C. Eleganlarda Fizyolojik Stres Tepkilerinin Ölçüleri

* These authors contributed equally
JoVE Journal
Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Burada, nematod C. elegans hücresel proteotoksik stres yanıtları floresan transkripsiyonel muhabirlerin aktivasyonunu ölçerek ve fizyolojik strese duyarlılık belirterek karakterize.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Bar-Ziv, R., Frakes, A. E., Higuchi-Sanabria, R., Bolas, T., Frankino, P. A., Gildea, H. K., Metcalf, M. G., Dillin, A. Measurements of Physiological Stress Responses in C. Elegans. J. Vis. Exp. (159), e61001, doi:10.3791/61001 (2020).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Organizmalar genellikle dalgalanan ortamlara ve hücre içi homeostazdeğişikliklerine maruz kalırlar, bu da proteom ve fizyolojileri üzerinde zararlı etkilere yol açabilir. Böylece, organizmalar hasar onarmak ve homeostaz korumak için adanmış hedefli ve özel stres yanıtları gelişti. Bu mekanizmalar arasında endoplazmik retikulum (UPRER),mitokondri (UPRMT),ısı şoku yanıtı (HSR) ve oksidatif stres tepkisinin (OxSR) ortaya çıkan protein yanıtı yer almaktadır. Burada sunulan protokoller, bu yolların aktivasyonunu ve bunların nematod, C. elegans'takifizyolojik sonuçlarını tespit etme ve karakterize etme yöntemlerini tanımlar. İlk olarak, hızlı hücresel karakterizasyon, ilaç taraması veya büyük ölçekli genetik tarama (örneğin, RNAi veya mutant kütüphaneler) için yola özgü floresan transkripsiyonel muhabirlerin kullanımı açıklanmıştır. Buna ek olarak, tamamlayıcı, sağlam fizyolojik tahliller açıklanmıştır, hangi doğrudan belirli stres hayvanların duyarlılığını değerlendirmek için kullanılabilir, transkripsiyonel muhabirlerin fonksiyonel doğrulama olarak hizmet vermektedir. Birlikte, bu yöntemler iç ve dış proteotoksik pertürbations hücresel ve fizyolojik etkileri hızlı karakterizasyonu için izin verir.

Introduction

Bir organizmanın hücre içi ve hücre dışı ortamdaki değişikliklere yanıt verebilme yeteneği hayatta kalması ve adaptasyonu için çok önemlidir. Bu hücre bütünlüğünü sağlamak çok sayıda koruyucu yollar aracılığıyla hücresel düzeyde gerçekleştirilir. Çok sayıda hücresel bileşenler stresle ilişkili hasara maruz kalırken, hücresel stres yanıtlarının önemli bir tutulumu hücresel proteomun homeostazını onarmak ve korumaktır. Ancak, proteinlerin organel adı verilen özel yapılara bölünmesi, hücre içindeki tüm proteinlerin düzgün bir şekilde katlanıp işlevsel olmasını sağlamak için merkezi bir protein kalite kontrolü formuna güvenemeyeceği nden, hücre için bir sorun teşkil etmektedir. Bu nedenle, proteinleri için tedirginlikile başa çıkmak için, organeller yanlış katlanmış proteinleri algılamak ve bu bölme içinde stresi hafifletmek için bir girişim bir stres yanıtı etkinleştirmek özel kalite kontrol mekanizmaları, gelişti. Örneğin, sitosol ısı şoku tepkisine (HSR) dayanırken, endoplazmik retikulum (ER) ve mitokondriler kompartmana özgü açılmakta olan protein yanıtlarına (UPR) güvenirler. OxSR reaktif oksijen türlerinin toksik etkilerini hafifletmek için hizmet vermektedir (ROS). Her stres tepkisi hücresel sorunlar ve çevresel hakaretvarlığında tetiklenir ve özel bir transkripsiyonel tepki neden olur. Bu yanıtların ayırıcı özellikleri, yanlış katlanmış proteinleri (şaperonlar gibi) uygun organelle yeniden katlayan veya alternatif olarak protein yıkımı ile hasarlı proteinleri ortadan kaldıran moleküllerin sentezlemesidir. Bu stres yanıtlarının etkinleştirilmesinin sağlanamaması hasarlı proteinlerin birikmesine, dokuların sistemik yetmezliğine yayılan hücresel disfonksiyona ve sonunda organizmanın ölümüne yol açar. Farklı stres yanıtlarının işlevi ve düzenlenmesi başka bir yerde gözden geçirilir1.

Hücresel stres yanıtlarının düzenlenmesi ve aktivitesi ile ilgili birçok anlayışlar nematod atfedilmiştir, Caenorhabditis elegans, genetik araştırmalarda çok hücreli model organizma. Nematodlar sadece hücredüzeyinde stres yanıtlarının aktivasyonçalışmasına izin değil, aynı zamanda organizma düzeyinde; nematodlar genetik tedirginliklerin veya ilaçlara ve kirleticilere maruz kalmanın büyüme ve hayatta kalma üzerindeki etkilerini incelemek için kullanılmıştır. Onların hızlı nesil zaman, izojeni, şeffaflık, genetik sistemlilik, ve deneme sırasında kullanım kolaylığı onları bu tür çalışmalar için ideal olun. Ayrıca, strese nispeten hızlı fizyolojik tepki (saat ve birkaç gün arasında) ve hücresel yolların evrimsel korunması nematodlar stres direnci çalışmalarında önemli bir araç olun.

C. elegansbüyümek için bir besin kaynağı olarak kullanılan iki yaygın olarak kullanılan E. coli suşları vardır: standart OP50, hangi en deney tarihsel2 ve HT115, hemen hemen tüm RNAi deneyleri için kullanılan bir K-12 suşu yapılmıştır bir B suşu3,4. OP50 ve HT115 bakteriyel diyetler arasında önemli farklılıklar olduğunu unutmayın. Bu farklı bakteriyel kaynaklarda büyüme metabolik profil, mitokondriyal DNA kopya numarası ve yaşam süresi5de dahil olmak üzere birçok önemli fenotipler, önemli farklılıklara neden olduğu gösterilmiştir . Bu farklılıkların bazıları OP50 bakteri büyüme ile ilişkili Vitamin B12 eksikliği atfedilir, mitokondriyal homeostaz kusurları ve patojenler ve streslere karşı artan duyarlılık neden olabilir. Tüm bu fenotiplerin HT115 bakterisi üzerinde büyüme ile hafifletilmiş olduğu gösterilmiştir, Hangi B12 vitamini daha yüksek düzeyde var6. Bu nedenle, rnai koşullarının gerekliliğine bakılmaksızın HT115 bakterileri üzerinde fizyolojik stres yanıtları üzerinde tüm deneylerin yapılması tavsiye edilir. Ancak, OP50'de hayvanların bakım kolaylığı nedeniyle, tüm standart büyüme (yani hayvanların bakımı ve amplifikasyonu) OP50 üzerinde gerçekleştirilebilir, çünkü burada açıklanan deneysel paradigmalarda önemli farklılıklar saptanamamıştır, op50'de tutulan solucanlarda, ht115 sonrası senkronizasyona (yani, l1 tutuklaması ile veya l1 tutuklaması olmadan yumurta dan beyazlatma dan) geçirilmelerinden itibaren fark edilmemiştir.

Burada iki fonksiyonel yöntem kullanılarak hücresel stres yanıtlarının aktivitesinin karakterizasyonu açıklanmıştır. Bu protokoller sunulan öncelikle hücresel stres yanıtları ve protein homeostaz üzerindeki etkileri üzerinde duruldu unutulmamalıdır. İlk olarak, floresan transkripsiyonel muhabirler kullanılmaktadır, hangi özellikle farklı hücresel streslere yanıt olarak aktive endojen gen organizatörleri tarafından düzenlenir. Bu floresan transkripsiyonel muhabirler, stres yanıtının doğal olarak bir parçası olan spesifik genlerin transkripsiyonel indüksiyonuna dayanmaktadır. Örneğin, HSP-4, insan refakatçih HSPA5/BiP bir ısı şok proteinorolog, ER-stres üzerine aktive edilir ve stresi hafifletmek için ER lokalize. ER stres koşullarında (örneğin, tunicamycin maruz imal), yeşil floresan protein (GFP), hsp-4 organizatörü nyönetmeliği altında yer, floresan mikroskopisi ile değerlendirilebilir veya kantitatif nematodların büyük parçacık akış sitometri kullanılarak ölçülebilir yüksek seviyelerde sentezlenir7. Benzer şekilde, bir mitokondriyal şaperon organizatörü, hsp-6 (memeli HSPA9 ortologous), UPRMT8aktivasyonunu izlemek için kullanılır , ve sitosolik şaperon organizatörü-16.2 (insan kristalin alfa genlerine ortologous) HSR aktivitesini değerlendirmek için kullanılır9. Bu muhabirler çeşitli tedirginliklere yanıt olarak aktive yolları hızlı bir karakterizasyon sağlar.

Genellikle, burada sunulan muhabirler stres yanıtlarının aktivasyonu nitel bir çıkış sağlayan mikroskopi kullanılarak görüntülenir. Ancak, görüntüleme teknikleri yukarıda açıklanan gazetecilerin yoğunluğu ve doku konumu hakkında hem bilgi sağlarken, onun nicelliği her zaman doğru veya sağlam değildir. Görüntüleme analiz araçları kullanılarak floresan aktivasyonu ölçmek mümkün olmakla birlikte, bu yöntemler nispeten düşük iş akışı ve örnek boyutu küçüktür, çünkü görüntülenmiş hayvan sayısı nispeten düşüktür. Kolaylık ve hayvanların büyük miktarlarda elde etmek için yeteneği hızla C. elegans ideal bir model sistemi büyük bir parçacık akışı sitometre kullanımı ile floresan stres muhabirlerinin aktivasyonunu titretmek için olun. Büyük parçacık akış sitometresi, birçok canlı hayvanın boyutuna ve floresansına göre kayıt, analiz ve sıralama yeteneğine sahiptir. Bu yöntemi kullanarak, binlerce solucan için floresan yoğunluğu, boyutu ve mekansal (2D) bilgi almak mümkündür. Sistem flowpilot kullanılarak kontrol edilir, hangi gerçek zamanlı veri toplama ve ölçülen parametrelerin analizi sağlar. Burada, büyük parçacık akış sitometresi kullanarak hem mikroskobik görüntüleme hem de kantitatif analiz yöntemleri stres yanıtlarının aktivasyonunu ölçmek için yöntemler olarak sunulmuştur.

Muhabir analizinin ötesinde, hayvanların strese karşı duyarlılığı veya direnci fizyolojik stres tahlilleri kullanılarak ölçülebilir. Bu belirli hücresel stres yollarını etkinleştirmek stresli ortamlara hayvanların maruz kalma ile elde edilir. Burada, tüm hayvanların belirli stres türlerine karşı duyarlılığını ölçmek için çeşitli yöntemler sağlanmaktadır.

ER stres ilerkist asyon, n-bağlı glikozilasyon blokları, ER10yanlış katlanmış proteinlerin birikimine neden kimyasal ajan, tunicamycin kullanılarak C. elegans uygulanır. C. elegansolarak , ER fonksiyonunda majör pertüreasyonlar tunicamycin sonuçlarına maruz kalma üzerine büyüme, ve önemli ölçüde azalmış ömrü11. Tunicamisin içeren plakalar üzerinde hayvanların hayatta kalma ölçümü ile, hayvanların ER stres duyarlılığı ölçülebilir. Örneğin, ektopik UPRER indüksiyonu olan ve böylece ACIL'de protein misfolding strese karşı direnci artmış olan hayvanlar yabani tip hayvanlara göre tunicamycin maruz kalma üzerine artan bir sağkalım var12.

Oksidatif ve mitokondriyal stres C. elegans kimyasal ajan, paraquat hayvanlar maruz tarafından uygulanır. Paraquat özellikle mitokondri13süperoksit oluşumuna neden olan yaygın olarak kullanılan herbisit vardır. Mitokondri kaynaklı reaktif oksijen türlerinin (ROS) spesifik lokalizasyonu nedeniyle, paraquat tahlilleri genellikle "mitokondriyal" stres tahlilleri olarak kullanılır. Ancak, süperoksit hızla mitokondriyal süperoksit dismutazlar tarafından hidrojen peroksit dönüştürülür (SODs)14. Hidrojen peroksit daha sonra mitokondri dışına yayılabilir ve hücrenin diğer bölümlerinde oksidatif strese neden olabilir. Bu nedenle, paraquat sağkalım tahlilleri hem mitokondriyal hem de oksidatif strese duyarlılık ölçümü olarak tanımlarız (diğer oksidatif stres tahlilleribulunabilir 15).

Termotolerans tahlilleri C. elegans yüksek sıcaklıklarda hayvanlar yerleştirerek yapılır. Nematodlar için ortam sıcaklıkları ~15-20 °C'dir ve termal gerilim 25 °C16,17üzerindeki sıcaklıklarda indüklenir. Termotolerans tahlilleri genellikle 30-37 °C arasında değişen sıcaklıklarda yapılır, hayvanlar bu sıcaklıkta büyük hücresel bozukluklar sergilerler ve hayatta kalma tahlilleri 24 saat içinde tamamlanır16,18. Burada termotolerans tahlillerinin icrası için iki alternatif yöntem sağlanmaktadır: 34 °C'de büyüme ve 37 °C'de büyüme. Burada sunulan protokoller birlikte, RNA paraziti veya kimyasal ilaç kütüphaneleri kullanılarak standart gen knock-down ile birleştirildiğinde büyük ölçekli ekranlar gerçekleştirmek için kullanılabilir.

Protokol, C. eleganların büyümesi ve görüntülemeye hazırlık (bölüm 1 ve 2), transkripsiyonel muhabirlerin floresan mikroskopi kullanılarak görüntülenmesi (bölüm 3-5), büyük parçacık akış sitometresi kullanan muhabirlerin kantitatif ölçümleri (bölüm 6) ve C. elegans'taki stres hassasiyetini ölçmek için fizyolojik tahliller olmak üzere 4 geniş prosedüre bölünebilir (bölüm 7).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Standart sıcaklık ve OP50 vs HT115 büyüme koşulları

  1. Standart büyüme ve genişleme
    1. LB(Tablo 1)veya ortam sıcaklığında (~22-25 °C) 24-48 saat için tercih edilen eşdeğer ortamda OP50 kültürünü büyütün. OP50 bir urasil auxotroph olduğu için oda sıcaklığında bakteri yetiştirmek ve 37 °C'de yetiştirildiğinde daha yüksek bir geri revertant (örn. baskılayıcı mutantlar) insidansı vardır. OP50 kültürlerinin uzun süreli depolanması önerilmez (4 °C'de maksimum 1 hafta).
    2. Solucanların bakımı için 60 mm NGM plakasına(Tablo 1)~100-200 μL doymuş OP50 kültürü ve 1 mL doymuş OP50 kültürünü deney için hayvanları genişletmek için 100 mm'lik bir tabağa tohumlayın.
    3. Tabaklar bir tezgah üzerinde bir gecede kuru.
      NOT: 100 mm plakaların kuruması için daha fazla zamana ihtiyaç olabilir, özellikle havalandırmasız plakalar kullanıyorsanız. Tüm C. elegans plakalarını 4 °C'de depolanan hava geçirmez kaplarda saklayın. Farklı ozmotik basınç ve plakasertliği nedeniyle plakalar üzerinde hayvan fizyolojisi değişecek tir.
    4. Standart bakım için, 10-15 genç hayvanı (yumurta, L1 veya L2 aşamaları) 60 mm'lik bir plakaya taşıyın, ancak daha düşük fecundity ile mutantlar veya transgenik hayvanlarla uğraşırken daha fazla hareket ettirilebilir. Gelişimsel veya fecundity kusurları olan hayvanlar için, stok kaybını önlemek için hayvanların daha değişken bir havuz yığın. 15 °C'de tutulursa, her hafta hayvanları hareket ettirin; 20 °C için, her 3-4 günde bir hayvanları hareket ettirin.
    5. Her 25-30 pasajda bir hayvanların taze bir erime gerçekleştirin (eğer hayvanlar haftada bir kez taşınır ve 15 °C'de tutulursa~ 6 ay).
    6. Genişletme için, tam 60 mm'lik plakayı genişlemek üzere 100 mm plakaüzerine yerleştirin. Bir referans çerçevesi olarak, yabani tip fecundity olan hayvanlar 4ths-6ths içine kesilmiş tam 60 mm plaka olabilir ve 20 °C'de büyük bir plaka üzerine 2 gün veya 15 °C 3 gün boyunca açlıktan ulaşmadan tam 100 mm plaka oluşturmak için parçalara.

2. Ağartma kullanarak solucanların evreleme/senkronizasyonu

  1. Solucanları senkronize etmek için beyazlatma protokolü
    1. M9 kullanarak agar plakalarından gravid solucanları (yumurta dolu yetişkinler) yıkayın(Tablo 1). Senkronize olmayan bir solucan popülasyonundan (örneğin, adım 1.1.6'dan parçalanmış solucanlardan) deneyler için ağartıcılığa başlayın, çünkü beyazlatma yoluyla birbirini izleyen senkronizasyon turlarında önemli genetik sürüklenme oluşabilir.
    2. Solucan/M9 karışımını cam pipet kullanarak 15 mL konik bir tüpe taşıyın; solucanlar birkaç tabak tek bir 15 mL konik tüp içine toplanabilir.
    3. 1.000 x g30 s aşağı hayvanları spin . Aspire M9 supernatant. Korkunç miktarda kontaminasyon veya büyük bakteri kümeleri olmadığı sürece artık bakterileri yıkamak gereksizdir. Bu durumda, M9 ile birkaç yıkar gerçekleştirin.
    4. Yeni bir beyazlatma çözeltisi stoku hazırlayın (Tablo 1). Beyazlatma çözeltisi 4 °C'de birkaç gün saklanabilir, ancak verimsiz beyazlatma, tüm solucan leşlerini ortadan kaldırmadan önce yumurtalara zarar verecek düzensiz beyazlatma ile sonuçlanabileceğiiçin taze yapılmış beyazlatma solüsyonu kullanılır.
    5. Hayvanlara 2-10 mL beyazlatma çözeltisi ekleyin (her ~0,1 mL hayvan peleti için ~1 mL çamaşır suyu çözeltisi). Çamaşır suyu ve solucan karışımını ~5 dk (10 dakikayı geçmez; ağartma süreleri değişebilir ve her laboratuvar için özel olarak titre edilmelidir) tersine çevirin. Solucan leşlerinin daha hızlı çözülmesine ve yumurtaların en iyi şekilde korunmasına yardımcı olmak için şiddetle sallayın. Periyodik olarak bir diseksiyon mikroskobualtında bakmak veya yetişkin solucan karkas tamamen çözülmüş ve sadece yumurta tüp kalır gözlemlemek için bir ışık konik tüp koymak.
    6. 30 s için 1.000 x g iplik ve daha sonra supernatant aspire ederek yumurta pelet. Yumurtalar bütünlüklerini bozmadan solucanlardan daha hızlı santrifüj edilebilir, bu nedenle santrifüj hızından emin değilseniz, yumurtalar fizyolojilerini etkilemeden 2.500 x g'ye kadar döndürülebilir.
    7. M9'u 15 mL'ye kadar ekleyin ve yumurtaları temizlemek için tüpü ters çevirin.
    8. Tekrar adımları 2.1.6-2.1.7 (yıkama / pelet süreci) 2-3 kez daha fazla kez çamaşır suyu kaldırmak için.
    9. Pipet yumurta/M9 plakalar üzerine karıştırın ve deneme için 15-20 °C'de büyür. Kaç solucan kullanılacağını ölçmek için, bir agar plaka veya slayt üzerine 5 μL yumurta karışımı pipetleme ve hacim 1 μL başına yumurta sayısını belirlemek için 5 ile yumurta sayısını bölerek yaklaşık yumurta sayımları gerçekleştirin. Ortalama 3 bağımsız sayım doğruluğu artırabilir. Açlığı önlemek için,plaka başına önerilen yumurta sayımları tablosu Tablo 2'de mevcuttur.
    10. Gerekirse, L1 20 °C'de yumurta/M9 karışımını 24 saate kadar bir rotatöre yerleştirerek daha sıkı zamansal senkronizasyon için hayvanları tutuklar. Yabani hayvanlarda, L1 48 saate kadar hapsedildiğinde hayvan fizyolojisinde herhangi bir kusur saptanmadı. Ancak, açlık duyarlı mutantlar (örneğin, lizozom veya otofaji mutantlar) L1 arresting ile çok kötü yapmak, ve bu nedenle açlık duyarlı olduğu bilinen mutantlar için bu senkronizasyon yöntemi gerçekleştirmek için tavsiye edilmez. L1 tutuklanamayan hayvanlar için daha sıkı senkronizasyon gerekiyorsa, bölüm 2.2'de açıklanan yumurta yumurtlama yöntemini kullanın.
  2. Solucanları senkronize etmek için yumurta lay protokolü
    NOT: Beyazlatma için alternatif bir yöntem olarak, bir yumurta-lay tsay yapılabilir. Yumurta-lay hayvanların beyazlatma yeterince senkronizasyon sağlamaz zaman kullanılır, yetişkin hayvanların yumurta kese içinde yumurta olarak farklı olabilir gibi 8-12 saat arayla. Hayvanların mümkün olduğunca yakından sahnelenmelerinin kritik olduğu, ancak L1'in tutuklanmasının mümkün olmadığı deneysel paradigmalar için (örneğin, açlık mutantlarında) yumurta yumurtlama tahlilleri önerilir. Ancak, yumurta lay protokolünde yer alan işgücü nedeniyle, yüksek ölçekli deneyler yapmak daha az mümkün olduğu unutulmamalıdır.
    1. Standart bir OP50 veya HT115 tohumlu NGM plakasına 4-12 gravid yetişkin yerleştirin (bkz. adım 2.2.2'den sonra not) (bakteriyel suşlarla ilgili öneriler için yukarıdaki Bölüm 1'e bakın). Deneylerin ölçeğine bağlı olarak, birden fazla plaka kullanılabilir. Adım 2.2 için her plakaüzerinde kaç hayvan olduğunu dikkatlice belgelediğinden emin olun.
    2. Hayvanları deneyler için istenilen sıcaklığa (15-20 °C) 4-8 saat yerleştirin.
      NOT: Hayvanların tabakta kalan saat sayısı, ilk yumurtanın ne kadar senkronize edildiğini ve son yumurtanın ne kadar senkronize olacağını belirleyecek, böylece zamanlama gerektiği gibi ayarlanabilir. Daha kısa kuluçka süreleri her hayvanın yumurtlamak için daha az zamanı olduğu anlamına geldiğinden, yeterli yumurtanın yumurtlanmasını sağlamak için tabaklara daha fazla hayvan yerleştirilmelidir. Gerçek yumurta yumurtlama oranı tamamen normale değil iken hayvanların yumurta yumurtlama normalleştirilmiş bir oranı yerine kısa patlamalar geçmesi eğilimi nedeniyle, hayvan başına yatırılan yumurta ortalama oranı ~ 5 yumurta/ saat yabani tip fecundity sergileyen hayvanlar için tahmin edilebilir19. Gün 1 yetişkin aşamasına hayvan yetiştirmeye çalışırken, zaman yumurta yumurtlamak için plaka başına <100 yumurta açlıktan önlemek için (plaka başına önerilen hayvanlar hakkında daha fazla bilgi için Tablo 2 bakın).
    3. Yetişkin hayvanları tabaklardan çıkarın. Tüm yetişkin hayvanların tabaklardan çıkarıldığından emin olun, çünkü hayvanlar yumurtlamaya devam edecek ve senkronize olmayan bir popülasyona ve/veya plakanın açlıktan ölmesine neden olacaktır.

3. Transkripsiyonel muhabirlerin görüntülenmesi için solucanların büyüme koşulları

  1. Solucanların büyümesi
    1. 100 g/mL karbenicillin ve 20 g/mL tetrasiklin ile desteklenen LB ortama istenilen hedef gen(ler) karşı rnai kaseti taşıyan ve/veya rnai kaseti taşıyan HT115'in bakteri kültürünü aşılamak.
    2. Bir gecede kültür büyümek (~ 16 saat) sallayarak 37 ° C inkübatör doygunluk için.
    3. Spot 60 mm NGM RNAi plakalar 200 μL doymuş bakteri kültürü ve 100 mm NGM RNAi plakaları ile 1.000 μL doymuş bakteri kültürü. Ortam sıcaklığında (~22 °C) bir gecede karanlıkta kurusun (alüminyum folyo ile gevşek bir şekilde kaplanmış).
    4. Floresan muhabirleri taşıyan transgenik solucanların senkronize popülasyonunu (tam liste için Tablo 3'e bakınız) tercih edilen bakterilerle tohumlanmış NGM RNAi plakalarına yerleştirin.
    5. 15-20 °C'de büyüyebilir ve aşağıda belirtildiği gibi belirli muhabirler için gerekli aşamalara kadar büyür.
  2. Deneyler için solucanların evrelemesinde dikkat edilmesi gerekenler
    1. L4 hayvanları gerektiren tahliller hariç, yetişkinliğin ilk gününde transkripsiyonel muhabirler için deneyler yapın. WormAtlas'a göre, L4 hayvanları yumurta evresinden yaklaşık 2,5 gün (~56 saat) yumurta evresinden(www.wormatlas.org)20 °C'de büyüme elde edilir.
    2. "1. gün yetişkinler" için, yumurta kaplama sonra 20 °C büyüme yaklaşık 3-4 gün (~ 65-96 saat) hayvan kullanın.
      NOT: Bu geniş aralık şu şekilde açıklanabilir: ~65 saat 20 °C'de hayvanların gerçek "yetişkinlik" durumu olan "yumurtlama"ya ulaşmasıdır. 96 saat, hayvanların WormAtlas'ın "yumurtlama maksimal" olarak tanımladığı şeye girmesidir, bu da yetişkinin bir yetişkin olduğu ve tam bir yumurta kesesi olduğu zamandır. Bu, hayvanların 1. Burada açıklanan tahliller için, bu ~ 65-96 h penceresinde hayvanları kullanırken büyük farklılıklar gözlenmemiştir.
    3. Tek bir denemenin kopyaları için, daha sağlam tekrarlanabilirlik için benzer bir zaman noktası kullanın (örneğin, tüm deneyleri yumurta kaplamadan sonra ~65 saat veya ~96 saat yapın).
      NOT: Bazı transgenik hayvanlar ve mutantlar büyüme oranlarının yavaşolduğunu gösterirler. Bunun için iki öneri vardır. 1) Deneylerin aynı anda yapılabilmesi için hayvanların farklı zamanlarda ağartılabildiği şaşırtıcı senkronizasyon kullanın. Bu durum, tahlildeki teknik değişkenlik senkronizasyon testinden kaynaklanabilecek teknik değişkenliklerden daha büyük olabilirse (örneğin, uzun süre çalışan sağkalım tahlilleri aynı anda yapılmazsa zarar görebilir). 2) Hayvanların aynı anda ağartılabildiği, ancak tahlilin kendisinin farklı zamanlarda yapıldığı şaşırtıcı analizler kullanın. Bu, doğal değişkenliğe sahip olmayan çok basit tahliller için önerilir (örn. stres yanıtlarının RNAi-indüksiyonu).

4. Stres yanıtlarının indüksiyonu

  1. UPRER'in aktivasyonu için hsp-4p::GFP'nin kullanımı
    1. RNAi kullanarak ER stresini indükleyen
      1. Bölüm 3'te olduğu gibi NGM RNAi plakalarına(Tablo 1)ilgi genini hedefleyen RNAi bakterisi ile tespit edilen plakaları hazırlayın. Bazal UPRER düzeyleri ve tag-335 RNAi knockdown için bir kontrol olarak EV kullanın (ER yerleşik proteinlerin N-bağlı glikozilasyon enzimi; RNAi knockdown tunicamycin tedavisi ne benzer etkileri vardır) ER stres altında UPRER aktivasyonu için olumlu bir kontrol olarak.
      2. Bölüm 2'de açıklanan yöntemleri kullanarak hsp-4p::GFP muhabiri hayvanları senkronize edin.
      3. Tablo 2'deönerilen kriterler kullanılarak RNAi plakalarına yumurta plakası.
      4. Yetişkinliğin ilk gününde deneyler yapmak için yumurtaları yaklaşık 3-4 gün (~65-96 saat) 20 °C'de kuluçkaya yatırın. UPRER deneyleri için, farklı sıcaklıklarda yetiştirilen hsp-4::GFP muhabirinin bazal floresansında farklılıklar vardır. Bu nedenle tüm deneyleri 20 °C'de gerçekleştirin.
    2. Kimyasal madde kullanarak ER stresini indükleyen
      1. Bölüm 2'de açıklanan yöntemleri kullanarak hsp-4p::GFP muhabiri hayvanları senkronize edin ve hayvanlar L4 aşamasına ulaşana kadar 20 °C'de büyüyün. Hayvanları M9 tüpüne aktarın. Solucanların yerleşmesine izin verin (~2-3 dk yerçekimi veya 1000 x g'de30 s spin), ve sonra M9'u çıkarın.
      2. Tunicamisin'i M9'da 25 ng/mL'ye seyreltin (1 mg/mL stoğundan 1:40 seyreltme). Bir kontrol olarak, aynı zamanda M9 DMSO eşdeğer hacmi seyreltmek.
      3. Solucanlara 25 ng/mL tunicamycin/M9 ekleyin veya DMSO/M9 çözeltisini kontrol edin (1,5 mL'lik bir tüp için 400-500 mL veya 15 mL konik tüp için 2 mL kullanın). 20 °C'de döner bir platformda 3-4 saat kuluçkaya yatırın.
        NOT: Tunicamycin de doğrudan solucan/M9 karışımı içine seyreltilebilir.
      4. Solucanların yerleşmesine, M9/TM çözeltisini çıkarmasına ve 1 mL M9 ile yıkamasına izin verin.
      5. Hayvanları NGM plakalarına veya NGM RNAi plakalarına aktarın ve floresan mikroskopi (bölüm 5) gerçekleştirmeden önce bir gecede (veya ~15-20 saat) ve yetişkinliğin 1.gününe 20 °C'de ulaşmalarını bekleyin. Bir gecede kurtarma GFP tespit edilebilir bir düzeyde birikmesi için izin vermek için gerçekleştirilir.
      6. Alternatif olarak, 16-24 saat boyunca 25 ng/μL tunicamycin içeren agar plakalarına L4 hayvanlarını taşıyarak hsp-4p::GFP'yi indükleyin. Bu, daha uzun stres süresi nedeniyle hsp-4p::GFP'nin çok daha sağlam bir indüksiyonuna sahiptir ve böylece dinamik aralık yukarıda açıklanan adadan çok daha düşüktür.
  2. UPRMT etkinleştirme için bir okuma olarak hsp-6p::GFP kullanma
    1. RNAi kullanarak mitokondriyal stresin indükleyici
      1. Bölüm 4.1.1 ile aynı protokolü izleyerek UPRMT'yi aktive edin, cox-5b/cco-1 (sitokrom c oksidaz alt birimi 5B; nakavt elektron taşıma zinciri aktivitesini inhibe eder) gibi mitokondriyal genlerin RNAi nakavtını kullanmak dışında. ELEKTRON taşıma zinciri fonksiyonunda pertürbasyonlar yoluyla UPRMT aktivasyonu için, RNAi knockdown erken geliştirme sırasında yapılması gerekir20. Bu nedenle, bu deneyler için ambardan RNAi gerçekleştirin.
    2. Kimyasal madde kullanarak mitokondriyal stresin indüklemesi
      1. Bölüm 3'teki gibi ilgi genini hedefleyen RNAi bakterisi ile tespit edilen plakaları hazırlayın. RNAi nakavtı içermeyen deneylerde bile HT115 bakterilerini kullanın (Bkz. Bölüm 1). Her iki NGM RNAi plaka (veya NGM RNAi + DMSO0.2) ve NGM RNAi + antimycin A plakaları(Tablo 1)her ikisi de adım 4.2.2.5 için hazır olduğundan emin olun.
      2. Bölüm 2'de açıklanan yöntemleri kullanarak hsp-6p::GFP veya hsp-60p::GFP muhabiri hayvanları senkronize edin.
      3. Tablo 2'deönerilen kriterler kullanılarak tercih edilen tohumlu tabaklara yumurta plakası. Antimisin A DMSO'da çözündilen için, ambardan NGM RNAi + DMSO0.2 plakaları üzerinde hayvanları büyütün.
      4. Yumurtaları 20 °C'de 2 gün (~56 saat) l4 aşamasına kadar kuluçkaya yatırın. Alternatif olarak, 15 °C'de 3 gün (~75 saat) hayvan yetiştirin.
      5. Solucanları NGM RNAi + DMSO0.2 plakalarından NGM RNAi + antimisin A plakalarına veya NGM RNAi + DMSO0.2 plakalarına kontrol edin. Solucanlar küçük ölçekli deneyler için bir seçim ile elle hareket ettirilebilir, ancak büyük ölçekli deneyler için, biz santrifüj ile yerleşme, M9 aspire, ve sonra NGM RNAi + antimisin A plakaları kaplama, M9 ile hayvan yıkama öneririz.
      6. Ek bir ~ 20 saat ve görüntü gün 1 yetişkin (bölüm 5) için kuluçka solucanlar.
  3. Oksidatif stres yanıtı için bir okuma olarak gst-4p::GFP kullanarak.
    1. RNAi kullanarak OxSR indükleme
      1. Alternatif olarak, gst-4p::GFP wdr-23 RNAi-knockdown kullanarak (bu skn-1olumsuz bir regülatör kodlar ; böylece, onun knockdown OxSR neden) bölüm 4.1.1 açıklanan protokolü kullanarak.
    2. Kimyasal oksidan Tert-bütil hidroperoksit (TBHP) maruz kalma kullanarak OxSR indükleme
      1. Bölüm 3'teki gibi ilgi genini hedefleyen RNAi bakterisi ile tespit edilen plakaları hazırlayın. RNAi nakavtı içermeyen deneylerde bile HT115 bakterilerini kullanın (Bkz. Bölüm 1).
      2. Bölüm 2'de açıklanan yöntemleri kullanarak gst-4p::GFP muhabiri hayvanları senkronize edin.
      3. Tablo 2'deönerilen kriterler kullanılarak tercih edilen tohumlu tabaklara yumurta plakası. İlaç tedavi protokolü hayvanların %10-20'sinin kaybına yol açtıklarından, gerekenden daha fazla tabak hazırladığından emin olun. Görüntüleme için >100 hayvanla başlayın ve sıralama için >1000 hayvanla başlayın.
      4. 20 °C'de 2 gün (~56 saat) l4 aşamasına kuluçkaya yatırın. Alternatif olarak, 15 °C'de 3 gün (~75 saat) hayvan yetiştirin.
      5. L4 hayvanlarını tabaklardan yıkayın ve her koşulda iki tane 15 mL konik tüpe bölün. Aspire hacmi en az 1 mL'ye kadar inin ve taze yapılmış 2 mM TBHP eşit hacim ekleyin. Daha düşük hacimlerde dönerken solucanların önemli ölçüde ölümüne neden olabileceğinden, toplam sıvı hacmini en az 2 mL olarak kullanın. Plakalardan arta kalan bakteriler kuluçka sırasında solucanların aşırı aç kalmamasını sağlamaya yardımcı olacağından, ilaç tedavisinden önce yıkamayın.
      6. 20 °C'de 4 saat boyunca rotator üzerinde kuluçka solucanları.
      7. Solucanları 1.000 x g'dedönerek, M9 + TBHP karışımını keserek ve 15 mL M9 ile değiştirerek yıkayın. İkinci bir yıkama için tekrarlayın.
      8. 20 °C'de bir gecede (~16-24 saat) kurtarmak için EV RNAi'deki plaka solucanları. Solucanlar seçim RNAi eşleşen kurtarılabilir, ancak EV RNAi kurtarıldı zaman önemli bir fark görüldü, bu yüzden bu deneysel kurulum kolaylığı için yapılabilir. İyileştikten sonra 1.
        NOT: Bir gecede kurtarma GFP algılanabilir bir düzeyde birikmesi için izin vermek için gerçekleştirilir. Bu kurtarma olmadan, algılanabilir GFP sinyali yoktur. Daha kısa vadeli bir iyileşme isteniyorsa, bölüm 4.3.3'te açıklanan sonucu kullanmak mümkündür.
    3. Kimyasal oksidan paraquat (PQ) maruz kalma kullanarak OxSR indükleme
      1. Durum başına 15 mL konik tüpler de L4 gst-4p::GFP hayvanların 2 toplu almak için bölüm 4.2.2 tüm adımları tekrarlayın.
      2. Aspire hacmi en az 1 mL'ye kadar inin ve eşit hacimde taze yapılmış 100 μM PQ ekleyin. 4.3.2.5'e benzer şekilde en az 2 mL hacim önerilir.
      3. 20 °C'de 2 saat boyunca rotator üzerinde kuluçka solucanları.
      4. Solucanları 1.000 x g'dedönerek, M9 + PQ karışımını keserek ve 15 mL M9 ile değiştirerek yıkayın. İkinci bir yıkama için tekrarlayın.
      5. EV RNAi'deki plaka solucanları 20 °C'de 2 saat boyunca iyileşir ve iyileşmeden hemen sonra fotoğraf çekerler.
        NOT: 2 saat kurtarma GFP indüksiyonu görselleştirmek için gerekli minimum kurtarma oldu.
  4. HSP-16.2p::GFP ve hsp-70p::GFP kullanarak HSR aktivasyonu için bir okuma olarak.
    1. Yüksek sıcaklıklara maruz kaldıktan sonra HSR'yi indükleme
      1. Bölüm 3'teki gibi ilgi genini hedefleyen RNAi bakterisi ile tespit edilen plakaları hazırlayın. RNAi nakavtı içermeyen deneylerde bile HT115 bakterilerini kullanın (bkz.
      2. Bölüm 2'de açıklanan yöntemleri kullanarak hsp-16.2p::GFP veya hsp-70p::GFP muhabiri hayvanları senkronize edin.
      3. Tablo 2'deönerilen kriterler kullanılarak tercih edilen tohumlu tabaklara yumurta plakası. Numunenin yarısı ısı şoku indüksiyonu için yüksek sıcaklıklara maruz kalacak ve diğer yarısı Ise ısı şoku olmayan bir kontrol olarak hizmet verecek olarak gerekli plaka sayısını 2 kat hazırlamak için emin olun.
      4. Yetişkinliğin ilk gününde deneyler yapmak için yumurtaları yaklaşık 3-4 gün (~65-96 saat) 20 °C'de kuluçkaya yatırın. 15 °C'den 20 °C'ye karşı ısı şoku yaşayan hayvanlar arasında küçük farklılıklar olduğu için, ısı şoku deneyleri için 15 °C'de solucan yetiştirmeyin.
      5. Deneysel hayvan gruplarını 34 °C'lik bir kuluçka makinesine taşıyın ve plakaları tek bir tabaka halinde kuvöze yerleştirin (yani, plakai istiflemeyok) plakalar arasında ısının en hızlı ve en eşit dağılımını sağlayın.
      6. Isı şoku olan hayvanları 20 °C'lik bir kuluçka makinesine taşıyın ve hemen 2 saat boyunca iyileşin ve hemen görüntüleyin (Bkz. Bölüm 5). Daha yüksek GFP indüksiyonu için gerekirse hayvanlar daha uzun süre geri kazanılabilir.
        NOT: 2 saat kurtarma GFP indüksiyonu görselleştirmek için gerekli minimum kurtarma oldu.

5. Stereo mikroskop veya düşük büyütmeli geniş alan/bileşik mikroskop kullanarak görüntüleme

  1. Floresan mikroskopi için solucanların hazırlanması
    1. Standart bir NGM plakasının üzerine 5-10 μL 100 mM sodyum azit (yani bakteri yok)
      NOT: Sodyum azit konsantrasyonu 10 mM'ye kadar düşebilir, ancak en sağlam immobilizasyon 100 mM sodyum azitte floresan sinyal üzerinde saptanabilir bir etki olmadan gözlenmiştir.
    2. Bir diseksiyon mikroskobu altında, deneysel plakalar 10-20 hayvan almak ve sodyum azid noktaya aktarın. Hayvanlar sodyum azitin içine indikten kısa bir süre sonra hareketlerini durdurmalıdır ve sodyum azitin kendisi saniyeler içinde buharlaşır.
    3. Sodyum azid buharlaştıktan sonra hayvanları istenilen görüntüleme düzenine göre sırala. Tüm hayvanlar için aynı yönde anterior ve arka yanları ile yan yana hayvanları taşıyın. Görüntüleri hayvanlar hemen.
      NOT: Sodyum azitte felç olduktan sonra Tablo 3'teki transkripsiyonel muhabirlerin herhangi birinde 15 dakikaya kadar muhabir sinyalinde herhangi bir değişiklik gözlenmedi.
  2. Stereomikroskop kullanarak görüntü edinimi
    NOT: Bu protokol için Leica DFC3000G monokromatik CCD kamera, standart Leica GFP filtresi (ex 395-455, EM 480 LP) ve LAS X yazılımı ile donatılmış bir Leica M205FA mikroskobu kullanılmıştır. Pozlama süreleri için önerilen ayarlar Tablo 4'tebulunabilir.
    1. LAS X programını başlatın.
    2. Yeni bir proje başlatın: Satın alma sekmesini açın, Projeleri Aç'a tıklayın ve yeni bir proje açmak için Klasör'ü tıklatın. Bu proje, klasörü sağ tıklayarak ve Yeniden Adlandırma'ya doğru kaydırılarak veya F2'yitıklatarak yeniden adlandırılabilir. Edinme sekmesinde, pozlama süresini ayarlamak ve istenen ayarları yakınlaştırmak için seçenekler de vardır.
    3. Solucan örneğini mikroskop hedefinin altına yerleştirin ve floresan ağartmayı en aza indirmek için parlak alan ayarını kullanarak solucanların doğru odak noktasını bulun. Örneğin merkezi yumurta hattı açıkça görülebilir ve bulanık değildir. Pozlama süresini, yakınlaştırmayı, netleşme yi ve parlak alan kondansatörlerini istenilen ayarlara ayarlayın.
    4. Görüntü Yakalama düğmesini kullanarak bir görüntü elde edin.
    5. Tüm ham görüntüleri ve meta verileri kaydederken görüntüyü .lif (Leica Image File) biçiminde kaydedin. TiFF, resmi (veya projeyi) sağ tıklayarak ve Kaydet seçeneği nin altında TIFF'itıklatarak da dışa aktarılabilir. Bu, tüm kanalları (örn. parlak alan ve GFP) herhangi bir değişiklikle birlikte saklar (örneğin, kontrast ayarlanmışsa, bu DURUM TIFF'e kaydedilir).
  3. Floresan görüntülerin nicel analizi
    1. Nicel analiz yapılacaksa, 3-B görüntüler alın. Bu, sağ üstte "z" etiketli z bölümü seçeneğine tıklayarak gerçekleştirilir. Bu kutu kırmızıysa Z bölümleri etkin olacaktır.
    2. Ayarlanabilir seçeneklerin sol alt kısmındaki aralığı ve dilim kalınlığını seçerek z kesitlerini optimize edin. Mümkün olduğunda, en iyi ayarlar için Sistem Optimize Edilmiş düğmesini kullanın.
    3. Görüntüyü yakalayın ve yukarıdaki bölüm 5.2'de açıklandığı gibi görüntüyü saklayın. Daha kolay ölçümler için solucanları aralarında boşluklarla hizalayın.
    4. TIFF görüntülerini tercih edilen görüntüleme yazılımına (örneğin, ImageJ) aktarın.
    5. ImageJ için, Analiz menüsünden Ölçümleri Ayarla'yıseçin. Aşağıdakileri kontrol edin: alan, ortalama gri değeri, entegre yoğunluk, ekran etiketi.
    6. YG (ilgi alanı) aracını kullanarak bir YG çizin. Her solucanı ayrı ayrı ölçün. Analiz menüsünden Ölçü'yü seçin veya Mtuşuna basın. Solucanların olmadığı arka planda bir ygonçizin ve arka planı aynı şekilde ölçün. Sonuçlar penceresinde görünen ölçümleri kopyalayın veya kaydedin.
    7. Arka plan tümleşik yoğunluğunu ölçülen her roi'nin tümleşik yoğunluğundan çıkarın. Bir YG'nin arka plan yoğunluğu, arka plan daki ortalama gri değerin ürünü ve çizilen Yatırım Getirisi alanı olarak tanımlanır.
  4. Bileşik/geniş alan mikroskobu kullanarak görüntü edinimi
    NOT: Transkripsiyonel muhabirlerin bileşik/geniş alan mikroskobu kullanılarak görüntülenmesi için, bu protokol olympus 4x Plan Florit NA 0.13 objektif lens( standart Olympus FITC filtresi (ex 470/40; em 525/50; DM 560) ve kamera ve ECHO yazılımı sürücü için bir iPad Pro. Pozlama süreleri için önerilen ayarlar Tablo 4'tebulunabilir.
    1. Kontrol programını başlatmak için dokunmatik yüzeyi kullanın. Yeni bir albüm ve dosya adı oluşturun.
    2. Plakayı objektif lensin altına yerleştirin. Sinyalin görünür olmasına ancak doymamış olması için taban çizgisi (EV/kontrol tedavisi) ve pozitif kontrolü kullanarak pozlama süresini ve floresan yoğunluğunu ayarlayın.
    3. Parlak alan görüntüsünü ve GFP/FITC görüntüsünü kaydedin.

6. Büyük parçacık akış sitometresi kullanan muhabirlerin nicel ölçümleri

NOT: Büyük parçacık akış sitometre analizi için solucanların büyümesi ve hazırlanması, daha fazla sayıda hayvanın gerekli olması dışında, floresan görüntüleme için solucanların hazırlanması için 1-5 numaralı bölümlerle aynı paradigmaları takip edebilir. Kullanım >500 hayvan, bazı hayvanlar manipülasyon sırasında kaybolduğundan, tüm hayvanlar sayısallaştırma sırasında filtreleme kriterlerini geçemez ve bazı hayvanlar akış sitometresi tarafından düzgün bir şekilde okunmaz. 5-10 mL M9 çözeltisi içinde plakaları 15 mL konik tüpler halinde ayıklamak için hazır hayvanları yıkayın.

  1. Büyük bir parçacık akış sitometrekullanarak sıralama kurulumu
    1. Akış sitometresini açmadan önce
      1. Kılıf sıvı şişe boş olmadığından emin olun. Ayırıcıyı kullanmadan en az birkaç saat önce 250x stoğundan kılıf sıvısı hazırlayın, çünkü kılıf sıvısında az miktarda deterjan vardır, bu da satın alma sırasında yapılara neden olabilecek kabarcıklara neden olabilir.
      2. Tüm atık konteynerlerinin dolu olmadığından emin olun.
    2. Akış sitometresini açma
      1. Hava kompresörü açın. Otomatikolarak çevirin. Basınç göstergesi kontrol edin - 30 psi civarında olmalıdır.
      2. Aleti aç. Cihazın solundaki güç kablosunun yanındaki güç anahtarını kullanın.
      3. Lazerleri aç. Kırmızı floresan için daha yüksek uyarma gerekiyorsa 561 nm ışık kaynağının kullanılması gerekmesine rağmen, 488 nm ışık kaynağı genellikle çoğu deney için yeterlidir.
      4. FlowPilot yazılımını açın; cihaz farklı vanalar üzerinde anahtarlama tıklama bir dizi yapmalıdır.
      5. Başlat'ıtıklatarak yazılım penceresindeki lazerleri açın. Çalıştır'ıtıklatarak Argon lazer kontrol açılır penceresine lazer başlatın. Bu lazer açmak ve yaklaşık 12 mW ulaşmak neden olmalıdır. 488 ışık kaynağı seviyesi 12 civarına çıkacak.
      6. Pencereyi kapatmak için Bitti'yi tıklatın.
    3. İlerlemeden önce yazılımı denetler
      1. Basınç göstergelerini kontrol edin -Pencerenin alt kısmında görüntülenen 4 basınç değerlerine bakın. Değerler orijinal kurulum etrafında olmalıdır (Sheath 5.5-5.7; Örnek 5.7-6.0; Ayıklayıcı 3.1-3.3; Temiz 8.5-8.7). Benzer görünüyorsa, Pressure Ok'unyanındaki kutuyu işaretleyin.
      2. Akışkanları kontrol edin -Akış hücreden kılıf/numune akışını engelleyen hava kabarcıkları ve enkaz olmadığından emin olmak için birkaç kez Temiz'i tıklatın.
      3. Kılıf akış hızını kontrol edin -Bunun için, 60 s. Switch Off Sortiçin kılıf toplamak, sonra kılıf akışını başlatmak için manuel kontrollerde Kılıf açık açın. 60 s için 15 mL tüp içinde toplayın; akış hızı ~9-10 mL/dk olmalıdır.
    4. Akış sitometresi kullanılmadan önce temizleme
      1. Toplama 'fincan' içine % 10 çamaşır suyu çözeltisi ~ 3-5 mL koyun ve Kazan'ıtıklatın. ~30 s için çalıştırın, Aborttıklayın ve vakum ile fazlalığı kaldırın.
      2. Deiyonize su ile toplama 'fincan' durulayın ve vakum ile çıkarın. Tekrar 2x.
      3. ~3-5 mL COPAS temizleme çözeltisini koleksiyon 'fincan' içine koyun ve Satın Al'ıtıklatın. ~30 s için çalıştırın, Aborttıklayın ve vakum ile fazla temizleme solüsyonu kaldırın.
      4. Deiyonize su ile toplama 'fincan' durulayın ve vakum ile çıkarın. Tekrar 2x.
      5. ~3-5 mL M9 çözeltisini koleksiyon 'fincan' içine koyun ve Satın Al'ıtıklatın. ~30 s için çalıştırın, Durdur'atıklayın ve vakum ile aşırı M9 çözüm kaldırın.
  2. Örnekleri sıralayıcıda çalıştırma
    1. Lazer PMT gücünü ve boyut gating'i, transkripsiyonel muhabirin en parlak aktivasyonuna neden olan duruma göre ayarlayın. Önerilen ayarlar Tablo 4'tebulunabilir.
    2. 'fincan' için hazırlanan solucanlar ekleyin. Satın Al'ıtıklatın. Tüm sıvımakineiçine alınmadığından emin olmak için izleyin; bu akış sitometre hava almak ve dedektörde kabarcıklar oluşturmak neden olur.
    3. Örnek düşük olduğunda ve/veya yeterli hayvan toplandığında İptal'i tıklatın.
    4. Kurulum'a tıklayın | Veri Depolama | Sadece Kapılı. Bu, verileri yalnızca boyut kısıtlamalarına göre kaydeder. Kapılı Depola'yı tıklatın ve kapılı verileri kaydedin. Verileri silmek için Sil'i tıklatın.
    5. Deiyonize su ile toplama 'fincan' durulayın ve vakum ile çıkarın. Tekrar 2x.
    6. Diğer örneklerle birlikte 6.2.1-6.2.5 adımlarını tekrarlayın.
  3. Kalibrasyon/ Kalite Kontrol - gerekirse
    NOT: Bu 488 lazer kalibre etmek için sağlanan 42 μM GYR floresan parçacıklar kontrol çalışan gerektirir.
    1. Hava tüpünü çıkarmak için numune kabının üstündeki metal dudağı basın. Kapağı sökün ve numune kabından sıvıçıkarmak için bir şırınga kullanın.
    2. Kullanmadan önce kontrol parçacıkları şişesini karıştırın ve numune kabına birkaç mililitre ekleyin. Kapağı kapatın ve yerine tıklayana kadar bastırarak havayı tekrar tonuyla tutarak tekrar tonuyla kapatın.
    3. Yazılımda, Araçlar seçeneğine gidin ve Denetim Parçacıklarını Çalıştır'ıtıklatın.
    4. Kontrol parçacıkları için PMT değerlerini şu şekilde sıfırlayın: YEŞİl - 325; SARI - 365; KIRMIZI - 575.
    5. Satın Al'ıtıklatın. Kılıf, numunenin ardından açılmalıdır. Boncuklar akış hücresinden geçmeye başladıktan sonra, akış hızı ekranın alt kısmında görülecektir. En uygun şekilde, akış hızı 5/s ile 15/s arasında olmalıdır. Akış hızı çok düşük veya sıfırsa, akış hızını artırmak için numune valfini fiziksel olarak saat yönünde çevirin. Akış hızı çok yüksekse, akış hızını azaltmak için numune valfini saat yönünün tersine çevirin.
      NOT: Normalde, boncuk koruyucu modu altında, 500 boncuk kapatmadan önce okunur. Veriler silinebilir ve boncuklar yeniden okunabilir.
    6. Okuma tamamlandıktan sonra, 5 parametrenin yanı sıra CV değerleri için temiz tek tepe noktalarını kontrol edin. Varyans Katsayısı (CV) <%15 olmalıdır. Ayrıca, üç farklı floresan kanalın CV değerlerinin birbirine yakın olduğundan emin olun.
    7. QC denetiminin kaydını yapın: Dosya sekmesinin altında ekran görüntüsü olarak Kaydet'itıklatın.
  4. Temizleme ve kapatma
    1. Numuneyi numune kabından çıkarmak için bir vakum kullanın ve bölüm 4.1.4'ü tekrarlayın.
    2. Toplama 'fincan' içine deiyonize su ~ 3-5 mL koyun ve Edinmetıklayın , ~ 30 s için çalıştırın ve sonra Aborttıklayın . Örnek kabın arkasında biraz distile su bırakın.
    3. Numune geri kazanım kabını ve atık şişeyi boşaltın.
    4. Yazılımı kapatın. Dosya sekmesinin altında, Çıkış'ıtıklatın. Açılır menüde, Temizlemeden Kapat'ıtıklatın.
    5. Lazeri kapatın, aleti kapatın ve sonra hava kompresörü kapatın. Aleti kapatmak için kapağı kapatın.

7. C. elegans stres duyarlılığıölçmek için fizyolojik tahliller

  1. Tunicamisin maruziyeti kullanarak ER stres hassasiyetinin ölçülmesi
    1. Bölüm 3'te olduğu gibi ilgi genini hedefleyen RNAi bakterisi ile tespit edilen NGM RNAi DMSO plakalarını hazırlayın. RNAi nakavtı içermeyen deneylerde bile HT115 bakterilerini kullanın (Bkz. Bölüm 1). Ayrıca NGM RNAi TM plakaları tohum unutmayın (Tablo 1bakınız). Yeterli miktarda plaka tohum: ~5-7 set NGM RNAi DMSO plakaları ve ~2-3 set NGM RNAi TM plakaları için plan.
    2. Bölüm 2'de açıklanan yöntemleri kullanarak tercih ettiği hayvanları senkronize edin.
    3. Plaka yumurta NGM RNAi DMSO tohumlu plakalar üzerine Tablo 2'deönerilen kriterleri kullanarak tercih edilen. Numunenin yarısı NGM RNAi TM plakalarına aktarılacaktır olarak gerekli plaka sayısını 2 kat hazırlamak için emin olun.
    4. 20 °C'de yaklaşık 3-4 gün (~65-96 saat) yetişkinliğin ilk gününe kadar kuluçkaya yatırın.
    5. 1. gün, hayvanları ayrı plakalara aktararak yaşam sürelerini hazırlayın. Plakaları korumak için (TM maliyetleri yüksek olduğu için), her koşulda 120 hayvan için, her koşulda 15 hayvandan oluşan 8 tabak kullanın. Bu puanlama için plaka başına hayvanların yönetilebilir sayıda sağlar ve istatistiksel analizler için yeterli miktarda hayvan sağlar, bazı sansür bile.
    6. İlk 5-7 gün boyunca, yetişkin hayvanları her gün nesilden uzaklaştırıp yeni bir tabağa taşıyın, ta ki artık soyundan gelene kadar. Bu aşamada, torbalanmış olan sansür hayvanları, vulval çıkıntıları/patlamalar sergiler veya plakaların kenarlarında sürünerek çıkarlar, çünkü bunlar ER stres hassasiyeti ile ilişkili ölümler değildir. TM tedavisinin hayvanlarda arreste neden olduğunu ve bu nedenle bu hayvanların 2-3 günde bir sadece 1-2 hareketinin TM içeren plakaların üretilmesiyle ilgili maliyetleri en aza indirmek için yeterli olduğunu unutmayın. Yabani hayvanlar DMSO~15-17 gün ortalama hayatta kalma ve tunicamcyin 12-14 gün var.
    7. Hayvanlar soy üretmeyi bıraktıktan sonra, tüm hayvanlar ölü veya sansürlü olarak puanlanana kadar her 1-2 günde bir skor ömrü. TM-tedavi hayvanlar gün boyunca her gün 6-14 yetişkinlik daha yüksek çözünürlük için.
  2. Paraquata maruz kalınarak mitokondriyal ve oksidatif stres hassasiyetinin ölçülmesi
    1. Bölüm 3'teki gibi ilgi genini hedefleyen RNAi bakterisi ile tespit edilen plakaları hazırlayın. RNAi nakavtiçermeyen deneylerde bile HT115 bakterisi kullanın (Bkz. Giriş).
    2. Bölüm 2'de açıklanan yöntemleri kullanarak tercih ettiği hayvanları senkronize edin.
    3. Plaka yumurta ngm RNAi tohumlu plakalar üzerine tablo 1önerilen kriterleri kullanarak tercih edilen. Teşbe durum başına ~ 60-100 hayvan çağrısı, bu yüzden buna göre hazırlayın.
    4. 20 °C'de yaklaşık 3-4 gün (~65-96 saat) yetişkinliğin ilk gününe kadar kuluçkaya yatırın.
    5. M9 çözeltisinde 100 mM paraquattaze bir şişe hazırlayın.
    6. Pipet 50-75 μL M9+paraquat düz alt 96-iyi plaka gibi birçok kuyu içine istenilen. Genellikle iyi başına ~ 8-10 hayvan içeren durum başına ~ 8-10 kuyu olması tavsiye edilir. Bu, her su şuya ~80 hayvan ile her kuyuda kolayca görülebilen hayvan sayısı sağlar.
    7. Her koşulda 8-10 hayvan seçin ve M9+ paraquat içeren her kuyuya aktarın. Hacim farklılıklarını ve paraquat konsantrasyonlarında istenmeyen değişiklikleri önlemek için borulama yerine hayvanları kuyulara aktarmak için bir kazma kullanın.
    8. Her 2 saat, her kuyuda hayvanların ölüm için puan. Plakalara hafifçe dokunun, bu da canlı hayvanların dayak yedirmelerine veya bükülmelerine neden olur. Canlı hayvanların bazen ölü olarak puanlanacak kadar felç olması mümkündür. Bu nedenle, canlı hayvan sayısı bir önceki zaman diliminden canlı hayvan sayısını aşıyorsa, hayvanın hayatta olması ve puansız olması olasıdır (örneğin, 4. saat 4'te 2/10 hayvan ölü olarak puanlanırsa ve 6. saatte sadece 1/10 hayvan ölmüşse, saat 4 ölü olarak yeniden puanlanmalıdır).
  3. Yüksek sıcaklıklara maruz kaldıktan sonra ısı yada hassasiyetinin ölçülmesi
    1. Bölüm 3'teki gibi ilgi genini hedefleyen RNAi bakterisi ile tespit edilen plakaları hazırlayın. RNAi nakavtı içermeyen deneylerde bile HT115 bakterilerini kullanın (Bkz. Bölüm 1).
    2. Bölüm 2'de açıklanan yöntemleri kullanarak tercih ettiği hayvanları senkronize edin.
    3. Tablo 1'deönerilen kriterler kullanılarak tercih edilen tohumlu tabaklara yumurta plakası. Termotolerans tahlilleri için durum başına 60-100 hayvan var. Termotolerans tahlilleri için, tahlil hayvanların yaşa göre büyük değişkenlik olduğu gibi en iyi senkronizasyon için L1 tutuklama veya yumurta yatıyordu tahliller kullanın.
    4. Yetişkinliğin ilk gününde deneyler yapmak için 20 °C'de yaklaşık 3-4 gün (~65-96 saat) kuluçkaya yatırın. 15 °C ile 20 °C arasında ısı şoku yaşayan hayvanlar arasında küçük bir fark olduğu için, ısı şoku deneyleri için 15 °C'de solucan yetiştirmeyin.
    5. 1. gün, ayrı plakalar üzerine aktararak hayvanları hazırlamak. Genellikle 60 hayvan toplam, 4-6 plakaile plaka başına ~ 10-15 hayvan olması tavsiye edilir. Bu puanlama için plaka başına hayvanların yönetilebilir bir sayı sağlar ve hayvanların yüksek sıcaklıklarda çekilmesi için en az süre sağlar.
    6. Hayvanları 37 °C'lik bir kuluçka makinesine yerleştirin ve her 2 saat puan. 5 saat öncesinde niçin 37 °C'de termotolerans için puanlama yapmaya başlayın, çünkü 5 saatten önce ölüm meydana gelmez. Ortanca termotolerans ~9 saat, bu nedenle saat 7, 9 ve 11 kritik zaman noktaları, inkübatör ve laboratuvar-laboratuvar değişkenliği nedeniyle, bu laboratuvar başına titre edilmesi gerekebilir rağmen gerçekleştirilir. Ayrıca, değişkenliği azaltmak için her türlü yöntem (örneğin, plakaları istiflememek, plakaları tek bir kuluçka makinesi içinde aynı alana yerleştirmek, kuvözün açılıp kapatılma süresini en aza indirmek, hayvanların 37 °C dışında geçirdikleri zamanı en aza indirmek için bir seferde kuvözden birkaç tabak alarak vb.) yardımcı olacaktır. Tam bir kılavuz için bkz:21).
    7. Adım 7.3.6'ya alternatif olarak hayvanları 37 °C yerine 34 °C'ye yerleştirin. 34 °C'deki ortanca termotolerans 14 saatin biraz üzerindedir, bu nedenle 12, 14 ve 16'daki zaman noktaları 34 °C termotolerans tahlilleri için önemlidir.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Stres yanıtlarının aktivasyonunu ölçmek için transkripsiyonel muhabirleri kullanma
Burada, floresan transkripsiyonel muhabirler kullanılır, Hangi C. elegansen stres yanıtlarının aktivasyon ölçmek için sağlam araçlar olarak hizmet vermektedir. GFP ifadesi, bölmeye özgü streslere yanıt veren ana transkripsiyonel düzenleyicilerin kanonik hedeflerinin organizatörü altında yürütülür. Yaygın olarak kullanılan transkripsiyonel muhabirlerin kapsamlı bir listesi Tablo 3'temevcuttur.

Perturbing ER homeostazı unfolded veya yanlış katlanmış proteinler veya lipid iki katmanlı stres er (UPRER)açığa protein yanıtının aktivasyonu ER kalite ve fonksiyon geri neden olur. UPRER transmembran sensörleri tarafından tanımlanan 3 farklı daldan oluşur: inositol gerektiren protein 1 (IRE1), transkripsiyon faktörü 6 (ATF6) aktive ve protein kinaz RNA (PKR)benzeri ER kinaz (PERK), hepsi C. elegans7,,22,23korunur . Nematod UPRER aktivasyonunu izlemek için en yaygın araç, hsp-4 organizatörü kontrolü altında GFP ifade transkripsiyonel muhabir gerginlik (hsp-4p::GFP)7. Hsp-4 geni memeli Hsp70, HSPA5 (veya BiP/Grp78) bir ortolog kodlar. UPRER etkinleştirildiğinde ER stres zamanlarında, hsp-4p::GFP muhabiri gerginlik GFP ifade eder. Bu muhabir stres yokluğunda minimal bazal ifadeye sahiptir, ancak hayvanlar tunicamycin maruz kaldığında sağlam GFP ifadesi sergiler (Şekil 1A). Bu farklılıklar büyük parçacık akış sitometresi kullanılarak da ölçülebilir (Şekil 1B). Ayrıca, ER stres altında hsp-4p::GFP indüksiyon tamamen XBP-1RNAi-knockdown tarafından bastırılmış olabilir , Bu transkripsiyon muhabiri aktivasyonu transkripsiyon faktörü bağlıdır gibi, XBP-112.

UPRERbenzer , mitokondri proteotoksik strese karşı kendi koruyucu mekanizma evler. Bu mekanizma, mitokondriyal UPR denir (UPRMT)24, esas olarak transkripsiyon faktörü tarafından düzenlenir, ATFS-1, hangi stres altında mitokondri girmek için başarısız ithalat verimliliği, çekirdek içine ATFS-1 girişi ile sonuçlanan25. İlginçtir, mitokondriyal süreçler için farklı pertürbations protein toplama dahil olmak üzere bu yanıtı etkinleştirebilirsiniz, elektron taşıma zinciri (ETC) kompleksleri alt birimleri, mitokondriyal DNA replikasyon stresi yıkmak, ve mitokondriyal protein çevirisi8,26. UPRMT aktivasyonu gfp mitokondriyal şaperon genleri, hsp-6 ve hsp-608organizatörleri yönetmeliği altında yerleştirildi bir transgenik yapı ifade solucanlar kullanılarak izlenmiştir. HSP-4p::GFP hayvanlarına benzer şekilde, hsp-6p::GFP hayvanları stres yokluğunda minimal bazal sinyal sergilerler. UPRMT'yi indüklemek için en sağlam yöntem aşağıdaki mitokondriyal proteinlerin RNAi-knockdown yoluyla: cox-5B, sitokrom c oksidaz alt birimi Vb/COX4 (Complex IV)20, nuo-4, NADH dehidrogenaz protein (Kompleks I)27, veya mrps-5, bir mitokondriyal ribosomal protein28, hsp-6p aktive::GFP muhabiri. Bu muhabir aracılığıyla GFP ifadesi sağlam bir şekilde etkinleştirilir ve bu koşullar altında kolayca görüntülenebilir ve ölçülebilir(Şekil 2A-B). UPRMT ayrıca elektron taşıma zincirinin kimyasal inhibisyonu (ETC) ile tetiklenebilir, örneğin sitokrom c redüktaz (kompleks III) inhibe antimisin A gibi. ETC bileşenlerinin RNAi-knockdown benzer, antimisin A tedavisi hsp-6p sağlam bir indüksiyon neden olur::GFP (Şekil 2C-D).

Organizmaların oksidatif stresi algılama ve yanıt verme yeteneği bakterilerden insanlara kadar korunmuş bir süreçtir29. C. elegans, NRF2 homolog, SKN-1, önemli bir transkripsiyon faktörü olarak hizmet vermektedir, hangi protein boyunca reaktif sistein nedeniyle redoks değişikliklerine duyarlıdır. SKN-1, NRF230ile sınırlanmış antioksidan tepki elemanlarına çok benzeyen konsensüs dizisini muhafaza etmek için bağlanarak OxSR'ın transkripsiyonel aktivatörlerinden biri olarak hizmet vermektedir. İnsanlarda, NRF2 negatif KEAP1 tarafından düzenlenir, hangi protein boyunca reaktif sistein nedeniyle redoks değişikliklerine duyarlı olduğu düşünülmektedir31. Solucanlarda KEAP1'in doğrudan ortologu bulunmamakla birlikte, SKN-1, KEAP1/NRF2 inhibisyonu32'denmekanistik olarak farklı bir şekilde WD-repeat proteini WDR-23 tarafından negatif olarak düzenlenir. Oksidatif stres üzerine, tert-bütil hidroperoksit gibi (TBHP), SKN-1 gst-4gibi detoksifikasyon ve antioksidan genleri aktive , Bir Glutatyon S-Transferaz. Oksidatif stresi ölçmek için, GFP ekspresyonu gst-4organizatörü altına yerleştirilir , bir glutatyon S-transferaz33. Burada sunulan diğer transkripsiyonel düzenleyicilerin aksine, gst-4p::GFP yüksek bazal ifadeye sahiptir. Ancak, bu ifade hala sağlam oksidatif stres koşulları altında aktive edilebilir, hangi hem genetik hem de kimyasal olarak yapılabilir. Genetik oksidatif stres indüklemek için, biz knockdown wdr-23, Hangi SKN-134proteazomal bozulmabir rol oynayan bir protein kodlar . wdr-23 knockdown gst-4p sağlam aktivasyonu sonuçları::GFP. Ayrıca, kimyasal oksidan ile solucanların tedavisi, TBHP, hafif sonuçları, ama yine de önemli, gst aktivasyonu-4p::GFP (Şekil 3). Gst-4p hem kimyasal ve genetik aktivasyon::GFP neredeyse tamamen SKN-1RNAi knockdown tarafından bastırılmış olabilir , Gen OxSR ana transkripsiyondüzenleyici kodlama.

Çoğu hücresel protein sitoplazmaya çevrilir ve başka bir yerde hedef alınmadan önce geçici olarak da olsa orada kalır. Böylece, sitoplazma uygun protein katlama ve fonksiyon teşvik şaperon çeşitli bir dizi ev sahipliği yapıyor, yanı sıra enzimler ve proteinler hasarlı, işlevsiz, ya da aşırı proteinlerin aşağılayıcı sorumlu. Sitoplazma bu karmaşık protein manzara korumak için, hücre ısı şoku yanıtı da dahil olmak üzere çeşitli sitoplazmik stres yanıt yolları, gelişti (HSR)35,36. HSR ısı stresi koşulları altında protein homeostaz teşvik adanmış bir yoldur ve ana transkripsiyondüzenleyici, HSF-137tarafından modüle edilir. Sabit koşullar altında, HSF-1 sitoplazmik şaperon, HSP90 ve HSP70/40, bir monomerik, inaktif durumda kilitli tutar ile bağlıdır. Isı veya benzer stres koşulları altında, yanlış katlanmış proteinlerin bir artış uzak HSF-1 şaperonların titrasyon sonuçlanır, trimerize ve hsr etkinleştirmek için çekirdeğe translocate izin38,39. HSF-1'in hsr aktivasyonu altında en çok çalışılan downstream hedefleri HSP70, HSP90, DNAJ ve HSP6017,,40gibi ısı şokproteinleri (HSP'ler) dir. C. elegansolarak , HSR için transkripsiyonel muhabirler kanonik HSPs, hsp-16.2 ve hsp-709,,41organizatörleri altında GFP ifade sürüş tarafından sentezlenmiştir . UPRMT ve UPRER benzerleri gibi hsp-16.2p::GFP ve hsp-70p::GFP stres yokluğunda minimal bazal ifade gösterir. Ancak, her iki muhabir de, mikroskopla kolayca görüntülenebilen veya büyük bir parçacık akış sitometresi kullanılarak ölçülebilen ısı stresi koşullarında sağlam bir şekilde indüklenir (Şekil 4). Her iki muhabirin de geniş dinamik aralığı vardır ve indüksiyon tamamen hsf-1bağlıdır , hsf-1 RNAi-knockdown hsp-16.2p::GFP ve hsp-70p::GFPindüksiyon uğruyor . Bu muhabirler çoğu durum için birbirinin yerine kullanılabilirken, dokular arasında ifade düzeyleri ve ifade farklılıkları olabilir.

C. elegans stres duyarlılığıölçmek için fizyolojik tahliller
C. elegans bakım ve deney düşük maliyet ve genom düzenleme veya genetik nakavt kolaylığı nedeniyle stres hassasiyetini ölçmek için büyük bir model organizmar RNAi kullanarak, hangi bir bütün organizmada büyük ölçekli deneyler gerçekleştirmek için kapasite sağlar. ER stresine karşı stres toleransını tsaymak için C. elegans'ı, N'ye bağlı glikozilasyon10'ubloke ederek ER'de hasarlı proteinlerin birikimine neden olan tunicamycin adlı kimyasal maddeye maruz bırakırız. İlaç gelişimsel bozukluklara neden olduğu için hayvanlar gelişim sonrası tunicamycin'e maruz kalırlar. Tunicamycin maruz kaldığında, yetişkin solucanlar yaşam süresi belirgin bir düşüş sergilerler. Ayrıca, uprER indüksiyonunda yer alan birincil transkripsiyon faktörlerinden birini kodlayan xbp-1geninin yıkılması, tunicamycin duyarlılığında önemli bir artışa yol açmaktadır (Şekil 5A)12. Böylece, bu yetişkin solucanlarda ER stres hassasiyetini ölçmek için sağlam bir titreşme görevi göremez.

Oksidatif stresi ve mitokondriyal stresi ölçmek için hayvanları kimyasal maddeye maruz bırakırız, paraquat. Paraquat mitokondriyal matris içinde ROS sentezi ile mitokondriyal strese neden olur, daha sonra hidrojen peroksit dönüştürülebilir ve tüm hücreoksidatif hasara neden mitokondri dışarı diffüz13. ER stres tahlillerine benzer şekilde, hayvanları yetişkinlikte paraquata maruz bırakırız. Ancak, maliyet ve el emeği ve agar plaka tabanlı tahliller azaltmak için sıvı paraquat tahlilleri gerçekleştirmek en laboratuvarlar için zor olacaktır. Burada, sıvı olarak paraquata maruz kalan hayvanların yaklaşık 5 saat ortanca sağkalım gösterdiğini göstermektedir(Şekil 5B). Ayrıca, insülin reseptörünün yıkılması, daf-2, DAF-16/FOXO aktivasyonu olarak paraquat artan bir direnç sonuçları ROS açıklık dahil artan ifade, sod-342gibi,43. Paraquat sağkalım tahlilleri kısa, 14 saate kadar süren ve böylece mitokondriyal ve oksidatif stres yanıtlarını sorgulamak için etkili bir yöntem olarak hizmet vermektedir.

Son olarak, yüksek sıcaklıklarda hayatta kalma ısı stresine fizyolojik tepki sorgulamak için kullanılır. Bu tahliller hem sıvı veya katı agar yapılabilir ve21özetlenen çok sayıda farklı protokoller var. Bu testte son derece yüksek olan değişkenliği azaltmak için laboratuvarda tek bir testin standartlaştırılması önerilir. Termotolerans standart agar plakaları üzerinde gün 1 yetişkin hayvanlar da yapılmalıdır, ya 34 °C veya 37 °C. 37 °C'de, ölümün büyük bir kısmı 7-11 saat arasında gerçekleşir ve bu basit bir tek günlük bir tetkik olurken, 34 °C'de 12-16 saatlik deneyler en kolay gecede gerçekleştirilir(Şekil 5C-E). Genmutasyonu, ttx-3, termosensoriyonrsinir devresorumlu AIY interneurons belirtimi nin başarısız olur, ve termosensitivite önemli bir artışa neden44. Termotolerans verileri bir sağkalım eğrisi olarak çizilebilirken(Şekil 5C),bu tahliller en az 4-6 kez yapılmalı ve tüm çoğaltmalar birbirine karşı çizilmelidir(Şekil 5D-E),termotolerans diğer stres denemelerine göre inanılmaz derecede yüksek değişkenlik gösterdiği için. Bu ilgi suşları değişkenlik de dahil olmak üzere bu deneylerin kurulmasında var olan birçok uyarılar nedeniyle, kuvözlerde hava eşitsiz bisiklet, düzensiz agar plakaları, vb21. 34 °C'de ortanca sağkalım yaklaşık 14 saatte gerçekleşir ve 37 °C'ye benzer şekilde, TTX-3 mutantları 34 °C'de sağkalımda azalma yada 34 °C'de azalır (Şekil 5E).

Figure 1
Şekil 1: UPRER indüksiyonu için muhabir olarak hsp-4p::GFP kullanma. (A) HSP-4p temsili floresan mikrograflar::GFP kontrol boş vektör (EV) veya xbp-1 RNAi yetiştirilen hayvanları ifade. RNAi'de yumurtadan 20 °C'ye kadar yetiştirilen hayvanlar, 20 °C'de 25 ng/μL tunicamycin veya %1 DMSO ile tedavi edildi ve görüntülemeden önce 20 °C'de 20 °C'de 16 saat OP50 plakaüzerinde bulundu. Hayvanlar bir NGM agar plaka üzerinde 100 μM sodyum azit felç edildi ve bir stereomikroskop kullanılarak görüntülendi. (B) Büyük bir parçacık biyosorteri kullanılarak (A) kantitatif analizi. Veriler, her noktanın tek bir hayvanı temsil ettiği tüm hayvan genelinde entegre floresan yoğunluğu olarak temsil edilir; DMSO kontrolü gri ve tunicamycin tedavi edilen hayvanlar kırmızıdır. Merkezi çizgi ortancayı, bıyıklar ise interquartile aralığını temsil eder. n = 123-291 hayvan sayısı başına. p < 0.001 parametrik olmayan Mann-Whitney testi kullanılarak. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Figure 2
Şekil 2: UPRMT indüksiyonu için muhabir olarak hsp-6p::GFP kullanma. (A) HSP-6p temsili floresan mikrograflar::GFP kontrol boş vektör (EV), cco-1, mrps-5veya nuo-4 RNAi yetiştirilen hayvanları ifade. RNAi'de yumurtadan hayvanlar yetiştirildi ve 20 °C'de yetişkinliğin ilk gününde resmedildi. Hayvanlar bir NGM agar plaka üzerinde 100 μM sodyum azit felç edildi ve bileşik mikroskop kullanılarak görüntülendi. (B) Büyük bir parçacık biyosorteri kullanılarak (A) kantitatif analizi. Veriler, her noktanın tek bir hayvanı temsil ettiği tüm hayvan genelinde entegre floresan yoğunluğu olarak temsil edilir; EV kontrolü gri RNAi tedavi hayvanlar kırmızı dır. Merkezi çizgi ortancayı, bıyıklar ise interquartile aralığını temsil eder. n = 303-384 hayvan başına. p < 0.001 parametrik olmayan Mann-Whitney testi kullanılarak EV kontrolü ile karşılaştırıldığında. (C) DMSO veya Antimisin A ile tedavi edilen HSP-6p:GFP hayvanlarının temsili görüntüleri %0,2 DMSO plakalı kapaktan yetiştirildi ve Revolve ECHO R4 bileşik mikroskobunda görüntülemeden önce 16 saat boyunca %0,2 DMSO veya 3 mM antimisin A içeren plakalara aktarıldı. Tüm büyüme 20 °C'de gerçekleştirildi. (D) (C) kantitatif analizine benzer büyük bir parçacık biyosortörü kullanarak (B). DMSO kontrolleri büyük ve Antimisin A-tedavi hayvanlar kırmızı bulunmaktadır. n = 495 DMSO ve 219 Antimycin A. ***p < 0.001 ev kontrolü olmayan parametrik Mann-Whitney testi kullanılarak karşılaştırıldığında. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Figure 3
Şekil 3: OxSR için bir muhabir olarak gst-4p::GFP kullanarak. (A) Gst-4p temsilcisi floresan mikrograflar::GFP kontrol boş vektör (EV), skn-1veya wdr-23 RNAi yetiştirilen hayvanları ifade. gst-4p::GFP RNAi'de yumurtadan 20 °C'de L4 evreye kadar hayvanlar yetiştirildi. RNAi'de yumurtadan 20 °C'ye kadar yetiştirilen hayvanlar, 20 °C'de 2 mM TBHP veya 20 °C'de "işlenmemiş" kontrol için sadece M9 ile 4 saat boyunca tedavi edilmiş ve görüntülemeden önce 20 °C'de 16 saat EV plakası üzerinde kurtarılmıştır. Hayvanlar bir NGM agar plaka üzerinde 100 μM sodyum azit felç edildi ve bileşik mikroskop kullanılarak görüntülendi. (B) Büyük bir parçacık biyosorteri kullanılarak (A) kantitatif analizi. Veriler, her noktanın tek bir hayvanı temsil ettiği tüm hayvan genelinde entegre floresan yoğunluğu olarak temsil edilir; tedavi edilmeyen kontrol gri ve TBHP ile tedavi edilen hayvanlar kırmızı dır. Merkezi çizgi ortancayı, bıyıklar ise interquartile aralığını temsil eder. n = 101-204 hayvan başına. p < 0.001 parametrik olmayan Mann-Whitney testi kullanılarak ilgili EV kontrolü ile karşılaştırıldığında. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Figure 4
Şekil 4: Hsp16.2p::GFP ve hsp-70p::GFP kullanarak ısı şoku tepkisi için muhabir olarak. (A) Hsp16.2p temsil ibareleri::GFP kontrol boş vektör (EV) veya hsf-1 RNAi yetiştirilen hayvanları ifade. RNAi'de 20 °C'de 1. 1. gün hayvanlar ya 20 °C'de (işlenmemiş) ya da 34 °C'de 2 saatlik ısı stresine maruz bırakılmış, daha sonra 20 °C'de 2 saat boyunca kurtarılmıştır. Hayvanlar bir NGM agar plaka üzerinde 100 μM sodyum azit felç edildi ve bir stereomikroskop kullanılarak görüntülendi. (B) Büyük bir parçacık biyosorteri kullanılarak (A) kantitatif analizi. Veriler, her noktanın tek bir hayvanı temsil ettiği tüm hayvan genelinde entegre floresan yoğunluğu olarak temsil edilir; işlenmemiş kontrol gri ve ısı şoklu hayvanlar kırmızı. Merkezi çizgi ortancayı, bıyıklar ise interquartile aralığını temsil eder. n = 320-364 hayvan başına. p < 0.001 parametrik olmayan Mann-Whitney testi kullanılarak. (C) HSP-70p temsil ibareleri::GFP kontrol EV ve hsf-1 RNAi yetiştirilen ve açıklandığı gibi tedavi hayvanları ifade (A). (D) (C) kantitatif analizi (B)olarak tanımlanır. n = 773-941 hayvan türü. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Figure 5
Şekil 5: C. elegansstres altında fizyolojik sağkalım tahlilleri . (A) 25 ng/μL tunicamycin (TM) plakası içeren %1 DMSO'da yetiştirilen nematodların ömrü. Hayvanlar ambardan 1 güne kadar %1 DMSO plakaları üzerinde yetiştirildi ve ilk gün ilgili TM plakalarına aktarıldı. Hayvanlar 20 °C'de kontrol boş vektör (EV) veya xbp-1 RNAi ambardan kontrol edildi. Yetişkin hayvanlar el ile her gün nesilden uzak ~ gün 7-8 zaman döl artık tespit edildi kadar taşınır, daha sonra tüm hayvanlar ölü veya sansür olarak kaydedildi kadar her 2 günde bir attı. Torbalama, vulval çıkıntıları/patlamaları olan hayvanlar ya da plakaların kenarlarına tırmanan hayvanlar sansürlenmiş kabul edildi. (B) 100 mM paraquat (PQ) nematodların sağkalım eğrisi M9 çözeltisinde çözünmüştür. Hayvanlar 20 °C'de yetişkinliğin ilk gününe kadar ambardan EV veya daf-2 RNAi'de yetiştirildi. Hayvanlar 20 °C'de 96 iyi plakalı 50 μL M9 + PQ çözeltisine yerleştirildi ve tüm hayvanlar hareketsiz olana kadar her 2 saatte bir görüntülendi. (C) Nematodların 37 °C'de hayatta kalma eğrisi. Yabani tip (N2), ttx-3(KS5)ve sur-5p::hsf-1 hayvanlar 20 °C'de 1. Birinci günde hayvanlar 37 °C'ye taşındı ve tüm hayvanlar ölü ya da sansürlü olarak değerlendirilene kadar her 2 saatte bir puanlandı. (D) 37 °C'de yapılan tüm termotolerans tahlillerinin havuzlu verileri. Veriler, termotolerans analizinin 9. (E) 34 °C'de yapılan tüm termotolerans tahlillerinin havuzlu verileri. Veriler, termotolerans analizinin 14. A-C'nin tüm istatistikleri Log-Rank (Mantel-Cox) testi kullanılarak gerçekleştirildi ve Tablo 5'tebulunabilir. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Reaktif Tarifi
Lysogeny Suyu (LB) Bu protokolde, ticari LB kullanılmıştır (Malzemeler bakınız), ancak Bacto-tryptone, maya özü ve NaCl kullanarak tüm standart LB ev yapımı yemek tarifleri yeterlidir.
Nematode Büyüme Medya (NGM) 1 mM CaCl2, 5 μg/mL kolesterol, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (w/v) agar, %0.25 (w/v) Bacto-Peptone, 51.3 mM NaCl
Çamaşır suyu çözeltisi %1.8 (v/v) sodyum hipoklorit, 0.375 M KOH
M9 çözeltisi 22 mM KH2PO4 monobasic, 42.3 mM Na2HPO4, 85.6 mM NaCl, 1 mM MgSO4
NGM RNAi plakaları 1 mM CaCl2, 5 μg/mL kolesterol, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (w/v) agar, %0.25 (w/v) Bacto-Peptone, 51.3 mM NaCl, 1 mM IPTG, 100 μg/mL carcibenillin/ampicillin. 4 ° C'de karanlıkta 3 aya kadar saklayın
Tetrasiklin 10 mg/mL stok çözeltisi (500x) %100 etanol. -20 °C'de saklayın
Carbenicillin Suda 100 mg/mL stok çözeltisi (1000x). Uzun süreli depolama için 4 °C'de 6 aya kadar veya -20 °C'de saklayın
Sodyum azit 1 M stok (~6,5%) suda sodyum azit stok çözeltisi. Karanlıkta 4 °C'de saklayın. Bu 10x bir çözümdür ve çoğu görüntüleme deneyi için 100 mM'lik bir çalışma stoğuna seyreltilir
Tunicamycin %100 DMSO'da 2.5 mg/mL stok çözeltisi. Uzun süreli depolama için -80 °C'de saklayın. Bu 100x bir çözümdür (25 ng/μL çalışma çözümü)
Antimisin A %100 DMSO'da 15 mM antimisin Bir stok çözeltisi. -20 °C'de saklayın. Bu bir 5000x çözümdür (3 μM çalışma stoku)
Paraquat Suda 50 μM çözelti – taze olarak hazırlanmalıdır
Tert-büil hidroperoksit (TBHP) Suda 7,7 M çözelti. Bu 3850x çözümdür (2 mM çalışma stoku)
NGM RNAi + DMSO0.2 1 mM CaCl2, 5 μg/mL kolesterol, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (w/v) agar, %0.25 (w/v) Bacto-Peptone, 51.3 mM NaCl, 1 mM IPTG, 100 μg/mL karsitilin/ampisilin, 0.2% DSOM
(antimisin A kontrolü)
NGM RNAi + antimisin A 1 mM CaCl2, 5 μg/mL kolesterol, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (w/v) agar, 0.25% (w/v) Bacto-Peptone, 51.3 mM NaCl, 1 mM IPTG, 100 μg/mL karbenillin/ampillin, 0.2% DMSO, 3 mM Amm anticc
NGM RNAi DMSO 1 mM CaCl2, 5 μg/mL kolesterol, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (w/v) agar, %0.25 (w/v) Bacto-Peptone, 51.3 mM NaCl, 1 mM IPTG, 100 μg/mL carcibenillin/ampicillin; %1 DMSO
(tunicamycin kontrolü)
NGM RNAi TM 1 mM CaCl2, 5 μg/mL kolesterol, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (w/v) agar, %0.25 (w/v) Bacto-Peptone, 51.3 mM NaCl, 1 mM IPTG, 100 μg/mL carcibenillin/ampicillin; %1 DMSO, 25 ng/μL tunicamycin
IPTG Suda 1 M çözelti.

Tablo 1: Kullanılan reaktifler için önerilen tarifler. Bu protokolde kullanılan reaktiflerin tüm tarifleri burada özetlenmiştir. Reaktiflerin satın alındığı özel şirketler de Malzeme Tablosu'ndamevcuttur. Birçok farklı kimyasal kaynağı test edilmiştir ve Malzemeler Tablosu'nda listelenenler en sağlam ve tekrarlanabilir sonuçları sergileyenlerdir.

Plaka Boyutu Bakteri Tipi # hayvanların gün 1 yetişkinlik ulaşmak için # Hayvanların L4 aşamasına ulaşmak için
60 mm OP50 100-150 Arası 150-300 Arası
60 mm HT115 70-100 Arası 120-200 Arası
100mm OP50 600-1000 Arası 1500-2000 arası
100mm HT115 350-600 Arası 700-1300 arası

Tablo 2: Açlıktan kaçınmak için senkronizasyon sonrası plakaya önerilen hayvan sayısı. Açlıktan korunmak için, her koşulda belirli sayıda hayvan kaplamanızı öneririz. OP50 HT115 daha yoğun büyür bu yana, daha fazla hayvan kaplama olabilir. Burada listelenen tüm sayılar laboratuarımızda kullanılan kurallardır ve laboratuar koşulları arasındaki çeşitli değişkenler ve farklılıklar nedeniyle sayılar biraz farklı olabilir. Bu nedenle, veya önerilen sayılar kalın yazı tipi alt tarafında dır. Maksimum sayılar, laboratuarımızda açlığa ulaşmadan en uygun koşullarda kaplanabilir, ancak öncelikle koşullarınızı titrating olmadan bu değerleri kullanmak için tavsiye edilmez. Tüm sayılar, bakterilerin tabaklara tohumlandığı ve solucanlar yerleştirilmeden önce plakalarda ortam sıcaklığında (~22 °C) ~24 saat boyunca büyümesine izin verildiği varsayımıyla belirlenir. Yumurta veya L1 kaplama zaman açlık oranlarında önemli bir fark olmamasına rağmen, biz tüm yumurta beyazlatma sonrası yumurtadan çünkü, yumurta kaplama ~ % 10 daha yüksek sayılar kaplama öneririz.

Süzme adı Transgen Amaç Stres için önerilen uygulama(lar) Kaynak
SJ4005 hsp-4p::GFP UPRER 25 μg/mL tunicamycin CGC
SJ4100 hsp-6p::GFP UPRMT 3 μM antimisin A; CGC
ETC veya mitokondriyal ribozom karşı RNAi
SJ4058 hsp-60p::GFP UPRMT 3 μM antimisin A; CGC
ETC veya mitokondriyal ribozom karşı RNAi
CL2070 hsp-16.2p::GFP ısı şoku tepkisi 34 °C 2 saat CGC
AM446 hsp-70p::GFP ısı şoku tepkisi 34 °C 2 saat Morimoto Laboratuvarı
CL2166 gst-4p::GFP OxSR 50 mM paraquat; CGC
2 mM tert-bütil hidroperoksit
CF1553 sod-3p::GFP OxSR & insülin sinyalizasyon Daf-2'ye karşı RNAi (insülin reseptörü) CGC
AU78 T24B8.5p::GFP doğuştan gelen bağışıklık yanıtı patojene maruziyet (örn. P. aeruginosa) CGC

Tablo 3: Hücresel stres yanıtlarının aktivasyonunu değerlendirmek için transkripsiyonel muhabirler. Burada listelenen suşların tümü CGC aracılığıyla veya bu makalede açıklanan nitel ve nicel görüntüleme yöntemlerinde kullanılmak üzere laboratuvarlara özel istekler yoluyla mevcuttur. Bu suşların hepsi Bristol N2 arka plantüretilmiştir. Muhabirleri etkinleştirmek için stres uygulamak için önerilen yöntemler de sağlanmaktadır. Sod-3p::GFP45 ve T24B8.5p::GFP46 hariç tüm muhabirler metinde açıklanmıştır.

Transgen Stres için önerilen uygulama(lar) Leica M2250FA stereo mikroskobu kullanarak pozlama süresi Revolve ECHO mikroskobu kullanarak pozlama süresi Union Biometrica COPAS biyosorter kullanarak PMT değerleri
hsp-4p::GFP 25 μg/mL tunicamycin (~4 saat gece kurtarma ile) 200 ms 275 ms 450
hsp-6p::GFP 3 μM antimisin A (~16 saat); 100 ms 50 ms 350
ETC veya mitokondriyal ribozom (ambardan) karşı RNAi
hsp-60p::GFP 3 μM antimisin A (~16 saat); 200 ms 100 ms 450
ETC veya mitokondriyal ribozom (ambardan) karşı RNAi
hsp-16.2p::GFP 34 °C 2 saat 400 ms 200 ms 500
hsp-70p::GFP 34 °C 2 saat 400 ms 300 ms 500
gst-4p::GFP 50 mM paraquat (~2 saat); 100 ms 50 ms 350
2 mM tert-bütil hidroperoksit (gece kurtarma ile ~ 4 saat)
sod-3p::GFP Daf-2'ye karşı RNAi (insülin reseptörü) 300 ms 300 ms 475
T24B8.5p::GFP patojene maruziyet (örn. P. aeruginosa) 100 ms 50 ms 350

Tablo 4: Büyük bir parçacık biyosorter kullanılarak floresan mikroskopi ve nicelik lendirme için önerilen ayarlar. Bu tablo, büyük parçacık biyosortörü için floresan mikroskopi veya PMT değerleri için önerilen maruz kalma süreleri için kılavuz görevi görücüye geçecektir. Bunlar iyi bir başlangıç noktası olarak hizmet verecektir, ancak hiçbir doygunluk oluşur ve floresan değerleri arka plan sinyali algılama sınırı üzerinde olduğundan emin olmak için her deneme için pozlama süresi ve PMT değeri ayarlanmalıdır. Bir deney için en parlak sinyale sahip numune biliniyorsa (örneğin, stres indüksiyonu için pozitif kontroller), bu örnekler sinyali doyramadan kullanılabilecek en yüksek pozlama süresini veya PMT'yi belirlemek için kullanılabilir. En parlak örnekler bilinmiyorsa, kontrol kullanılabilir ve sisteminizin dinamik aralığının merkezinde bir pozlama süresi veya PMT kullanılabilir.

Karşılık Gelen Şekil Gerinim, Tedavi Ortanca Yaşam Süresi # Ölümler/# Toplam Ortanca yaşam süresinde % değişim p-değeri (Log-Rank; Mantel-Cox)
5A N2, vektör RNAi, %1 DMSO 22 gün 95/120 -- --
N2, xbp-1 RNAi, %1 DMSO 14 gün 92/120 -36.4 > 0,001
N2, vektör RNAi, 25 ng/μL TM 14 gün 97/120 -36.4 > 0,001
N2, xbp-1 RNAi, 25 ng/μL TM 12 gün 98/120 -45.4 > 0,001
5B N2, vektör RNAi, 100 mM PQ 5 saat 73/73 -- --
N2, daf-2 RNAi, 100 mM PQ 6,5 saat 74/74 30 > 0,001
5C N2, vektör RNAi, 37 °C 8 saat 59/60 -- --
ttx-3(KS5), vektör RNAi, 37 °C 7 saat 60/60 -12.5 0.002
sur-5p::hsf-1, vektör RNAi, 37 °C 9 saat 59/60 12.5 0.012

Tablo 5: Yaşam süreleri ve stres sağkalım tahlilleri için istatistikler. Şekil 5 için tüm örneklem boyutları, istatistikler ve sansür oranlarına buradan ulaşabilirsiniz.

Stres Yanıtı Hedef Gen İleri Astar Ters Astar
UPRER hsp-3 TCGCTGGATTGAACGTTGTTCG GTTGCGTTCTCCGTTTCTTCtTG
UPRER hsp-4 GAACAACCTACTCGTGGTTGG GAACAACCTACTCGTGGTTGG
UPRER sel-11 TTGATCTCCGGAAAACGCAACG TTGATCTCCGGAAAACGCAACG
UPRER ire-1 TCCTCAACCGCTCCATCAACAT TCCTCAACCGCTCCATCAACAT
UPRER xbp-1 GGACTTCTTCGGCTTCTGGAGT GGACTTCTTCGGCTTCTGGAGT
UPRER xbp-1 (spliced) GGTGGATGGAGGGAGAAGATT GGTGGATGGAGGGAGAAGATT
UPRER crt-1 GAAGTAATAGCCGAGGGAAGC GAAGTAATAGCCGAGGGAAGC
UPRER T14G8.3 CACCTCCATCAACAACAAACAT CACCTCCATCAACAACAAACAT
Hsr hsp-17 TCGTTTTCCACCATTCTCCCCA TGTTTGATCGGCCCAGTATGGT
Hsr hsp-70 TGTTTGATCGGCCCAGTATGGT TTCGCAATGAGAAGGGACGACT
Hsr F44E5.4 TTCGCAATGAGAAGGGACGACT CGTTGTGCTGCGTCTTCTTTTT
Hsr hsp-16.2 TCCATCTGAGTCTTCTGAGATT
GTTA
TGGTTTAAACTGTGAGACGTTGA
Hsr hsf-1 TTTGCATTTTCTCGTCTGTGTC TCTATTTCCAGCACACCTCGT
UPRMT hsp-6 GAGATCGTGGAACCGGAAAGGA CGGCATTCTTTTCGGCTTCCTTTT
UPRMT hsp-60 CGGCATTCTTTTCGGCTTCCTTTT CGTCGTGTTGCAGAGCTCAAGAAG
UPRMT ymel-1 CAAAACCTGATCTCGCTGGG TTCTCAATGTCGGCTAGT
UPRMT clpp-1 TGATAAGTGCACCAGTGTCCA TGATTCTGGAGTTCGGGAGA
UPRMT lonp-1 CGATGATGGCCATTGTGCAG CGCTTTGAAACATCAATTTCAT
Cca
OxSR gst-4 GATGCTCGTGCTTTCtG CCGAATTGTTCTCCATCGAC
OxSR gst-6 CCGAATTGTTCTCCATCGAC TTTGGCAGTTGTTGAGGAG
OxSR gst-7 TTTGGCAGTTGTTGAGGAG TGGGTAATCTGGACGGTTTG
OxSR gcs-1 TGGGTAATCTGGACGGTTTG ATGTTTGCCTCGACAATGTT
OxSR skn-1 GGACAACAGAATCCCAAAGG TCAGGACGTCAACAGCAGAC
OxSR sod-3 GTAACGGGCGATAGCATGAG GCGAGAGCACATTGATGAC
OxSR ptps-1 AATCGATTCCTTTGGAGACC CAATCTACTGCTCGCACTCtT
CAAAGC
Başvuru pmp-3 TGGCCGGATGATGGTGTCGC ACGAACAATGCCAAAGGCCAGC
Başvuru Y45F10.4 CGAGAACCCGCGAAATGTCGGA CGGTTGCCAGGGAAGGAGGC
Başvuru öz-49 TGGCGGATCGTCGTGCTTCC ACGAGTCTCCTCTCTCGTCCCA
Başvuru tba-1 TCAACACTGCCATCGCCGCC TCCAAGCGAGACCAGGCTTCAG

Tablo 6: Stres yanıtı genlerinin transkripsiyonel upregülasyonunun ölçülmesi için önerilen gen hedefleri ve astar çiftleri.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Burada, C. eleganshücresel stres yanıtlarını sorgulamak için yöntemler , floresan transkripsiyonel muhabirler ve fizyolojik stres sağkalım tahlilleri kullanılarak açıklanmıştır. Muhabirlerin hepsi, hücresel stres tepkilerinin artmasıyla ilgili transkripsiyon faktörlerinin aşağı transkripsiyon hedefinin organizatörü altında yönlendirilen GFP ifadesini kullanırlar. HSP-4p kullanımı::GFP XBP-1s-aracılı UPRERtarafından modüle , hsp-6p::GFP ATFS-1-aracılı UPRMTtarafından kontrol , gst-4p::GFP SKN-1-aracılı OxSR altında, ve hsp16.2p::GFP ve hsp-70p::GFP altında HSF-1-aracılı ısı şoku tepkisi açıklanmıştır. Diğer standart transkripsiyonel muhabirler Tablo 3'tebulunabilir. Burada sunulan tüm transkripsiyonel muhabirler geniş bir dinamik menzile sahiptir ve genetik tedirginlikler veya strese neden olan kimyasallara maruz kalma yoluyla stres uygulanarak sağlam bir şekilde aktive edilebilir. Ayrıca, bu muhabirlerin hepsi istihdam organizatörlerin yukarı transkripsiyon faktörlerinin yıkılması ile bastırılabilir. Son olarak, her transkripsiyonel muhabir belirli bir fizyolojik stres sağkalım teşbesi ya aktive veya belirli bir stres yanıtı bastırma etkisinin fizyolojik bir okuma sağlamak için eşlenir.

Transkripsiyonel muhabirlerin kullanımını başarılı bir şekilde istihdam etmek için, her muhabirin dinamik aralığını belirlemek esastır. Medya, agar, ortam ortamı, vb farklılıkları nedeniyle büyük laboratuvar-laboratuvar değişkenliği nedeniyle, bir temel olarak önerilerimizi kullanarak konsantrasyonları ve zamanlama için her ilaç veya stres indüksiyon paradigmat titretmek için tavsiye edilir. Daha sonra, hayvanların sağlıklı ve düzgün senkronize olduğundan emin olmak için önemlidir. Bir çeşit stres yaşamış hayvanlar (örn. açlık, ışığa uzun süreli maruz kalma, yüksek sıcaklığa maruz kalma, vb.) deneyden önce birkaç nesil boyunca kurtarılmalıdır. Birkaç stres yanıtları yaşlanma sürecinde aktivasyon farklı düzeylerde olduğu gibi gerekli olan bölüm 2, özetlenen yöntemler kullanılarak doğru senkronizasyon elde edilebilir. Son olarak, görüntü ve veri kalitesini etkileyebilecek çeşitli şeyler olduğundan, görüntüleme protokolleri standartlaştırmak için gereklidir. Örneğin, sodyum azit hayvanların süresi en aza indirilmelidir, bu hayvanlar için strese neden olur ve muhabir sinyali etkileyebilir. Ayrıca, mikroskop ve biyosorter özellikleri düzgün sinyal-gürültü oranı ve dinamik aralık maksimize etmek için ayarlanmalıdır, doygunluğa neden olmadan. Doymuş pikseller, maksimum floresan sinyali ciddi şekilde hafife alınabildiği için numunelerin nicel analizinde önemli sorunlara neden olabilir.

Burada açıklanan transkripsiyon muhabirleri stres yanıtlarının aktivasyonunu ölçmek için sağlam ve verimli bir araç sağlarken, bunun bilinen bir transkripsiyon faktörünün tek bir gen hedefi olduğunu anlamak önemlidir. Bu nedenle, büyük ölçekli ekranlar veya ilgi suşları ilk geçiş testleri için güvenilir bir yöntem olarak hizmet ederken, uygun doğrulamalar yapılmalıdır. Her stres yanıtının indüksiyonu ile aktive edilen birkaç kanonik hedef geni ölçmek için qPCR gerçekleştirmenizi öneririz. Önerilen gen hedeflerinin bir listesini Tablo 6'dabulabilirsiniz. Buna ek olarak, RNA-seq ile transkripsiyon profilleme aynı anda birden fazla transkripsiyonel hedefler üzerindeki etkileri daha geniş bir görünüm için başka bir alternatiftir. Özellikle dikkat, floresan gazetecilerin görüntüleme tedirginlikler etkilenen dokular ile ilgili mekansal bilgi sağlar. Bu tür bilgiler qRT-PCR veya RNA-seq elde edilemez, tüm solucan özleri kullanır gibi, scRNA-seq dışında, FISH, ve dokuya özgü RNAseq protokolleri47. Son olarak, bu stres muhabirleri genellikle kendi stres tepki makineleri özgü olarak karakterizedir. Ancak, tüm stres tepkisi paradigmaları benzersiz ve farklı olduğunu hatırlamak önemlidir. Örneğin, ER stres OxSR etkinleştirebilirsiniz ve tam tersi48, ve ısı şoku yanıtı ve ER stres yanıtları arasında örtüşen yaygın olarak bulunmuştur49. Bunlar, çapraz iletişim ve stres yanıtları arasındaki örtüşme literatüründeki pek çok örnekten sadece birkaçıdır ve bu nedenle tüm tahlillerin nihai sonuçlar elde etmek için özgüllük açısından test edilmesi gerektiğini anlamak önemlidir.

Açıklanan yöntemlerin bir diğer sınırlaması da, bir biyosorter aracılığıyla görüntüleme ve nicelemenin sınırlı iş bölümüne sahip olmasıdır. Biyosorter kantitatifi daha yüksek iş hacmi için 96 kuyulu plakalarda yapılabilse de, solucanların çözeltiye aktarılması gerekliliği ile sınırlıdır, oysa görüntüleme araştırmacının solucan ları hazırlama ve mikroskobu yapma kapasitesi ile sınırlıdır. Bu nedenle, büyük ölçekli ekranlar büyük olasılıkla sadece floresan muhabir sinyal görsel bir tarama içerecektir, sadece görüntüleri ve ölçülen isabet ile.

Bu floresan muhabirlerin kullanımıyla ilgili önemli bir uyarı, stres yanıtlarının aktivasyonu veya bastırılmasının her zaman fizyolojik olarak anlamlı fenotiplere katkıda bulunmaması veya diğer küresel etkileri yansıtmasıdır (örn. protein sentezindeki azalma). Bu nedenle, her transkripsiyonel muhabir stres hayatta kalma tsay bir yöntem ile eşleştirilmiş. Bu UPRERiçin tunicamycin sağkalım tahlilleri gerçekleştirmek için tavsiye edilir , UPRMT ve OxSR için paraquat sağkalım tahlilleri, ve ısı şoku tepkisi için yüksek sıcaklıklarda hayatta kalma. Bunlar genellikle sağlam, hızlı ve basit tahliller olsa da, yoğun el emeği gerektirir ler ve bu nedenle ölçeklenebilirlik açısından ciddi şekilde sınırlıdırlar. Ayrıca, bugüne kadar yayınlanan hemen hemen tüm termotolerans tahlilleri büyük değişkenlik var, neredeyse gerekli çoğaltmalar çok sayıda yapma21. Tuicamycin ve paraquat hayatta kalma tahlilleri tekrarlanabilirlik bu eksikliği muzdarip olmasa da, onlar geniş hands-on emek ve protokolün süresi de dahil olmak üzere kendi zorlukları var. Yeni teknolojiler yaşam süresi ve hayatta kalma tahlilleri otomatikleme doğar gibi, bu stres hayatta kalma tahlilleri de yüksek iş yapma50olabilir muhtemeldir. Ancak, bu otomatik tahliller standart hale gelinceye kadar, sağkalım tahlilleri şu anda stres yanıt aktivitesinin dinamiklerini değiştiren fizyolojik sonuçların doğrulanması ile sınırlıdır.

Burada açıklanan stres hayatta kalma tahlillerinin ötesinde, hayvanlarda fizyolojiyi ölçmek için başka yöntemler de vardır. Örneğin, ticari olarak kullanılabilen bir Seahorse XFp Analyzer hücresel solunum izleme izin verebilir, hangi ek mekanistik anlayış sağlar51. Transkripsiyon eldeki gazetecilere bir diğer alternatif de floresan olarak etiketlenmiş transkripsiyon faktörlerinin nükleer lokalizasyonunun kullanılmasıdır. Bu tekniğin çok sayıda varyantları vardır, ancak burada açıklanan yöntemleriçin özellikle ilgi şunlardır: HSF-1::GFP ısı şoku yanıtı için52, DVE-1::GFP UPRMT53için , ve DAF-16::GFP ve SKN-1:GFP OxSR54,55. Son olarak, ilgi belirli organellerin morfolojidoğrudan sorgulama yapılabilir. Örneğin, mitokondriyal morfolojimi mitokondriyal matris hedefli bir florofor kullanılarak görselleştirilebilir56. ER morfolojisi, N-terminus ve HDEL'e kaynaşmış bir sinyal dizisi ile ER'yi hedefleyen bir florofor kullanılarak görselleştirilebilir57 veya Bir ER membran proteinine kaynaşmış GFP58. Son olarak, aktin sitoskeletal bütünlük HSF-1 termal stres hassasiyeti aşağı için bir proxy olarak kullanılabilir. Aktin sitoiskelethf-1 transkripsiyonel hedefleri tarafından düzenlenir, özellikle yaşlanma ve ısı stresi sırasında, ve böylece aktin organizasyon HSF-1 fonksiyonel okuma belirlemek için görselleştirilmiş olabilir ve ısı ile ilgili stres59,60.

Burada açıklanan tüm yöntemler, genlerin veya ilgi çekici ilaçların ve bunların stres yanıtı üzerindeki etkilerinin kapsamlı bir analizi için bağımsız olarak veya birbiriyle birlikte kullanılabilir. Büyük ölçekli ekranlar yüksek işlemtranskripsiyonel muhabir tahlilleri kullanılarak, ikincil ekranlar ise bu muhabirlerin nicel analizleri kullanılarak gerçekleştirilebilir. Bir kez daha yönetilebilir aday gen / ilaç listeleri tespit edilir, fizyolojik tahliller tüm hayvan fizyolojisi üzerinde doğrudan etkisi olan bu adayları belirlemek için yapılabilir. Yukarıda önerilen diğer yöntemler de doğrulama veya daha fazla araştırma olarak kullanılabilir.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarların açıklayacak bir şeyi yok.

Acknowledgments

R.BZ. EMBO uzun vadeli burs ve Larry L. Hillblom Vakfı tarafından desteklenir. R.H.S, Ulusal Yaşlanma Enstitüsü (NIA) ve Glenn Tıbbi Araştırma Doktora Sonrası Burs Vakfı aracılığıyla 5F32AG032023-02 hibe ile desteklenir. A.F. NIA aracılığıyla Hibe F32AG051355 tarafından desteklenir. H.K.G. Ulusal Bilim Vakfı Lisansüstü Araştırma Bursu Programı ile DGE1752814 hibe ile desteklenir. M.G.M. NIA ile 1F31AG060660-01 tarafından desteklenir. A.D. Thomas ve Stacey Siebel Vakfı, Howard Hughes Tıp Enstitüsü ve 4R01AG042679-04 ve 5R01AG05891-02 NIA ve 5R01ES021667-09 NIEHS tarafından desteklenir. Larry Joe, Melissa Sanchez, Naame Kelet ve Anel Esquivel'e önemli teknik yardımlar için teşekkür ederiz. Biz Morimoto laboratuvar ve CGC (NIH Office Araştırma Altyapı Programı P40 OD010440 tarafından finanse edilen) suşları için teşekkür ederiz.

Materials

Name Company Catalog Number Comments
Antimycin A Sigma-Aldrich A8674 for mitochondrial stress
Bacto Peptone Fisher Scientific DF0118072 for NGM plates
BD Difco granulated agar VWR 90000-782 for NGM plates
Calcium chloride dihydrate VWR 97061-904 for NGM plates
Carbenicillin BioPioneer C0051-25 for RNAi
Cholesterol Sigma-Aldrich 57-88-5 for NGM plates
COPAS Biosorter Union Biometrica 350-5000-000 equipped with a 488 nm light source.
COPAS Cleaning Solution Union Biometrica 300-5072-000 to use with COPAS
COPAS Sheath Solution Union Biometrica 300-5070-100 to use with COPAS
DMSO Sigma-Aldrich 472301 solvent for drugs
IPTG dioxane free Denville Scientific CI8280-4 for RNAi
LB Broth Miller Fisher Scientific BP1426500 for LB
M205FA stereoscope Leica 10450040 equipped with a Leica DFC3000G monochromatic CCD camera, standard Leica GFP filter (ex 395-455, EM 480 LP), and LAS X software
Magnesium sulfate heptahydrate VWR EM-MX0070-3 for NGM plates, M9
Paraquat Sigma-Aldrich 36541 for oxidative/mitochondrial stress
Potassium Chloride Fisher P217-500 for bleach soluton
Potassium phosphate dibasic VWR EM-PX1570-2 for NGM plates
Potassium phosphate monobasic VWR EM-PX1565-5 for M9
Revolve ECHO 75990-514 equipped with an Olympus 4x Plan Fluorite NA 0.13 objective lens, standard Olympus FITC filter (ex 470/40; em 525/50; DM 560), and an iPad Pro for camera and to drive ECHO software
Sodium Azide Sigma-Aldrich 71289-50G for imaging
Sodium Chloride EMD Millipore SX0420-5 for NGM plates, M9
Sodium phosphate dibasic VWR 71003-472 for M9
Tert-butyl hydroperoxide Sigma-Aldrich 458139 for oxidative stress
Tetracycline hydrochloride Sigma-Aldrich T7660-5G for RNAi
Tunicamycin Sigma-Aldrich T7765-50MG for ER stress

DOWNLOAD MATERIALS LIST

References

  1. Higuchi-Sanabria, R., Frankino, P. A., Paul, J. W., Tronnes, S. U., Dillin, A. A Futile Battle? Protein Quality Control and the Stress of Aging. Developmental Cell. 44, (2), 139-163 (2018).
  2. Brenner, S. The genetics of Caenorhabditis elegans. Genetics. 77, (1), 71-94 (1974).
  3. Rual, J. F., et al. Toward improving Caenorhabditis elegans phenome mapping with an ORFeome-based RNAi library. Genome Research. 14, (10B), 2162-2168 (2004).
  4. Timmons, L., Court, D. L., Fire, A. Ingestion of bacterially expressed dsRNAs can produce specific and potent genetic interference in Caenorhabditis elegans. Gene. 263, (1-2), 103-112 (2001).
  5. Reinke, S. N., Hu, X., Sykes, B. D., Lemire, B. D. Caenorhabditis elegans diet significantly affects metabolic profile, mitochondrial DNA levels, lifespan and brood size. Molecular Genetics and Metabolism. 100, (3), 274-282 (2010).
  6. Revtovich, A. V., Lee, R., Kirienko, N. V. Interplay between mitochondria and diet mediates pathogen and stress resistance in Caenorhabditis elegans. PLOS Genetics. 15, (3), e1008011 (2019).
  7. Calfon, M., et al. IRE1 couples endoplasmic reticulum load to secretory capacity by processing the XBP-1 mRNA. Nature. 415, (6867), 92-96 (2002).
  8. Yoneda, T., Benedetti, C., Urano, F., Clark, S. G., Harding, H. P., Ron, D. Compartment-specific perturbation of protein handling activates genes encoding mitochondrial chaperones. Journal of Cell Science. 117, (Pt 18), 4055-4066 (2004).
  9. Link, C. D., Cypser, J. R., Johnson, C. J., Johnson, T. E. Direct observation of stress response in Caenorhabditis elegans using a reporter transgene. Cell Stress & Chaperones. 4, (4), 235-242 (1999).
  10. Heifetz, A., Keenan, R. W., Elbein, A. D. Mechanism of action of tunicamycin on the UDP-GlcNAc:dolichyl-phosphate Glc-NAc-1-phosphate transferase. Biochemistry. 18, (11), 2186-2192 (1979).
  11. Struwe, W. B., Hughes, B. L., Osborn, D. W., Boudreau, E. D., Shaw, K. M. D., Warren, C. E. Modeling a congenital disorder of glycosylation type I in C. elegans: a genome-wide RNAi screen for N-glycosylation-dependent loci. Glycobiology. 19, (12), 1554-1562 (2009).
  12. Taylor, R. C., Dillin, A. XBP-1 is a cell-nonautonomous regulator of stress resistance and longevity. Cell. 153, (7), 1435-1447 (2013).
  13. Castello, P. R., Drechsel, D. A., Patel, M. Mitochondria are a major source of paraquat-induced reactive oxygen species production in the brain. The Journal of Biological Chemistry. 282, (19), 14186-14193 (2007).
  14. Oberley, L. W., Buettner, G. R. Role of Superoxide Dismutase in Cancer: A Review. Cancer Research. 39, (4), 1141-1149 (1979).
  15. Senchuk, M. M., Dues, D. J., Van Raamsdonk, J. M. Measuring Oxidative Stress in Caenorhabditis elegans: Paraquat and Juglone Sensitivity Assays. Bio-protocol. 7, (1), (2017).
  16. Lithgow, G. J., White, T. M., Hinerfeld, D. A., Johnson, T. E. Thermotolerance of a long-lived mutant of Caenorhabditis elegans. Journal of Gerontology. 49, (6), B270-B276 (1994).
  17. Labbadia, J., Morimoto, R. I. The Biology of Proteostasis in Aging and Disease. Annual Review of Biochemistry. 84, (1), 435-464 (2015).
  18. Park, H. E. H., Jung, Y., Lee, S. J. V. Survival assays using Caenorhabditis elegans. Molecules and Cells. 40, (2), 90-99 (2017).
  19. Waggoner, L. E., Hardaker, L. A., Golik, S., Schafer, W. R. Effect of a Neuropeptide Gene on Behavioral States in Caenorhabditis elegans Egg-Laying. Genetics. 154, (3), 1181-1192 (2000).
  20. Durieux, J., Wolff, S., Dillin, A. The cell-non-autonomous nature of electron transport chain-mediated longevity. Cell. 144, (1), 79-91 (2011).
  21. Zevian, S. C., Yanowitz, J. L. Methodological Considerations for Heat Shock of the Nematode Caenorhabditis elegans. Methods (San Diego, Calif). 68, (3), 450-457 (2014).
  22. Shen, X., Ellis, R. E., Sakaki, K., Kaufman, R. J. Genetic interactions due to constitutive and inducible gene regulation mediated by the unfolded protein response in C. elegans. PLoS genetics. 1, (3), e37 (2005).
  23. Frakes, A. E., Dillin, A. The UPR(ER): Sensor and Coordinator of Organismal Homeostasis. Molecular Cell. 66, (6), 761-771 (2017).
  24. Martinus, R. D., et al. Selective induction of mitochondrial chaperones in response to loss of the mitochondrial genome. European Journal of Biochemistry. 240, (1), 98-103 (1996).
  25. Nargund, A. M., Pellegrino, M. W., Fiorese, C. J., Baker, B. M., Haynes, C. M. Mitochondrial import efficiency of ATFS-1 regulates mitochondrial UPR activation. Science (New York, N.Y). 337, (6094), 587-590 (2012).
  26. Baker, B. M., Haynes, C. M. Mitochondrial protein quality control during biogenesis and aging. Trends in Biochemical Sciences. 36, (5), 254-261 (2011).
  27. Shore, D. E., Carr, C. E., Ruvkun, G. Induction of Cytoprotective Pathways Is Central to the Extension of Lifespan Conferred by Multiple Longevity Pathways. PLOS Genetics. 8, (7), e1002792 (2012).
  28. Houtkooper, R. H., et al. Mitonuclear protein imbalance as a conserved longevity mechanism. Nature. 497, (7450), 451-457 (2013).
  29. Chiang, S. M., Schellhorn, H. E. Regulators of oxidative stress response genes in Escherichia coli and their functional conservation in bacteria. Archives of Biochemistry and Biophysics. 525, (2), 161-169 (2012).
  30. Blackwell, T. K., Steinbaugh, M. J., Hourihan, J. M., Ewald, C. Y., Isik, M. SKN-1/Nrf, stress responses, and aging in Caenorhabditis elegans. Free Radical Biology & Medicine. 88, (Pt B), 290-301 (2015).
  31. Nguyen, T., Nioi, P., Pickett, C. B. The Nrf2-antioxidant response element signaling pathway and its activation by oxidative stress. The Journal of Biological Chemistry. 284, (20), 13291-13295 (2009).
  32. Lo, J. Y., Spatola, B. N., Curran, S. P. WDR23 regulates NRF2 independently of KEAP1. PLOS Genetics. 13, (4), e1006762 (2017).
  33. Link, C., Johnson, C. Reporter Transgenes for Study of Oxidant Stress in Caenorhabditis elegans. Methods in enzymology. 353, 497-505 (2002).
  34. Choe, K. P., Przybysz, A. J., Strange, K. The WD40 Repeat Protein WDR-23 Functions with the CUL4/DDB1 Ubiquitin Ligase To Regulate Nuclear Abundance and Activity of SKN-1 in Caenorhabditis elegans. Molecular and Cellular Biology. 29, (10), 2704-2715 (2009).
  35. Velazquez, J. M., Lindquist, S. hsp70: nuclear concentration during environmental stress and cytoplasmic storage during recovery. Cell. 36, (3), 655-662 (1984).
  36. Tissières, A., Mitchell, H. K., Tracy, U. M. Protein synthesis in salivary glands of Drosophila melanogaster: relation to chromosome puffs. Journal of Molecular Biology. 84, (3), 389-398 (1974).
  37. Gomez-Pastor, R., Burchfiel, E. T., Thiele, D. J. Regulation of heat shock transcription factors and their roles in physiology and disease. Nature Reviews Molecular Cell Biology. (2017).
  38. Guisbert, E., Czyz, D. M., Richter, K., McMullen, P. D., Morimoto, R. I. Identification of a tissue-selective heat shock response regulatory network. PLoS genetics. 9, (4), e1003466 (2013).
  39. Hentze, N., Le Breton, L., Wiesner, J., Kempf, G., Mayer, M. P. Molecular mechanism of thermosensory function of human heat shock transcription factor Hsf1. eLife. 5, (2016).
  40. Li, J., Labbadia, J., Morimoto, R. I. Rethinking HSF1 in Stress, Development, and Organismal Health. Trends in Cell Biology. (2017).
  41. Morley, J. F., Morimoto, R. I. Regulation of longevity in Caenorhabditis elegans by heat shock factor and molecular chaperones. Molecular Biology of the Cell. 15, (2), 657-664 (2004).
  42. Senchuk, M. M., et al. Activation of DAF-16/FOXO by reactive oxygen species contributes to longevity in long-lived mitochondrial mutants in Caenorhabditis elegans. PLoS Genetics. 14, (3), (2018).
  43. Henderson, S. T., Bonafè, M., Johnson, T. E. daf-16 protects the nematode Caenorhabditis elegans during food deprivation. The Journals of Gerontology. Series A, Biological Sciences and Medical Sciences. 61, (5), 444-460 (2006).
  44. Prahlad, V., Cornelius, T., Morimoto, R. I. Regulation of the Cellular Heat Shock Response in Caenorhabditis elegans by Thermosensory Neurons. Science. 320, (5877), 811-814 (2008).
  45. Libina, N., Berman, J. R., Kenyon, C. Tissue-specific activities of C. elegans DAF-16 in the regulation of lifespan. Cell. 115, (4), 489-502 (2003).
  46. Shivers, R. P., Kooistra, T., Chu, S. W., Pagano, D. J., Kim, D. H. Tissue-specific activities of an immune signaling module regulate physiological responses to pathogenic and nutritional bacteria in C. elegans. Cell Host & Microbe. 6, (4), 321-330 (2009).
  47. Kaletsky, R., et al. Transcriptome analysis of adult Caenorhabditis elegans cells reveals tissue-specific gene and isoform expression. PLoS Genetics. 14, (8), (2018).
  48. Glover-Cutter, K. M., Lin, S., Blackwell, T. K. Integration of the Unfolded Protein and Oxidative Stress Responses through SKN-1/Nrf. PLOS Genetics. 9, (9), e1003701 (2013).
  49. Liu, Y., Chang, A. Heat shock response relieves ER stress. The EMBO journal. 27, (7), 1049-1059 (2008).
  50. Stroustrup, N., Ulmschneider, B. E., Nash, Z. M., López-Moyado, I. F., Apfeld, J., Fontana, W. The Caenorhabditis elegans Lifespan Machine. Nature Methods. 10, (7), 665-670 (2013).
  51. Leung, D. T. H., Chu, S. Measurement of Oxidative Stress: Mitochondrial Function Using the Seahorse System. Methods in molecular biology (Clifton, N.J). 1710, 285-293 (2018).
  52. Morton, E. A., Lamitina, T. Caenorhabditis elegans HSF-1 is an essential nuclear protein that forms stress granule-like structures following heat shock. Aging Cell. 12, (1), 112-120 (2013).
  53. Haynes, C. M., Petrova, K., Benedetti, C., Yang, Y., Ron, D. ClpP mediates activation of a mitochondrial unfolded protein response in C. elegans. Developmental Cell. 13, (4), 467-480 (2007).
  54. Kwon, E. S., Narasimhan, S. D., Yen, K., Tissenbaum, H. A. A new DAF-16 isoform regulates longevity. Nature. 466, (7305), 498-502 (2010).
  55. An, J. H., et al. Regulation of the Caenorhabditis elegans oxidative stress defense protein SKN-1 by glycogen synthase kinase-3. Proceedings of the National Academy of Sciences of the United States of America. 102, (45), 16275-16280 (2005).
  56. Daniele, J. R., Esping, D. J., Garcia, G., Parsons, L. S., Arriaga, E. A., Dillin, A. High-Throughput Characterization of Region-Specific Mitochondrial Function and Morphology. Scientific Reports. 7, (1), 6749 (2017).
  57. Daniele, J. R., et al. A non-canonical arm of UPRER mediates longevity through ER remodeling and lipophagy. bioRxiv. 471177 (2018).
  58. Xu, N., et al. The FATP1-DGAT2 complex facilitates lipid droplet expansion at the ER-lipid droplet interface. The Journal of Cell Biology. 198, (5), 895-911 (2012).
  59. Baird, N. A., et al. HSF-1-mediated cytoskeletal integrity determines thermotolerance and life span. Science (New York, N.Y.). 346, (6207), 360-363 (2014).
  60. Higuchi-Sanabria, R., et al. Spatial regulation of the actin cytoskeleton by HSF-1 during aging. Molecular Biology of the Cell. 29, (21), 2522-2527 (2018).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics