission of R5 and X4 tropic HIV-1 via vaginal and rectal routes in humanized Rag2 -/- γc -/- (RAG-hu) mice. Virology. 373, (2), 342-351 (2008).
  6. Veselinovic, M., Charlins, P., Akkina, R. Modeling HIV-1 Mucosal Transmission and Prevention in Humanized Mice. Methods Mol Biol. 203-220 (2016).
  7. Neff, C. P., Kurisu, T., Ndolo, T., Fox, K., Akkina, R. A topical microbicide gel formulation of CCR5 antagonist maraviroc prevents HIV-1 vaginal transmission in humanized RAG-hu mice. PLoS ONE. 6, (6), 20209 (2011).
  8. Neff, P. C., Ndolo, T., Tandon, A., Habu, Y., Akkina, R. Oral pre-exposure prophylaxis by anti-retrovirals raltegravir and maraviroc protects against HIV-1 vaginal transmission in a humanized mouse model. PLoS ONE. 5, (12), 15257 (2010).
  9. Veselinovic, M., et al. HIV pre-exposure prophylaxis: Mucosal tissue drug distribution of RT inhibitor Tenofovir and entry inhibitor Maraviroc in a humanized mouse model. Virology. 464-465, 253-263 (2014).
  10. Akkina, R., et al. Humanized Rag1-/-γc-/- mice support multilineage hematopoiesis and are susceptible to HIV-1 infection via systemic and vaginal routes. PLoS ONE. 6, (6), 20169 (2011).
  11. Zhou, J., et al. Systemic administration of combinatorial dsiRNAs via nanoparticles efficiently suppresses HIV-1 infection in humanized mice. Molecular Therapy. 19, (12), 2228-2238 (2011).
  12. Balcombe, J. P., Barnard, N. D., Sandusky, C. Laboratory routines cause animal stress. Contemporary Topics in Laboratory Animal Science. 43, (6), 42-51 (2004).
  13. Trecarichi, E. M., et al. Partial protective effect of CCR5-Delta 32 heterozygosity in a cohort of heterosexual Italian HIV-1 exposed uninfected individuals. AIDS Research and Therapy. 3, (1), (2006).
  14. Novembre, J., Galvani, A. P., Slatkin, M. The geographic spread of the CCR5 Δ32 HIV-resistance allele. PLoS Biology. 3, (11), 1954-1962 (2005).
  15. Solloch, U. V., et al. Frequencies of gene variant CCR5-Δ32 in 87 countries based on next-generation sequencing of 1.3 million individuals sampled from 3 national DKMS donor centers. Human Immunology. 78, (11-12), 710-717 (2017).
  16. Ochsenbauer, C., et al. Generation of Transmitted/Founder HIV-1 Infectious Molecular Clones and Characterization of Their Replication Capacity in CD4 T Lymphocytes and Monocyte-Derived Macrophages. Journal of Virology. 86, (5), 2715-2728 (2012).
  17. Andersen, A. H. F., et al. Long-Acting, Potent Delivery of Combination Antiretroviral Therapy. ACS Macro Letters. 7, (5), 587-591 (2018).
  18. Caro, A. C., Hankenson, F. C., Marx, J. O. Comparison of thermoregulatory devices used during anesthesia of C57BL/6 mice and correlations between body temperature and physiologic parameters. Journal of the American Association for Laboratory Animal Science JAALAS. 52, (5), 577-583 (2013).
  19. Gatlin, J., Padgett, A., Melkus, M. W., Kelly, P. F., Garcia, J. V. Long-term engraftment of nonobese diabetic/severe combined immunodeficient mice with human CD34+ cells transduced by a self-inactivating human immunodeficiency virus type 1 vector. Human Gene Therapy. 12, (9), 1079-1089 (2001).
  20. Leth, S., et al. HIV-1 transcriptional activity during frequent longitudinal sampling in aviremic patients on antiretroviral therapy. AIDS. 30, (5), 713-721 (2016).
  21. Halper-Stromberg, A., et al. Broadly neutralizing antibodies and viral inducers decrease rebound from HIV-1 latent reservoirs in humanized mice. Cell. 158, (5), 989-999 (2014).
  22. Rothenberger, M. K., et al. Large number of rebounding/founder HIV variants emerge from multifocal infection in lymphatic tissues after treatment interruption. Proceedings of the National Academy of Sciences. 112, (10), 1126-1134 (2015).
  23. Rongvaux, A., et al. Human Hemato-Lymphoid System Mice: Current Use and Future Potential for Medicine. Annual Review of Immunology. 31, (1), 635-674 (2013).
  24. Walsh, N. C., et al. Humanized Mouse Models of Clinical Disease. Annual Review of Pathology: Mechanisms of Disease. 12, (1), 187-215 (2017).
  25. Denton, P. W., García, J. V. Humanized mouse models of HIV infection. AIDS Reviews. 13, (3), 135-148 (2011).
  26. Denton, P. W., Søgaard, O. S., Tolstrup, M. Using animal models to overcome temporal, spatial and combinatorial challenges in HIV persistence research. Journal of Translational Medicine. 14, (1), (2016).
  27. Andersen, A. H. F., et al. cAIMP administration in humanized mice induces a chimerization-level-dependent STING response. Immunology. 157, (2), 163-172 (2019).
  28. Tanaka, S., et al. Development of Mature and Functional Human Myeloid Subsets in Hematopoietic Stem Cell-Engrafted NOD/SCID/IL2r KO Mice. The Journal of Immunology. 188, (12), 6145-6155 (2012).
  29. Quan, P. L., Sauzade, M., Brouzes, E. DPCR: A technology review. Sensors (Switzerland). 18, (4), (2018).
  30. Denton, P. W., et al. Generation of HIV Latency in Humanized BLT Mice. Journal of Virology. 86, (1), 630-634 (2012).
  31. Li, Y., et al. A human immune system mouse model with robust lymph node development. Nature Methods. 15, (8), 623-630 (2018).
  32. Satheesan, S., et al. HIV Replication and Latency in a Humanized NSG Mouse Model during Suppressive Oral Combinational Antiretroviral Therapy. Journal of Virology. 92, (7), 02118 (2018).
  33. Bachmanov, A. A., Reed, D. R., Beauchamp, G. K., Tordoff, M. G. Food intake, water intake, and drinking spout side preference of 28 mouse strains. Behavior Genetics. 32, (6), 435-443 (2002).
  34. Shultz, L. D., et al. Generation of functional human T-cell subsets with HLA-restricted immune responses in HLA class I expressing NOD/SCID/IL2r null humanized mice. Proceedings of the National Academy of Sciences. 107, (29), 13022-13027 (2010).
  35. Willinger, T., et al. Human IL-3/GM-CSF knock-in mice support human alveolar macrophage development and human immune responses in the lung. Proceedings of the National Academy of Sciences. 108, (6), 2390-2395 (2011).
  36. Hanazawa, A., et al. Generation of human immunosuppressive myeloid cell populations in human interleukin-6 transgenic NOG mice. Frontiers in Immunology. 9, FEB (2018).
  37. Huntington, N. D., et al. IL-15 trans-presentation promotes human NK cell development and differentiation in vivo. The Journal of Experimental Medicine. 206, (1), 25-34 (2009).
  38. Rongvaux, A., et al. Development and function of human innate immune cells in a humanized mouse model. Nature Biotechnology. 32, (4), 364-372 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics