Humaniserte NOG-mus for intravaginal HIV-eksponering og behandling av HIV-infeksjon

JoVE Journal
Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Vi har utviklet en protokoll for generering og evaluering av en humanisert og human immunsvikt virus-infisert NOG musemodell basert på stamcelletransplantasjon, intravaginal humant immunsvikt virus eksponering, og droplet digital PCR RNA Kvantifisering.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Andersen, A. H. F., Nielsen, S. S. F., Olesen, R., Mack, K., Dagnæs-Hansen, F., Uldbjerg, N., Østergaard, L., Søgaard, O. S., Denton, P. W., Tolstrup, M. Humanized NOG Mice for Intravaginal HIV Exposure and Treatment of HIV Infection. J. Vis. Exp. (155), e60723, doi:10.3791/60723 (2020).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Humaniserte mus gir en sofistikert plattform for å studere humant immunsviktvirus (HIV) virologi og for å teste antivirale legemidler. Denne protokollen beskriver etableringen av et menneskelig immunsystem hos voksne NOG-mus. Her forklarer vi alle de praktiske trinnene fra isolering av navlestrengblod avledet humane CD34+ celler og deres påfølgende intravenøstransplantasjon i musene, til manipulering av modellen gjennom HIV-infeksjon, kombinasjon antiretroviral behandling ( cART), og blodprøvetaking. Omtrent 75 000 hCD34+ celler injiseres intravenøst i musene og nivået av menneskelig chimerisme, også kjent som humanisering, i perifert blod er estimert langsgående i måneder ved flyt cytometri. Totalt 75 000 hCD34+-celler gir 20 %–50 % humane CD45+-celler i perifert blod. Musene er utsatt for intravaginal infeksjon med HIV og blod kan prøves en gang i uken for analyse, og to ganger månedlig i lengre perioder. Denne protokollen beskriver en analyse for kvantifisering av plasma virusbelastning ved hjelp av droplet digital PCR (ddPCR). Vi viser hvordan musene effektivt kan behandles med et standard-of-care cART diett i kostholdet. Levering av cART i form av vanlig mus chow er en betydelig raffinement av eksperimentell modell. Denne modellen kan brukes til preklinisk analyse av både systemiske og aktuelle pre-eksponering profylakse forbindelser samt for testing av nye behandlinger og HIV kur strategier.

Introduction

Humant immunsviktvirus (HIV) er en kronisk infeksjon med mer enn 37 millioner infiserte personer over heleverden. Kombinasjon antiviral terapi (cART) er en livreddende terapi, men en kur er fortsatt berettiget. Dermed er det behov for dyremodeller som speiler det menneskelige immunforsvaret og dets svar for å lette fortsatt forskning på HIV. Flere typer humaniserte mus som er i stand til å støtte celle- og vevsengraftment, er utviklet ved å transplantere menneskelige celler til alvorlig immundeficient mus2. Slike humaniserte mus er utsatt for HIV-infeksjon og gir et viktig alternativ til ikke-humane primatsimiane immunsviktvirusmodeller, da de er billigere og enklere å bruke enn ikke-menneskelige primater. Humaniserte mus har tilrettelagt forskning i HIV viral overføring, patogenesen, forebygging, og behandling3,4,5,6,7,8,9,10,11.

Vi presenterer et fleksibelt humanisert modellsystem for HIV-forskning utviklet ved å transplantere ledningsblod avledet menneskelige stamceller til mus i NOD. Cg-PrkdcscidIl2rgtm1Sug/JicTac (NOG) bakgrunn. Foruten å være av ikke-føtal opprinnelse, er den praktiske bioengineering av disse musene mindre teknisk krevende i forhold til mikrokirurgiske prosedyrer involvert i transplantasjon av blodlever-thymus (BLT) konstruksjon.

Vi viser hvordan du etablerer HIV-infeksjon gjennom intravaginal overføring og hvordan du overvåker plasma virusbelastningen med en sensitiv dråpe digital PCR (ddPCR)-basert oppsett. Deretter beskriver vi etableringen av standard cART gitt som en del av det daglige musedietten. Målet med disse kombinerte metodene er å redusere stress for dyrene og legge til rette for store eksperimenter der tid brukt håndtering av hvert dyr er begrenset12.

Hos mennesker forårsaker en CCR5Δ32/wt eller CCR5Δ32/ Δ32 genotype redusert følsomhet for HIV-infeksjon med sender/grunnleggervirus13, og noen forholdsregler må tas når bioengineering humaniserte mus med stamceller med det formål med HIV-studier. Dette gjelder spesielt i vår region fordi naturlig forekommende varianter i CCR5 genet, spesielt Δ32 slettinger, er mer utbredt i skandinaviske og baltiske innfødte populasjoner sammenlignet med resten av verden14,15. Dermed inkluderer vår protokoll en enkel, høy gjennomstrømningsanalyse for screening av donorhematopoetiske stamceller for CCR5-varianter før transplantasjon.

For intravaginal eksponering valgte vi senderen/grunnleggeren R5 virus RHPA4259, isolert fra en kvinne i et tidlig stadium av infeksjon som ble smittet intravaginalt16. Vi utsatte musene for en virusdose som var tilstrekkelig til å gi vellykket overføring i de fleste mus, men under en 100% overføringshastighet. Valg av en slik dose muliggjør et tilstrekkelig dynamisk område i overføringshastigheten slik at antivirale effekter av en legemiddelkandidat kan resultere i beskyttede dyr i HIV-forebyggende eksperimenter og redusert virusbelastning for behandlingsstudier.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alle ledningsblodprøver ble innhentet i henhold til lokalt godkjente protokoller, inkludert informert samtykke om anonym donasjon av foreldrene. Alle dyreforsøk ble godkjent og utført i henhold til danske nasjonale forskrifter i henhold til lisensen 2017-15-0201-01312.

FORSIKTIG: Håndter HIV-eksponerte mus og blod med ekstrem forsiktighet. Dekontaminer alle overflater og væsker som har vært i kontakt med HIV med et bekreftet HIV-desinfeksjonsmiddel (Materialtabell).

1. Isolasjon av humane CD34+ stamceller

  1. Samle ledning blodprøver i EDTA-belagt blod samling rør etter planlagt keisersnitt eller vaginal fødsler og i henhold til lokale etiske godkjenninger.
  2. Isolere PMBCer fra ledningsblod ved tetthetsgradering i henhold til produsentens protokoll.
  3. Isolere CD34 + celler fra PBMC befolkningen ved først pre-berikende med antistoffer mot vanlige markører for modne celler, som induserer krysslinking av celler av uønskede linjer med røde blodlegemer. Dette etterfølges av CD34+ celleberikelse ved hjelp av magnetiske perler, i henhold til produsentens protokoll.
    1. Bestem antall levende celle ved standard trypan blå eksklusjon ved å suspendere 10 μL cellesuspensjon i 90 μL trypan blå. Legg til 10 μL av denne løsningen til et hemacytometer og telle ikke-blå celler, i henhold til produsentens protokoll.
    2. Levedyktig kryobevarCD34 + celler i 1 ml 10% DMSO i føtal storfe serum (FBS) til dagen for musetransplantasjon.
    3. Levedyktig kryobevar er en liten brøkdel av både isolert (CD34+) og gjennomstrømningsceller (CD34-) separat for vurdering av CD34+ stamcellerenhet (~ 30 000 celler i hver prøve). Alternativt kan du teste renheten på nyberikede celler (se trinn 2 nedenfor).
    4. Frys en brøkdel av ikke-pelleted flow-through (CD34-) for fastsettelse av CCR5Δ32 status. Celler kan fryses direkte uten betinget fryseløsning, men tilstedeværelsen av røde blodlegemer i pelletkan hemme den påfølgende PCR hvis gjennomstrømningen er pelleted.

2. Vurdering av CD34+ stamcellerenhet via flow cytometri

  1. Tin de isolerte cellene (CD34+) og gjennomstrømningsceller (CD34-). Vask cellene ved å resuspendere cellene fra hvert hetteglass i 9 ml romtemperatur (RT) FACS-buffer, bestående av 2% føtal storfeserum (FBS) i fosfatbufret saltvann (PBS).
  2. Sentrifuge i 5 min ved 300 x g ved RT til pelletceller.
  3. Hell av supernatanten, resuspender cellene i gjenværende væske og overfør til FACS-rør. Gjenta vasketrinnet med 3 ml FACS-buffer. Etter den andre sentrifugeringen, hell av supernatanten og resuspendere cellene i den gjenværende væsken.
  4. Tilsett 5 μL fc reseptor blokkering løsning (Tabell over materialer) og la stå i 10 min på RT. Ikke vask av Fc Receptor blokkering løsning.
  5. Legg til blandingen som inneholder forhåndsbestemte mengder antistoffer mot human CD3 (klone SK7) BUV395, CD34 (klone AC136), FITC og CD45 (klone 2D1) APC (Tabell 1). La cellene stå i 30 min på RT i mørket. Fluoropforene må velges basert på parametere som kan vurderes med tilgjengelige strømningscytometre uten å kreve en kompensasjonsmatrise.
  6. Vask cellene med 3 ml FACS-buffer.
  7. Sentrifuge i 5 min ved 300 x g ved RT for å pellet cellene.
  8. Hell av supernatanten og resuspender cellene i den gjenværende væsken.
    1. Gjenta dette vasketrinn2xfor å sikre at alle ubundne antistoffer er fjernet.
  9. Ta opp prøvene på flytcytometeret (Materialtabell)og utfør dataanalyse med riktig programvare. Gating-strategien presenteres i figur 1A–F.

3. Genetisk screening for CCR5Δ32-varianter i ledningsblod

  1. Inkuber 1,25 μL ikke-pelleted flow-through med 11,25 μL PCR-blanding som inneholder 200 μM dNTP mix, 0,01 U /μL high fidelity DNA polymerase, og de fremre og omvendte primere beskrevet i tabell 2.
    1. Juster volumet med kjernefritt vann til ca. 12,5 μL for hver PCR-reaksjon.
  2. Forsterk genomiske fragmenter med PCR-sykkelprogrammet som er beskrevet i tabell 3.
  3. Skill PCR-produktene på en 2% agarose gel13.
    1. PCR-produkter fra de ville typeallelene og Δ32-allelene gir PCR-fragmenter av henholdsvis 196 basispar og 164 baseparbånd, noe som gjør dem lett skilles av gelelektroforese13 (Figur 1G).

4. Intravenøs stamcelletransplantasjon

MERK: Å ha en person forberede cellene i laboratoriet og en annen person forberede musene og arbeidsområdet for transplantasjoner er en effektiv tilnærming.

  1. I et dyreanlegg, 4-6 timer før den planlagte transplantasjonen av stamcellene, bestråle 6-7 uke gamle kvinnelige NOD. Cg-Prkdcscid Il2rgtm1Sug/JicTac (NOG) mus(Materialtabell)med 0,75 Gy med cs137 kilde. Den beste prekondisjoneringsdosen kan variere avhengig av musealder, strålingskilde og andre faktorer. Denne prosessen forholder dyrene for vellykket engraftment med menneskelige stamceller.
  2. I et dyreanlegg, forberede flytbenk arbeidsområdeog alle reagenser før du bringer musene eller cellene inn i arbeidsområdet.
    1. Plasser en steril blå pute for å dekke arbeidsflaten på strømningsbenken. Forbered steril tbind og en beholder med skarpe gjenstander.
    2. Plasser en varmelampe desinfisert med 70% etanol i strømningsbenken med et tomt sterilt musebur under varmen.
  3. I laboratoriet kan du tine isolerte CD34+-celler og fortynne dem i 9 ml av 37 °C vanlig RPMI.
  4. Sentrifuge cellene ved 350 x g i 5 min ved RT, kast supernatanten ved aspirasjon, og resuspender pellet i 1 ml vanlig RPMI ved 37 °C.
  5. Bestem celletallet ved å prøve blå eksklusjon, og juster volumet til 200 μL per mus. Gjør ekstra for å ta hensyn til mulig tap på grunn av de påfølgende håndteringstrinnene.
    1. Forbered deg på å transplantere 75 000 CD34+ celler per 200 μL i hver mus.
    2. Cellene kan holdes ved 4 °C under transport til dyreanlegget før transplantasjonen. Unngå å holde cellene på is for å redusere aggregering eller klumping.
  6. I dyreanlegget, ta buret med musene inn i strømningsbenken og overfør musene til buret under varmelampen for å utvide blodkarene. La den ene enden av buret være borte fra varmekilden slik at musene kan bevege seg bort fra varmen ved å bli varme. Mus som har flyttet til enden av buret, vekk fra varmekilden, er tilstrekkelig varme for en vellykket haleveneinjeksjon.
  7. Legg en 1 ml smurt sprøyte til over 800 μL-merket med suspenderte CD34+-celler. Ved hjelp av en smurt 1 ml sprøyte vil dramatisk lette intravenøs injeksjon og øke presisjonen av denne teknikken.
  8. Fest en 30 G 13 mm kanyle og klargjør kanylen og sprøyten til injeksjon. Denne rekkefølgen av operasjonen gjør det mulig for sprøyten å bli lastet raskere samtidig som integriteten til cellene skal transplanteres gitt mulig skade som kan oppstå under rask aspirasjon av celler gjennom en så liten målernål. Fyll nåløyet med væske ved å trykke på stempelet og fjern væsken ned til 200 μL-merket på nålen.
  9. Plasser en oppvarmet mus (trinn 4.6) i et tilbakeholdelsesprogram som brukes til å gi IV injeksjoner. Injiser forsiktig 200 μL av cellesuspensjonen i musens halevene. Tilbring 2 s utføre stupet og holde nålen satt inn i ca 2 s etter ferdigstillelse av injeksjonen. Dette sikrer at cellene har migrert tilstrekkelig langt fra injeksjonsstedet før fjerning av nålen.
  10. Etter behov, tørk musehalen med sterilgasbind for å fjerne synlig blod. Sett musen tilbake i sitt ikke-oppvarmede hjemmebur. Gjenta injeksjonsprosedyren med de gjenværende musene.

5. Blodinnsamling og behandling for analyse

MERK: Human celleengraftment i perifert blod kan evalueres via flow cytometri 3–5 måneder etter human stamcelletransplantasjon.

  1. Tegn blodprøver fra musene ved hjelp av lokale IACUC-godkjente teknikker.
  2. Samle maksimalt 70–100 μL totalt blod i sterile PCR mikrocentrifugerør som inneholder 10 μL 0,5 M EDTA (pH = 8,0) for å unngå koagulering av blod.

6. Evaluering av menneskelig engraftment via flow cytometri

  1. Overfør 40–50 μL blod til FACS-rør.
  2. Tilsett 5 μL fc reseptor blokkering løsning for å hindre uspesifikk binding av antistoffer og la stå i 10 min på RT.
  3. Tilsett musen anti-human antistoff blanding som inneholder CD4 (klone SK3) BUV 496, CD8 (klone RPA-T8) BV421, CD3 (klone OKT3) FITC, CD19 (klone sj25c1) PE-Cy7, CD45 (klone 2D1) APC (Tabell 4) og la det flekke i mørket ved RT i 30 min. Fluorophores må velges basert på parametere som kan vurderes med tilgjengelige flytcytometre uten å kreve kompensasjonmatrise.
  4. Tilsett 2 ml av en passende røde blodlegemer lysing buffer til hvert rør for å lyse de røde blodlegemene. Bruk en lysisbuffer spesielt formulert for antistofffarging før rødblodslyse (et egnet eksempel er gitt i materialbordet). Vortex kort for å sikre lik fordeling av cellene i lysing løsningen og la stå i 10 min på RT. Lik fordeling av cellene er viktig.
  5. Tilsett 2 ml FACS-buffer for å stoppe lysisreaksjonen.
  6. Sentrifuge i 5 min ved 300 x g ved RT for å pellet cellene.
  7. Hell av supernatant og vortex forsiktig til cellene er suspendert på nytt.
  8. Tilsett 3 ml FACS buffer og sentrifuge i 5 min ved 300 x g ved RT.
  9. Hell av supernatant og resuspender cellene.
  10. Ta opp prøvene på et passende flytcytometer og analyser ved hjelp av riktig programvare (Materialtabell). Representative analyse og resultater er avbildet i figur 2 og figur 3.

7. Intravaginal HIV-eksponering

MERK: Viruset som brukes til intravaginal eksponering av musene kan produseres ved hjelp av tidligere publiserte protokoller17. Viruset holdes ved -80 °C og transporteres mellom steder mens det lagres på tørris etter lokalt godkjente protokoller. Viruset lagres på tørris til umiddelbart før eksponering av musene. Viruset kan fortynnes til vanlig RPMI (unngå RPMI som har antibiotika eller serumtilsetningsstoffer) for å oppnå riktig konsentrasjon umiddelbart før eksponering (21 400 IUs ble brukt til denne IVAG-eksponeringen). Når den er generert, holde den fortynnede aksjen på våt is gjennom hele prosedyren for å unngå fryse-tine sykluser som ville oppstå hvis det fortynnede viruset ble plassert tilbake på tørris når tint.

  1. Forbered alt utstyr og flytbenkarbeidsområdesom presenteres i figur 4 før du tar musene eller viruset inn i strømningsbenken (tilsvarende trinn 4.2).
    1. Plasser varmelampen si i midten av arbeidsområdet der musen vil bli plassert under HIV-eksponeringsprosedyren. Varmelampen sikrer ingen reduksjon i kroppstemperaturen til musene. Annet utstyr som styrer temperaturen kan også brukes, (f.eks. en oppvarmet gelpute eller et sirkulerende varmt vannteppe, i henhold til lokale IACUC-forskrifter18).
    2. Ta med sterile 20 μL pipettespisser og en passende pipette inn i benken. Plasser en beholder med flytende desinfeksjonsmiddel (Materialtabell) på benken for umiddelbar inaktivering av materialer og væsker som har vært i kontakt med viruset.
  2. Plasser en mus i et kammer med 3% isoflurangass og papirhåndklær. Denne prosentandelen av gass vil bedøve dyrene innen 2-4 min. Som med alle andre materialer som brukes sammen med immundeficient mus, må anestesiapparatet desinfiseres riktig før bruk.
  3. Når du er bedøvet, overfør musen til en steril blå pute under varmelampen. Sett musesnuten inn i en maske som leverer kontinuerlig 3% isoflurangass for å opprettholde anestesi. Hold musen på bunnen av halen, magen vendt opp, med hånden som støtter musen tilbake som avbildet i figur 4.
  4. Med en steril pipettespiss stimulerer du kjønnsområdet ved å forsiktig stryke oppover mot anusfor å indusere tømming av endetarmen, og lindre trykket på skjeden.
  5. Forsiktig blotte vaginal åpningen ved å pakke musehalen over fingrene slik at vulva naturlig åpnes, kanskje med liten nudging ved hjelp av en steril pipette tips.
  6. Endre pipettespissen og pipetten 20 μL virus atraumatiskinn i museskjeden uten å lage bobler. Ikke sett spissen dypt inn i skjeden. Snarere, med vulva åpnet, plasser pipettespissen på nivået av vaginalåpningen, unngå å gå dypere for å eliminere potensialet for slitasje under inokulasjonsprosessen, slipp viruset, og la tyngdekraften trekke viruset inn i skjeden. Alternativt kan du bruke en 22 G 1,25 mm blunt-end, rett nål, som beskrevet i Veselinovic et al.6.
  7. Behold musen i denne posisjonen med skjeden vendt opp i 5 minutter etter eksponering for å unngå tyngdekraften-indusert lekkasje av virussuspensjonen.
    1. Legg musen forsiktig inn i hjemmeburet, og pass på å plassere musen på ryggen.

8. Behandling av blodprøver før virusbelastningsanalyse

  1. Samle blod som beskrevet i avsnitt 5 ovenfor.
  2. Sentrifuge blodprøvene i 5 min ved 500 x g ved RT for å skille plasma og celler.
  3. Samle 40 μL plasma for virusbelastningsmåling i et nytt sterilt PCR-godkjent mikrocentrifugerør og oppbevar esler ved -80 °C i minst 1 time til videre behandling. Det er viktig å fryse alle prøver før RNA-ekstraksjon for å unngå risikoen for skjevhet fra å sammenligne RNA-nivåer i prøver som ikke har vært frosset før RNA-isolasjon til prøver frosset før RNA-isolasjon.
  4. Juster volumet av blod tilbake til det opprinnelige volumet ved å legge til 40 μL suspensjon media (PBS med 2,5% storfe serum albumin, 50 U / ml penicillin G og streptomycin, og 10 U / ml DNase, sterilt-filtrert på 0,22 μm).
  5. Overfør 15 μL av det justerte blodvolumet til et nytt PCR-godkjent mikrocentrifugerør.
  6. Tilsett 1 ml 1x RBC lysis oppløsning (Materialtabell),vortex og inkuber i 10 min ved RT.
  7. Sentrifuge i 1 min ved 9600 x g ved RT til pelletceller.
  8. Aspirer supernatant og la bare den lille hvite cellen pellet, fordi røde blodlegemer forurensning kan hemme PCR.
  9. Oppbevar pellet ved -80 °C i minst 1 t til videre behandling.
    MERK: Eventuelt kan eventuell gjenværende blod fra trinn 8.4 brukes til flow cytometrianalyse, som beskrevet ovenfor i trinn 6.

9. DNA-ekstraksjon ved hjelp av en proteinase K ekstraksjonsmetode

  1. Trekk ut DNA fra perifere cellepellets (generert i trinn 8.8) ved hjelp av en proteinase K ekstraksjonsmetode som beskrevet nedenfor. Denne metoden har blitt vist å trekke ut den høyeste DNA-utbyttefra et lite volum blod som det som kreves for serieblodsamlinger som benyttes i denne studien19.
  2. Tilsett 25 μL proteinase K (20 μg/ml) til 1 ml 0,1 m tris buffer.
  3. Vortex proteinase K-løsningen kort.
  4. Tilsett 50 μL av proteinase K-oppløsningen til hver cellepellet som skal fordøyes.
  5. Bland ved å pipettere opp og ned og bekreft resuspensjonen av cellepelleten.
  6. Rist på en termoshaker (Materialtabell) ved 400 o/min (avhengig av instrumentet) ved 56 °C i 1 t. Taperør nede for å holde dem på plass, om nødvendig.
  7. Umiddelbart og i samme termoshaker, inaktiverproteinase K med et temperaturskifte til 95 °C mens ristingen fortsetter i ytterligere 20 min.
  8. Vortex hver prøve.
  9. Plasser hver prøve ved -80 °C i minst 30 min.
  10. Tin, deretter sentrifuge prøvene på 17.000 x g i 1 min på RT for å pellet uønskede cellulære fragmenter.
  11. Plasser DNA-inneholdende supernatant i et nytt mikrocentrifugerør.
  12. DNA-malen er klar for PCR. DNA-malene kan lagres ved -80 °C.

10. RNA ekstraksjon, cDNA-syntese og ddPCR kvantifisering av viral RNA

  1. Isolere RNA fra tint mus plasma med et virus RNA isolasjon kit etter produsentens protokoll (Table of Materials).
  2. Etter tilsetning av prøven i kolonnen, legg til et on-column DNase behandlingstrinn for å sikre fjerning av alt DNA i plasmaprøven.
    1. For hver prøve tilsett 95 μL RNase-fri DNase-oppløsning (bland 2 μL RNAse-fri DNase og 98 μL reaksjonsbuffer) i kolonnen og inkubator i 15 min ved RT.
  3. Oppbevar RNA-prøvene ved -80 °C i minst 1 t før videre behandling. Det er viktig å fryse alle prøver etter RNA-ekstraksjon, unngår risikoen for skjevhet ved sammenligning av prøver som ikke har vært frosset til prøver som var frosset.
  4. Syntetiser cDNA ved hjelp av et omvendt transkripsjonstrinn ved hjelp av reagenser som beskrevet tidligere20. Sørg for å legge til 0,5 μL av en RNase-hemmer til cDNA-reaksjonen for å unngå nedbrytning av RNA.
    1. Utfør cDNA-syntese med programmet som er beskrevet i tabell 5.
  5. Oppbevar cDNA-prøvene ved -80 °C i minst 1 timer. Det er viktig å fryse alle prøver etter cDNA-syntese unngår risikoen for skjevhet når du sammenligner prøver som ikke har vært frosset til prøver som var frosset.
  6. Klargjør eksempler for ddPCR som følger20:
    1. Bland 3 μL av cDNA-prøven med 11 μL av ddPCR-probeblandingen (ingen dUTP)20,250 nM mindre sporbindende sonde og 900 nM av hver av de fremre og omvendte primere som beskrevet i tabell 6.
    2. Juster det totale PCR-volumet til 22 μL med kjernefritt vann.
  7. Emulgerpcr-blandingene med dropletgenerasjonolje for prober på en dråpegenerator i henhold til produsentens protokoll og tidligere beskrivelser20.
  8. Kjør PCR-programmet som beskrevet i tabell 7.
    MERK: Primer/probesekvensene og PCR-programmene som vises her, er spesielt utformet og optimalisert for sensitiv påvisning av HIV-stammen RHPA4259. Primer- og probesekvenser kan enkelt justeres for å oppdage andre HIV-stamme.
  9. Oppdag dråpefluorescens fra prøvene på en dråpeleser, og analyser resultatene med riktig programvare i henhold til produsentens protokoll.

11. Behandling med cART-holdig chow

  1. Mate mus med pellets som inneholder et standard cART-regime som inneholder 4800 mg/kg raltegravir (RAL), 720 mg/kg tenofovirdisoproksilfumarat (TDF) og 520 mg/kg emtricitabin (FTC)21 (Tabell 8). Disse dosene ble bestemt forutsatt at en mus veier 25 g og spiser 4 g chow per dag. Dette tilsvarer en daglig dose på 768 mg/kg RAL, 2,88 mg/kg TDF og 83 mg/kg FTC21.
  2. Bruk en cART diett som er utarbeidet av en ekstern leverandør (Se tabell over materialer) av reseptbelagte legemidler. Andre selskaper kan potensielt også produsere dette regimet. Bruk en cART diett farget rød for å enkelt skille den fra vanlig mus chow.
    1. Produser en kontroll chow diett uten cART i en standard brun farge for enkel forskjell.
  3. For initiering av cART, lag sterile musebur med tilsetning av cART-inneholdende chow diett, og deretter overføre musene fra det gamle buret til det nye buret.
    1. Overvåk vektene til musene og forbruket av cART-holdig chow ved visuell inspeksjon for å sikre at musene tilpasser seg endringen.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Gating-strategien for analyse av stamcellerenhet er avbildet i figur 1. Figur 1A–C viser den rensede CD34+ populasjonen og figur 1D–F CD34- gjennomstrømningen som brukes til å illustrere at den minimale mengden cd34+-populasjonen går tapt i isolasjonsprosessen. Renheten til isolerte CD34+ stamceller var mellom 85 %–95 % med mindre enn 1 % T-cellekontaminering. Figur 1G viser CCR5-bånd fra en voksen human kontrolldonor med CCR5Δ32/wt genotype, etterfulgt av band fra to CCR5wt/wt og en CCR5Δ32/wt stamcelledonorer. Frekvensen av genotype CCR5Δ32/wt i en gruppe på 19 givere var 15,8% ( figur1H). Dette er i samsvar med større epidemiologiske studier14,15 rapporterer genotypen hos opptil 23,6% av undersøkte personer i Danmark.

Humant CD45+ nivåer i mus perifert blod ble vurdert via flow cytometri 3-5 måneder etter transplantasjon av humane CD34 + stamceller. Gating-strategien presenteres i figur 2A–E. Figur 3A og figur 3B illustrerer variasjonen mellom 10 og 16 individuelle mus som mottar stamceller fra to forskjellige donorer. Transplantasjon av 75 000 hCD34+-celler ga 20 %–50 % human CD45+ i perifert blod. Alle mus utviklet menneskelige B- og T-celler, inkludert både CD4- og CD8+ T-celler.

For atraumatisk intravaginal eksponeringer ble oppsettet avbildet i figur 4 brukt. Mus ble bedøvet i et lukket kammer og holdt under anestesi under eksponeringen. Mus ble holdt med skjeden vendt opp i 5 min etter eksponering for å sikre virusløsningsengasjement med slimhinneflater.

Figur 5A viser suksessraten på 64 % HIV-smitte som er observert ved hjelp av denne modellen. Mus ble utfordret med 21 400 smittsomme enheter (IE) av RHPA4259 intravaginalt. Denne dosen resulterte i at 64% av musene ble HIV-smittet etter vaginal eksponering. Til sammenligning er data fra to forskjellige kohorter av mus eksponert gjennom en intravenøs rute inkludert. Som forventet ble 100% av musene HIV + med lignende doser av RHPA og en ekstra belastning (YU2) ved hjelp av denne ruten.

Figur 5B viser representative resultater fra tre mus som var smittet med HIV og byttet til en diett som inneholder standard cART. Mus ble byttet tilbake til vanlig mus chow etter 40 dager med cART. I dette analyseoppsettet var grensen for virusbelastningsdeteksjon 725 kopier/ml. Virusbelastninger var alle under deteksjonsgrensen etter 4 uker med cART. Etter opphør av cART, viruset rebounded, speiling kliniske data22. Mus på cART tolererte endringen i dietten godt som angitt i figur 5C.

Figure 1
Figur 1: Representativ flyt cytometri gating strategi for validering av stamcellerenhet og CCR5 donor variant status. -C) Gating-strategien som brukes for den isolerte CD34+ cellepopulasjonen. Dobler og rusk er utelukket i henholdsvis panel A og B (FSC-A vs. FSC-H og FSC-A vs. SSC-A). (C) Frekvensen av CD34+ stamceller og CD3+ T cellekontaminering. -Jeg har ikkenoeå si til deg. CD34- flow-through gating strategi. Prosenter i portene beregnes som en brøkdel av den overordnede befolkningen. (G) Resultatene av en CCR5Δ32/wt PCR analyse. Lane 1: DNA fra en human CCR5Δ32/wt donor, baner 2 og 3: to CCR5wt /wt menneskelige stamcelledonorer, lane 4: En CCR5Δ32 /wt human stamcelledonor. (H) Frekvensen av genotype CCR5Δ32/wt i vår gruppe på 19 stamcelleprøver er 15,8%. Vennligst klikk her for å vise en større versjon av dette tallet.

Figure 2
Figur 2: Flyt cytometri gating strategi for validering av human celle engraftment og differensiering. Den totale enukleære cellepopulasjonen fra humaniserte mus ble analysert via flow cytometri. (A) Prosentandelen av humane CD45 + celler ble bestemt som en brøkdel av de totale registrerte hendelsene. (B) Dobler ble senere ekskludert basert på FSC-A/FSC-H gating. (C) Den sanne lymfocyttpopulasjonen ble definert basert på størrelse og detaljrikdom. (D) Lymfocytter ble deretter karakterisert som enten CD3 + (T-celler) eller CD19 + (B-celler). (E) CD3 + T celler var enten CD4 + T celler eller CD8 + T celler. Prosentandeler i porter ble beregnet som en brøkdel av den overordnede befolkningen. Vennligst klikk her for å vise en større versjon av dette tallet.

Figure 3
Figur 3: Representativhumaniseringsnivå 4–5 måneder etter stamcelletransplantasjon med celleundertypefraksjoner for 10 og 16 mus generert fra to forskjellige menneskelige donorer. (A) Den enukleære cellepopulasjonen (MNC) fra 10 og (B) 16 humaniserte mus ble analysert via flytcytometri og inngjerdet som presentert i figur 2. Fraksjonen av humane CD45+-celler presenteres som %hCD45 (av totalt MNC) og %B- og %T-celler som en brøkdel av hCD45. T-celler ble senere delt inn i %CD4 og %CD8. Hvert datapunkt representerer én mus. Data presenteres som slem ± SD. Vennligst klikk her for å vise en større versjon av dette tallet.

Figure 4
Figur 4: Eksperimentelt laboratoriebenkoppsett for intravaginal eksponering av mus. Eksperimentelt oppsett for HIV-eksponering av humaniserte mus gjennom intravaginal ruten. Prosedyren utføres i en strømningsbenk der alle reagenser og overflater er sterilisert før bruk. Vennligst klikk her for å vise en større versjon av dette tallet.

Figure 5
Figur 5: Frekvensen av HIV-stammeoverføring gjennom ulike eksponeringsruter og effekt og sikkerhet av cART-holdig chow i viral undertrykkelse. (A) Humaniserte NOG-mus ble vellykket smittet med to forskjellige stammer av HIV gjennom enten intravaginal eller intravenøs rute. Mus ble utsatt med 21 400 IUs av RHPA4259 intravaginally, 5157 IUs IV med RHPA4259, eller 3000 IUs IV med YU2. Detaljer om IV eksponering av humaniserte mus er ikke inkludert i denne protokollen. HIV-infeksjoner ble vellykket behandlet med et cART-regime levert gjennom musechow. (B) Virusbelastningen ble redusert til under deteksjon for alle tre musene på cART og rebound dukket opp etter opphør av cART. Den stiplede linjen indikerer grensen for kvantifisering ved 725 kopier/ml. Mus matet med cART chow hadde lignende vektutvikling som mus plassert på ikke-cART chow i samme tidsperiode, noe som indikerer ingen smak-preferanse eller bivirkninger av cART diett. (C) Vekter presenteres som foldendring sammenlignet med starten av cART. Hvert datapunkt representerer gjennomsnittet av tre dyr ± SD. Vennligst klikk her for å se en større versjon av dette tallet.

Antistoffmål Klone Fluorophore (andre betydninger)
CD3 (CD3) klone SK7 Buv395 (andre)
CD34 (CD34) klone AC136 FITC (andre)
CD45 (CD45) klone 2D1 Apc

Tabell 1: Antistoffer som brukes til bestemmelse av stamcellerenhet. Foreslått flerfarget flyt cytometri panel for evaluering av stamcellerenhet. Oppført er antistoffmålet, kloneog fluoropfor.

CCR5Δ32 deteksjon Primere
Forover primer 5'CTTCATTACACCTGCAGCT'3
Omvendt primer 5'TGAAGATAAGCCTCACAGCC'3

Tabell 2: CCR5Δ32 variantdeteksjon PCR-primere. Fremover og omvendt primere som brukes til påvisning av 32 bp sletting i CCR5 genet.

nei. av sykluser 1 45 1
Temperatur (°C) 98 98/63/72 72 10
Tid 30 s 10 s/30 s/15 s 5 min.

Tabell 3: CCR5Δ32 variant deteksjon PCR program. PCR sykkelprogram som brukes til forsterkning av CCR5 genet.

Antistoffmål Klone Fluorophore (andre betydninger)
CD4 (CD4) SK3 (ANDRE) Buv 496 Leilighet
CD8 (CD8) RPA-T8 (andre) BV421 (andre)
CD3 (CD3) Okt3 (andre) FITC (andre)
CD19 (engelsk) Sj25c1 (andre) Pe-cy7 (andre)
CD45 (CD45) 2D1 (andre) Apc

Tabell 4: Antistoffer som brukes til bestemmelse av musehumanisering. Foreslått flerfarget flyt cytometri panel for humanisering. Oppført er antistoffmålet, kloneog fluoropfor.

nei. av sykluser 1 1
Temperatur (°C) 51 80 4
Tid 45 min. 15 min.

Tabell 5: cDNA forsterkning program. Program som brukes til forsterkning av komplementær strand DNA til viral RNA.

HIV-kvantifisering Primere
Forover primer 5'AGGGCAGCATAGAGCAAAAA'3
Omvendt primer 5'CAAAGGAATGGGTTCTT'3
FAM-sonde 5'ATCCCCACTTCAACAGATGC'3

Tabell 6: HIV ddPCR-primere. Primers og sonder som brukes til ddPCR forsterkning av viral cDNA.

nei. av sykluser 1 39 1
Temperatur (°C) 95 95/54.5 98 4
Tid 10 min. 30 s/1 min 10 min.

Tabell 7: HIV ddPCR-program. PCR sykkelprogram som brukes til forsterkning av viral RNA.

Raltegravir (RAL) 4800 mg/kg
Tenofovirdisoproksilfumarat (TDF) 720 mg/kg
Emtricitabine (FTC) 520 mg/kg

Tabell 8: Mus cART chow diett. Mus chow diett ble formulert som tidligere publisert21. Chow dietten ble gjort på en base av standard mus chow, og etter produksjon, maten ble γ-bestrålt med 25 kGy og dobbelt-bagged. Chow ble lagret ved -20 °C til bruk.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Den alvorlig immunkompromitterte musen belastning NOD. Cg-PrkdcscidIl2rgtm1Sug/ JicTac (NOG) er ekstremt godt egnet for transplantasjon av menneskelige celler og vev. Både medfødte og adaptive immunveier i disse musene er kompromittert. NOG- og NSG-mus har enPrkdc-scidmutasjon som resulterer i defekt T- og B-cellefunksjon. Videre mangler disse musene en funksjonell interleukin-2 reseptor γ-kjede (vanlig gammakjede, IL2rg) som er uunnværlig i bindingskompleksene til mange viktige cytokiner som IL-2, IL-4, IL-7, IL-9, IL-15 og IL-21. Immundeficient mus, som NOG, transplantert med et menneskelig immunsystem er et kraftig verktøy for studiet av HIV-overføring og immunologi. Bidrag i disse feltene gjort ved hjelp av humaniserte mus har blitt grundig gjennomgått2,23,24,25,26. Bruken av disse musene til å studere humanmedmede immunresponser får også økt oppmerksomhet27,28.

Målet med dette manuskriptet er å levere en omfattende protokoll av mus og ddPCR prosedyrer for å gå fra en naiv mus til HIV-overføring og behandlingsdata. Vårt system benyttet ddPCR for kvantifisering av viral RNA og DNA. I en ddPCR-reaksjon er retogtene partisjonert i opptil 20 000 dråper, som hver inneholder en enkelt, separat mikro PCR-reaksjon. Forsterkningen av et mål inne i en dråpe fører til et positivt fluorescerende signal for den dråpe. Dermed er avlesningen binær, og ved å bruke Poisson statistiske analyser, kan antall positive reaksjoner oversettes direkte til en rekke malkopier i det opprinnelige eksemplet. Fordelen med ddPCR ligger i sin evne til å direkte kvantifisere et mål uavhengig av en standard kurve. Dette er spesielt attraktivt når du analyserer RNA-prøver som er utfordrende å utnytte som PCR-standardkurver på grunn av labile natur29. Videre, ved å analysere flere replikaer av samme prøve og slå sammen de enkelte datapunktene for den endelige eksempelkvantifiseringen, gjør den binære naturen til ddPCR det mulig å senke registreringsgrensen for malkopier per ml eksempel29. Dette er spesielt viktig i en humanisert musinnstilling, der bare begrenset prøvemateriale er tilgjengelig og høy følsomhet er nødvendig.

Administrasjon av cART til humaniserte mus kan gjøres enten ved oralgavage eller intraperitoneale injeksjoner med løsninger av cART30,31,32, og som vist nylig, ved formulering idietten 21. Et av våre store mål var gjennomføringen av et cART-regime i musedietten for å redusere potensiell stress på dyrene på grunn av de ekstra håndteringstrinnene som ligger i andre metoder for levering av legemidler. Dosen av medisin som en mus vil spise kan nøyaktig estimeres basert på gjennomsnittlig daglig matinntak avmusene 33. Muntlig levering gjennom dietten fungerer som den enkleste leveringsruten med både minimal stress for dyret og minimal arbeidsbelastning for handleren. Vi baserte vår kombinasjon av antivirale legemidler på tidligere publiserte studier hos humaniserte mus21,30. Videre er vår cART-strategi klinisk relevant gitt at legemiddelkombinasjonen som benyttes klinisk, gis muntlig av pasienter over hele verden.

Visse begrensninger er notert vedrørende bruk av NOG-mus. Viktigere, menneskelige T-celler i disse musene dyrkes i en mus thymic miljø, i motsetning til et menneskelig miljø. Det siste fokuset er på å generere xenorecipient stammer som har et gunstig miljø for utvikling av robuste menneskelige immunresponser. Disse nye stammene inkluderer immundeficient mus som er transgene for menneskelige MHC molekyler, for eksempel A2. Disse modellene gjør det mulig for HLA-begrensede antigen T-celleresponser som resulterer i bedre modnings- og effektorfunksjoner i det adaptive immunsystemet34. En annen tilnærming er å erstatte musegener med viktige menneskelige cytokiner for IL-3/GM-CSF35, IL-636, IL-1537, TPO, M-CSF38og IL-7/TSLP31. Slike modeller har fått økt oppmerksomhet for deres evne til å generere bedre differensiering av medfødte celletyper. Vår protokoll er lett tilpasningsdyktig for humanisering og HIV-infeksjon av mus ved hjelp av en slik forbedret genetisk bakgrunn immundeficient belastning.

Oppsummert forenkler brukervennligheten og nytten av den beskrevne tilnærmingen forskning på HIV-relaterte felt in vivo. Humaniserte mus kan være et svært kraftig verktøy for å veilede forskning mot å generere bedre forskningshypoteser. Sammen med genereringen av mer "humane" humaniserte mus med menneskelige transgenes, tror vi vår standardiserte protokoll vil bidra til effektivisering av eksperimentelle prosedyrer på tvers av ulike forskningsmiljøer.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne erklærer ingen interessekonflikter.

Acknowledgments

Forfatterne vil gjerne takke biomedisin dyrefasilitetspersonalet ved Aarhus Universitet, spesielt Jani Kær for kolonivedlikeholdsarbeid og for å spore musevekter. Forfatterne vil gjerne takke professor Florian Klein for å utvikle standard-of-care cART og for veiledning. Følgende reagens ble innhentet gjennom NIH AIDS Reagent Program, Divisjon av AIDS, NIAID, NIH: pRHPA.c/2635 (katt# 11744) fra Dr. John Kappes og Dr. Christina Ochsenbauer.

Materials

Name Company Catalog Number Comments
Blue pad VWR 56616-031 Should be sterilized prior to use
Bovine serum albumin (BSA) Sigma A8022
CD19 (clone sj25c1) PE-Cy7 BD Bioscience 557835
CD3 (clone OKT3) FITC Biolegend 317306
CD3 (clone SK7) BUV395 BD Bioscience 564001
CD34 (clone AC136) FITC Miltenyi 130-113-740
CD4 (clone SK3) BUV 496 BD Bioscience 564652/51
CD45 (clone 2D1) APC Biolegend 368511/12
CD8 (clone RPA-T8) BV421 BD Bioscience 562428
ddPCR Supermix for probes (no dUTP) Bio-Rad 1863025
DMSO Merck 10,02,95,21,000
DNAse Sigma D4263 For suspension buffer
dNTP mix Life Technologies R0192
Dulbeccos phosphate-buffered saline (PBS) Biowest L0615-500
EasySep Human Cord Blood CD34 Positive Selection Kit II Stemcell 17896
EDTA Invitrogen 15575-038
FACS Lysing solution 10X BD 349202 Dilute 1:10 in dH20 immediately before use
FACS tubes (Falcon 5 mL round-botton) Falcon 352052
Fc Receptor blocking solution (Human Trustain FcX) Biolegend 422302
Fetal bovine serum Sigma F8192-500
Ficoll-Paque PLUS GE Healthcare 17144002
Flowjo v.10
Gauze Mesoft 157300 Should be sterilized prior to use
Heating lamp Custom made
Hemacytometer (Bürker-Türk) VWR DOWC1597418
Isoflurane gas Orion Pharma 9658
LSR Fortessa X20 flow cytometer BD
Microcentrifuge tubes, PCR-PT approved Sarstedt 72692405
Mouse cART food ssniff Spezialdiäten GmbH Custom made product
Mouse restrainer Custom made product
Needle, Microlance 3, 30G ½" BD 304000
NOG mice NOD.Cg-Prkdcscid Il2rgtm1Sug/JicTac Taconic NOG-F
Nuclease-free water VWR chemicals 436912C
Nucleospin 96 Virus DNA and RNA isolation kit Macherey-Nagel 740691
PCR-approved microcentrifuge tubes Sarstedt 72.692.405
Penicillin-Streptomycin solution 100X Biowest L0022-100
Phusion Hot Start II DNA polymerase Life Technologies F549S
Pipette tips, sterile, ART 20P Barrier ThermoScientific 2149P
Proteinase K NEB 100005398
QuantaSoft software Bio-Rad
QX100 Droplet Generator Bio-Rad 1886-3008
QX100 Droplet Reader Bio-Rad 186-3003
RBC lysis solution Biolegend 420301
RNase-free DNAse size F + reaction buffer Macherey-Nagel 740963
RNAseOUT Recombinant Ribonuclease inhibitor ThermoScientific 10777-019
RPMI Biowest L0501-500 Dissolve in H20
Softject 1 mL syringe Henke Sass Wolf 5010-200V0
Superscript III Reverse Transcriptase ThermoFisher Scientific 18080044
Thermoshaker VWR 89370-910
Trypane blue Sigma T8154
Ultrapure 0.5 EDTA, pH 8.0 ThermoFisher Scientific 15575-020
Virkon S (virus disinfectant) Dupont 7511

DOWNLOAD MATERIALS LIST

References

  1. WHO. GHO | By category | Antiretroviral therapy coverage - Data and estimates by WHO region (2018). World Health Organization. Available from: http://apps.who.int/gho/data/node.main.626 (2018).
  2. Skelton, J. K., Ortega-Prieto, A. M., Dorner, M. A Hitchhiker's guide to humanized mice: new pathways to studying viral infections. Immunology. 154, (1), 50-61 (2018).
  3. Denton, P. W., Krisko, J. F., Powell, D. A., Mathias, M., Kwak, Y. T. Systemic Administration of Antiretrovirals Prior to Exposure Prevents Rectal and Intravenous HIV-1 Transmission in Humanized BLT Mice. PLoS ONE. 5, (1), 8829 (2010).
  4. Zou, W., et al. Nef functions in BLT mice to enhance HIV-1 replication and deplete CD4 + CD8 + thymocytes. Retrovirology. 9, (1), 44 (2012).
  5. Berges, B. K., Akkina, S. R., Folkvord, J. M., Connick, E., Akkina, R. Mucosal transmission of R5 and X4 tropic HIV-1 via vaginal and rectal routes in humanized Rag2 -/- γc -/- (RAG-hu) mice. Virology. 373, (2), 342-351 (2008).
  6. Veselinovic, M., Charlins, P., Akkina, R. Modeling HIV-1 Mucosal Transmission and Prevention in Humanized Mice. Methods Mol Biol. 203-220 (2016).
  7. Neff, C. P., Kurisu, T., Ndolo, T., Fox, K., Akkina, R. A topical microbicide gel formulation of CCR5 antagonist maraviroc prevents HIV-1 vaginal transmission in humanized RAG-hu mice. PLoS ONE. 6, (6), 20209 (2011).
  8. Neff, P. C., Ndolo, T., Tandon, A., Habu, Y., Akkina, R. Oral pre-exposure prophylaxis by anti-retrovirals raltegravir and maraviroc protects against HIV-1 vaginal transmission in a humanized mouse model. PLoS ONE. 5, (12), 15257 (2010).
  9. Veselinovic, M., et al. HIV pre-exposure prophylaxis: Mucosal tissue drug distribution of RT inhibitor Tenofovir and entry inhibitor Maraviroc in a humanized mouse model. Virology. 464-465, 253-263 (2014).
  10. Akkina, R., et al. Humanized Rag1-/-γc-/- mice support multilineage hematopoiesis and are susceptible to HIV-1 infection via systemic and vaginal routes. PLoS ONE. 6, (6), 20169 (2011).
  11. Zhou, J., et al. Systemic administration of combinatorial dsiRNAs via nanoparticles efficiently suppresses HIV-1 infection in humanized mice. Molecular Therapy. 19, (12), 2228-2238 (2011).
  12. Balcombe, J. P., Barnard, N. D., Sandusky, C. Laboratory routines cause animal stress. Contemporary Topics in Laboratory Animal Science. 43, (6), 42-51 (2004).
  13. Trecarichi, E. M., et al. Partial protective effect of CCR5-Delta 32 heterozygosity in a cohort of heterosexual Italian HIV-1 exposed uninfected individuals. AIDS Research and Therapy. 3, (1), (2006).
  14. Novembre, J., Galvani, A. P., Slatkin, M. The geographic spread of the CCR5 Δ32 HIV-resistance allele. PLoS Biology. 3, (11), 1954-1962 (2005).
  15. Solloch, U. V., et al. Frequencies of gene variant CCR5-Δ32 in 87 countries based on next-generation sequencing of 1.3 million individuals sampled from 3 national DKMS donor centers. Human Immunology. 78, (11-12), 710-717 (2017).
  16. Ochsenbauer, C., et al. Generation of Transmitted/Founder HIV-1 Infectious Molecular Clones and Characterization of Their Replication Capacity in CD4 T Lymphocytes and Monocyte-Derived Macrophages. Journal of Virology. 86, (5), 2715-2728 (2012).
  17. Andersen, A. H. F., et al. Long-Acting, Potent Delivery of Combination Antiretroviral Therapy. ACS Macro Letters. 7, (5), 587-591 (2018).
  18. Caro, A. C., Hankenson, F. C., Marx, J. O. Comparison of thermoregulatory devices used during anesthesia of C57BL/6 mice and correlations between body temperature and physiologic parameters. Journal of the American Association for Laboratory Animal Science JAALAS. 52, (5), 577-583 (2013).
  19. Gatlin, J., Padgett, A., Melkus, M. W., Kelly, P. F., Garcia, J. V. Long-term engraftment of nonobese diabetic/severe combined immunodeficient mice with human CD34+ cells transduced by a self-inactivating human immunodeficiency virus type 1 vector. Human Gene Therapy. 12, (9), 1079-1089 (2001).
  20. Leth, S., et al. HIV-1 transcriptional activity during frequent longitudinal sampling in aviremic patients on antiretroviral therapy. AIDS. 30, (5), 713-721 (2016).
  21. Halper-Stromberg, A., et al. Broadly neutralizing antibodies and viral inducers decrease rebound from HIV-1 latent reservoirs in humanized mice. Cell. 158, (5), 989-999 (2014).
  22. Rothenberger, M. K., et al. Large number of rebounding/founder HIV variants emerge from multifocal infection in lymphatic tissues after treatment interruption. Proceedings of the National Academy of Sciences. 112, (10), 1126-1134 (2015).
  23. Rongvaux, A., et al. Human Hemato-Lymphoid System Mice: Current Use and Future Potential for Medicine. Annual Review of Immunology. 31, (1), 635-674 (2013).
  24. Walsh, N. C., et al. Humanized Mouse Models of Clinical Disease. Annual Review of Pathology: Mechanisms of Disease. 12, (1), 187-215 (2017).
  25. Denton, P. W., García, J. V. Humanized mouse models of HIV infection. AIDS Reviews. 13, (3), 135-148 (2011).
  26. Denton, P. W., Søgaard, O. S., Tolstrup, M. Using animal models to overcome temporal, spatial and combinatorial challenges in HIV persistence research. Journal of Translational Medicine. 14, (1), (2016).
  27. Andersen, A. H. F., et al. cAIMP administration in humanized mice induces a chimerization-level-dependent STING response. Immunology. 157, (2), 163-172 (2019).
  28. Tanaka, S., et al. Development of Mature and Functional Human Myeloid Subsets in Hematopoietic Stem Cell-Engrafted NOD/SCID/IL2r KO Mice. The Journal of Immunology. 188, (12), 6145-6155 (2012).
  29. Quan, P. L., Sauzade, M., Brouzes, E. DPCR: A technology review. Sensors (Switzerland). 18, (4), (2018).
  30. Denton, P. W., et al. Generation of HIV Latency in Humanized BLT Mice. Journal of Virology. 86, (1), 630-634 (2012).
  31. Li, Y., et al. A human immune system mouse model with robust lymph node development. Nature Methods. 15, (8), 623-630 (2018).
  32. Satheesan, S., et al. HIV Replication and Latency in a Humanized NSG Mouse Model during Suppressive Oral Combinational Antiretroviral Therapy. Journal of Virology. 92, (7), 02118 (2018).
  33. Bachmanov, A. A., Reed, D. R., Beauchamp, G. K., Tordoff, M. G. Food intake, water intake, and drinking spout side preference of 28 mouse strains. Behavior Genetics. 32, (6), 435-443 (2002).
  34. Shultz, L. D., et al. Generation of functional human T-cell subsets with HLA-restricted immune responses in HLA class I expressing NOD/SCID/IL2r null humanized mice. Proceedings of the National Academy of Sciences. 107, (29), 13022-13027 (2010).
  35. Willinger, T., et al. Human IL-3/GM-CSF knock-in mice support human alveolar macrophage development and human immune responses in the lung. Proceedings of the National Academy of Sciences. 108, (6), 2390-2395 (2011).
  36. Hanazawa, A., et al. Generation of human immunosuppressive myeloid cell populations in human interleukin-6 transgenic NOG mice. Frontiers in Immunology. 9, FEB (2018).
  37. Huntington, N. D., et al. IL-15 trans-presentation promotes human NK cell development and differentiation in vivo. The Journal of Experimental Medicine. 206, (1), 25-34 (2009).
  38. Rongvaux, A., et al. Development and function of human innate immune cells in a humanized mouse model. Nature Biotechnology. 32, (4), 364-372 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics