Misurazioni delle risposte allo stress fisiologico in C. Elegans

* These authors contributed equally
JoVE Journal
Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Qui, caratterizziamo le risposte di stress proteotossico cellulare nel nematode C. elegans misurando l'attivazione di reporter trascrizionali fluorescenti e analizzando la sensibilità allo stress fisiologico.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Bar-Ziv, R., Frakes, A. E., Higuchi-Sanabria, R., Bolas, T., Frankino, P. A., Gildea, H. K., Metcalf, M. G., Dillin, A. Measurements of Physiological Stress Responses in C. Elegans. J. Vis. Exp. (159), e61001, doi:10.3791/61001 (2020).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Gli organismi sono spesso esposti ad ambienti fluttuanti e cambiamenti nell'omeostasi intracellulare, che possono avere effetti negativi sul loro proteoma e sulla fisiologia. Così, gli organismi hanno evoluto risposte mirate e specifiche allo stress dedicate a riparare i danni e mantenere l'omeostasi. Questi meccanismi includono la risposta proteica dispiegata del reticolo endolamico (UPRER),la risposta proteica dispiegata dei mitocondri (UPRMT), la risposta allo shock termico (HSR) e la risposta allo stress ossidativo (OxSR). I protocolli qui presentati descrivono i metodi per rilevare e caratterizzare l'attivazione di questi percorsi e le loro conseguenze fisiologiche nel nematode, C. elegans. In primo luogo, l'uso di reporter trascrizionali fluorescenti specifici del percorso è descritto per la caratterizzazione cellulare rapida, lo screening farmacologico o lo screening genetico su larga scala (ad esempio, RNAi o librerie mutanti). Inoltre, vengono descritti saggi fisiologici complementari e robusti, che possono essere utilizzati per valutare direttamente la sensibilità degli animali a fattori di stress specifici, servendo come convalida funzionale dei reporter trascrizionali. Insieme, questi metodi consentono una rapida caratterizzazione degli effetti cellulari e fisiologici delle perturbazioni proteotossiche interne ed esterne.

Introduction

La capacità di un organismo di rispondere ai cambiamenti nell'ambiente intra ed extracellulare è cruciale per la sua sopravvivenza e adattamento. Questo si ottiene a livello cellulare attraverso numerose vie protettive che garantiscono l'integrità della cellula. Mentre numerosi componenti cellulari sono soggetti a danni associati allo stress, uno dei principali coinvolgimenti delle risposte allo stress cellulare è quello di riparare e proteggere l'omeostasi del proteoma cellulare. Tuttavia, la compartimentazione delle proteine in strutture speciali, chiamate organelli, rappresenta una sfida per la cellula, in quanto non può basarsi su una forma centralizzata di controllo della qualità delle proteine per garantire che tutte le proteine all'interno della cellula siano correttamente piegate e funzionali. Pertanto, per affrontare le perturbazioni alle loro proteine, gli organelli hanno sviluppato meccanismi di controllo della qualità dedicati, che possono percepire le proteine piegate male e attivare una risposta allo stress nel tentativo di alleviare lo stress all'interno di quel compartimento. Ad esempio, il citosol si basa sulla risposta all'urto termico (HSR), mentre il reticolo endoplasmico (ER) e i mitocondri si basano sulle loro risposte proteiche spiegate specifiche per il compartimento (UPR). L'OxSR serve ad alleviare gli effetti tossici delle specie reattive dell'ossigeno (ROS). Ogni risposta allo stress viene attivata in presenza di sfide cellulari e insulti ambientali e induce una risposta trascrizionale su misura. I segni distintivi di queste risposte includono molecole sintetizzanti che ripiegano le proteine piegate male (come gli chaperoni) mirate all'organida corretta, o in alternativa, rimuovono le proteine danneggiate dalla degradazione delle proteine. La mancata attivazione di queste risposte allo stress comporta l'accumulo di proteine danneggiate, la disfunzione cellulare propagata al fallimento sistemico dei tessuti e infine la morte dell'organismo. La funzione e la regolazione delle diverse risposte allo stress sono esaminate altrove1.

Molte intuizioni riguardanti la regolazione e l'attività delle risposte allo stress cellulare sono state attribuite al nematode, Caenorhabditis elegans, un organismo modello multicellulare nella ricerca genetica. I nematodi non solo consentono di studiare l'attivazione delle risposte allo stress a livello cellulare, ma anche a livello di organismo; nematodi sono stati utilizzati per studiare gli effetti delle perturbazioni genetiche o l'esposizione a farmaci e inquinanti sulla loro crescita e sopravvivenza. Il loro tempo di generazione rapido, l'isogenesi, la trasparenza, la trattatività genetica e la facilità d'uso durante la sperimentazione li rendono ideali per tali studi. Inoltre, la risposta fisiologica relativamente veloce allo stress (tra ore e pochi giorni) e la conservazione evolutiva dei percorsi cellulari rendono i nematodi uno strumento prominente nello studio della resistenza allo stress.

Ci sono due ceppi di E. coli comunemente usati utilizzati come fonte di cibo per far crescere C. elegans: OP50 standard, un ceppo B in cui la maggior parte della sperimentazione è stata storicamente eseguita2 e HT115, un ceppo K-12 che viene utilizzato per quasi tutti gli esperimenti RNAi3,4. È importante notare che ci sono differenze significative tra le diete batteriche OP50 e HT115. La crescita su queste diverse fonti batteriche ha dimostrato di causare grandi differenze nel profilo metabolico, numero di copia del DNA mitocondriale, e diversi fenotipi principali, tra cui la durata della vita5. Alcune di queste differenze sono attribuite alla carenza di vitamina B12 associata alla crescita sui batteri OP50, che può provocare difetti nell'omeostasi mitocondriale e una maggiore sensibilità agli agenti patogeni e agli stress. Tutti questi fenotipi hanno dimostrato di essere alleviato dalla crescita sui batteri HT115, che hanno livelli più elevati di vitamina B126. Pertanto, si raccomanda di eseguire tutti gli esperimenti sulle risposte allo stress fisiologico sui batteri HT115, indipendentemente dalla necessità di condizioni di RNAi. Tuttavia, a causa della facilità di mantenimento degli animali su OP50, tutta la crescita standard (cioè la manutenzione e l'amplificazione degli animali) può essere eseguita su OP50, poiché differenze significative nei paradigmi sperimentali qui descritti non sono state rilevate nei worm mantenuti su OP50, purché siano stati spostati nell'HT115 dopo la sincronizzazione (cioè, dal post-bleaching del portello con o senza l'arresto L1) fino alla sperimentazione dell'arresto L1.

Qui, viene descritta la caratterizzazione dell'attività delle risposte allo stress cellulare utilizzando due metodi funzionali. Va notato che i protocolli presentati si concentrano principalmente sulle risposte allo stress cellulare e sul loro impatto sull'omeostasi delle proteine. In primo luogo, vengono utilizzati i reporter trascrizionali fluorescenti, che sono regolati da promotori genici endogeni che sono specificamente attivati in risposta a diversi stress cellulari. Questi reporter trascrizionali fluorescenti si basano sull'induzione trascrizionale di geni specifici che fanno nativamente parte della risposta allo stress. Ad esempio, l'HSP-4, una proteina da shock termico ortologo al accompagnatore umano HSPA5/BiP, viene attivata su stress ER e localizza al ER per alleviare lo stress. In condizioni di stress DA E. (ad esempio, l'esposizione alla tunicacina), una proteina fluorescente verde (GFP), posta sotto la regolazione del promotore hsp-4, è sintetizzata in alti livelli come può essere valutato mediante microscopia fluorescente o misurata quantitativamente utilizzando citometria di flusso di grandi particelle di nematodi7. Allo stesso modo, il promotore di un chaperone mitocondriale, hsp-6 (ortologo del mammifero HSPA9), viene utilizzato per monitorare l'attivazione dell'UPRMT8e il promotore del chaperone citosolico hsp-16.2 (ortologo al gene alfa cristallino umano) viene utilizzato per valutare l'attività dell'HSR9. Questi giornalisti permettono una rapida caratterizzazione dei percorsi attivati in risposta a varie perturbazioni.

Spesso, i giornalisti qui presentati sono immagini con microscopia, che fornisce un output qualitativo dell'attivazione delle risposte allo stress. Tuttavia, mentre le tecniche di imaging forniscono sia informazioni sull'intensità che sulla posizione dei tessuti dei reporter sopra descritti, la sua quantificazione non è sempre accurata o robusta. Sebbene sia possibile quantificare l'attivazione fluorescente utilizzando strumenti di analisi dell'imaging, questi metodi hanno una produttività relativamente bassa e le dimensioni del campione sono ridotte, a causa del numero relativamente basso di animali immaginati. La facilità e la capacità di ottenere grandi quantità di animali rendono rapidamente C. elegans un sistema modello ideale per testare l'attivazione dei reporter di stress fluorescente attraverso l'uso di un grande citometro a flusso di particelle. Un citometro a flusso di grandi particelle è in grado di registrare, analizzare e ordinare in base alle dimensioni e alla fluorescenza di molti animali vivi. Utilizzando questo metodo, è possibile ottenere l'intensità fluorescente, le dimensioni, e anche le informazioni spaziali (2D) per migliaia di vermi. Il sistema è controllato utilizzando FlowPilot, che consente l'acquisizione e l'analisi in tempo reale dei dati misurati. Qui, i metodi per l'imaging microscopico e l'analisi quantitativa utilizzando un citometro di flusso di particelle di grandi dimensioni sono offerti come metodi per misurare l'attivazione delle risposte allo stress.

Oltre all'analisi dei reporter, la sensibilità o la resistenza degli animali allo stress possono essere misurate utilizzando analisi dello stress fisiologico. Ciò si ottiene esponendo gli animali ad ambienti stressanti che attivano percorsi specifici di stress cellulare. Qui, vengono forniti diversi metodi per misurare la sensibilità di animali interi a specifici tipi di fattori di stress.

La sollecitazione ER viene applicata a C. elegans utilizzando l'agente chimico, la tunicamycina, che blocca la glicosilazione legata a N, causando l'accumulo di proteine piegate in modo misto nel ER10. In C. elegans, la crescita dopo l'esposizione alla tunicacina provoca grandi perturbazioni nella funzione ER, e una durata significativamente ridotta11. Misurando la sopravvivenza degli animali su placche contenenti tunicacina, è possibile quantificare la sensibilità allo stress ER degli animali. Ad esempio, gli animali con induzione ectopica di UPRER e quindi una maggiore resistenza allo stress da misfolding delle proteine nel ER hanno una maggiore sopravvivenza in base all'esposizione alla tunicamicina rispetto agli animali di tipo selvatico12.

Lo stress ossidativo e mitocondriale viene applicato a C. elegans esponendo gli animali all'agente chimico, il paraquat. Paraquat è un erbicida comunemente usato, che provoca la formazione di superossido specificamente nei mitocondri13. A causa della localizzazione specifica delle specie reattive dell'ossigeno derivate dai mitocondri (ROS), i saggi paraquati sono spesso usati come un saggio di stress "mitocondriale". Tuttavia, il superossido viene rapidamente convertito in perossido di idrogeno dalle dismutasi mitocondriali del superossido (SOD)14. Il perossido di idrogeno può successivamente diffondersi dai mitocondri e causare stress ossidativo in altri compartimenti della cellula. Pertanto, descriviamo i saggi di sopravvivenza dei paraquati come misurala della sensibilità allo stress mitocondriale e ossidativo (altri test di stress ossidativo possono essere trovati15).

I saggi di termotolleranza vengono eseguiti in C. elegans mettendo gli animali a temperature elevate. Le temperature ambientali per i nematodi sono di 15-20 gradi centigradi e lo stress termico è indotto a temperature superiori a2:C16,17. I saggi di termotolleranza sono generalmente eseguiti a temperature che vanno da 30-37 gradi centigradi, poiché gli animali presentano gravi difetti cellulari a questa temperatura, e i test di sopravvivenza vengono completati entro 24 ore16,18. In questo caso, sono previsti due metodi alternativi per l'esecuzione di saggi di termotolleranza: crescita a 34 gradi centigradi e crescita a 37 gradi centigradi. Insieme, i protocolli qui presentati possono essere utilizzati per eseguire schermi su larga scala quando combinati con il gene knock-down standard utilizzando l'interferenza dell'RNA o le librerie di farmaci chimici.

Il protocollo può essere suddiviso in 4 procedure generali: crescita di C. elegans e preparazione per l'imaging (sezioni 1 e 2), imaging di reporter trascrizionali utilizzando microscopia fluorescente (sezioni 3-5), misurazioni quantitative dei reporter che utilizzano un citometro di flusso di grandi particelle (sezione 6) e analisi fisiologiche per misurare la sensibilità allo stress in C. elegans (sezione 7).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Condizioni di crescita standard delle temperature e OP50 rispetto all'HT115

  1. Crescita ed espansione standard
    1. Coltivare una cultura di OP50 in LB (Tabella 1) o supporti equivalenti di scelta per 24-48 h a temperatura ambiente (22-25 gradi centigradi). Crescere batteri a temperatura ambiente come OP50 è un uracicolo auxotroph e c'è una maggiore incidenza di rerevertant (ad esempio, mutanti soppressori) quando coltivato a 37 gradi centigradi. L'archiviazione a lungo termine delle colture OP50 non è consigliata (massimo 1 settimana a 4 gradi centigradi).
    2. Semina un volume di 100-200 dollari di coltura OP50 satura su una piastra NGM da 60 mm (Tabella 1) per la manutenzione dei vermi e 1 mL di coltura OP50 satura su una piastra da 100 mm per l'espansione degli animali per la sperimentazione.
    3. Lasciare asciugare i piatti durante la notte su un piano di panca.
      NOTA: le piastre da 100 mm potrebbero aver bisogno di più tempo per asciugarsi, soprattutto se si utilizzano piastre non ventilate. Conservare tutte le piastre C. elegans in contenitori a tenuta d'aria conservati a 4 gradi centigradi. Non utilizzare piastre oltre 6 mesi di età come disidratazione di piastre si verificherà, che cambierà la fisiologia animale su piastre a causa di diversa pressione osmotica e rigidità delle piastre.
    4. Per la manutenzione standard, spostare 10-15 giovani animali (uova, L1 o stadi L2) su una piastra di 60 mm, anche se più possono essere spostati se si tratta di mutanti o animali transgenici con fecondità inferiore. Per gli animali con difetti di sviluppo o fecundità, suddividere una piscina più variabile di animali per prevenire la perdita dello stock. Se tenuti a 15 gradi centigradi, spostare gli animali ogni settimana; per 20 gradi centigradi, spostare gli animali ogni 3-4 giorni.
    5. Eseguire un fresco disgelo di animali ogni 25-30 passaggi (6 mesi se gli animali vengono spostati una volta alla settimana e tenuti a 15 gradi centigradi).
    6. Per l'espansione, suddividere una piastra completa da 60 mm su piastre da 100 mm per l'espansione. Come telaio di riferimento, gli animali con fecondità di tipo selvatico possono avere una piastra completa di 60 mm tagliata in 4ths-6ths ed essere tagliati su una grande piastra a 20 gradi centigradi per 2 giorni o 15 gradi centigradi per 3 giorni per creare una piastra completa di 100 mm senza raggiungere la fame.

2. Gestione/sincronizzazione dei worm mediante sbiancamento

  1. Protocollo di sbiancamento per sincronizzare i worm
    1. Lavare i vermi gravidi (adulti pieni di uova) dai piatti di agar utilizzando M9 (Tabella 1). Iniziare da una popolazione non sincronizzata di vermi (cioè, vermi in blocchi dal passaggio 1.1.6) alla candeggina per gli esperimenti, in quanto una significativa deriva genetica può verificarsi su cicli successivi di sincronizzazione tramite sbiancamento.
    2. Spostare la miscela verme/M9 in un tubo conico da 15 mL utilizzando una pipetta di vetro; diverse piastre di vermi possono essere raccolte in un unico tubo conico da 15 mL.
    3. Spin animali verso il basso per 30 s a 1.000 x g. Aspirate M9 supernatante. Non è necessario lavare i batteri residui a meno che non vi sia una quantità eclatante di contaminazione o grandi ciuffi di batteri. In questo caso, eseguire diversi washes con M9.
    4. Preparare una nuova scorta di soluzione di sbiancamento (Tabella 1). La soluzione di sbiancamento può essere conservata per diversi giorni a 4 gradi centigradi, ma utilizzare una soluzione di sbiancamento appena fatta in quanto lo sbiancamento inefficiente può causare uno sbiancamento irregolare, che causerà danni alle uova prima di eliminare tutte le carcasse del verme.
    5. Aggiungere agli animali una soluzione di sbiancamento da 2 a 10 mL (1 mL di soluzione di candeggina per ogni 0,1 mL di pellet animale). Invertire la miscela di candeggina e verme per 5 min (non superare i 10 min; si noti che i tempi di sbiancamento possono variare e devono essere titolerati specificamente per ogni laboratorio). Agitare vigorosamente per aiutare a sciogliere le carcasse del verme più velocemente e per una conservazione ottimale delle uova. Osservare periodicamente al microscopio di scarico o mettere il tubo conico ad una luce per osservare quando le carcasse del verme adulto si sono completamente disciolte e rimangono solo le uova nel tubo.
    6. Pellet le uova filando a 1.000 x g per 30 s e poi aspirare il supernatante. Le uova possono essere centrifughe più velocemente dei vermi senza interrompere la loro integrità, quindi se non sono sicuro della velocità di centrifuga, le uova possono essere filate fino a 2.500 x g senza alterare la loro fisiologia.
    7. Aggiungere M9 fino a 15 mL e invertire il tubo per cancellare la candeggina dalle uova.
    8. Ripetere i passaggi 2.1.6-2.1.7 (processo di lavaggio/pellet) 2-3 più volte per rimuovere la candeggina.
    9. Uovo di pipet/M9 si mescolano su piatti e crescono a 15-20 gradi centigradi per la sperimentazione. Per ottenere una misura del numero di vermi da utilizzare, eseguire conteggi approssimativi delle uova conlatando 5 - L. di miscela di uova su un piatto di agar o scivolo e dividendo il numero di uova per 5 per determinare il numero di uova per 1 : L di volume. Una media di 3 conteggi indipendenti può migliorare la precisione. Per evitare la fame, una tabella di conteggi di uova raccomandati per piastra è disponibile nella tabella 2.
    10. Se necessario, L1 arresta gli animali per una più stretta sincronizzazione temporale mettendo la miscela uovo/M9 in un rotatore a 20 gradi centigradi per un massimo di 24 h. Per gli animali di tipo selvatico, non sono stati rilevati difetti nella fisiologia animale quando L1 si arresta fino a 48 h. Tuttavia, i mutanti sensibili alla fame (ad esempio, mutanti lisosomi o autofagia) fanno molto male con l'arresto di L1, e quindi non è consigliabile eseguire questo metodo di sincronizzazione per i mutanti che sono noti per essere sensibili alla fame. Se è necessaria una sincronizzazione più rigorosa per gli animali che non possono essere arrestati L1, utilizzare il metodo di laici d'uovo descritto nella sezione 2.2.
  2. Protocollo di laici d'uovo per la sincronizzazione dei vermi
    NOTA: Come metodo alternativo per lo sbiancamento, può essere eseguito un saggio di lapide d'uovo. La deposizione delle uova viene utilizzata quando lo sbiancamento degli animali non fornisce una sincronizzazione abbastanza vicina, in quanto le uova all'interno del sacco di uova degli animali adulti possono essere diverse come 8-12 h di distanza. Per i paradigmi sperimentali in cui è fondamentale che gli animali siano il più possibile in scena, ma dove l'arresto di L1 non è possibile (ad esempio, nei mutanti affamati), si raccomandano i saggi laici di uova. Tuttavia, va notato che a causa del lavoro coinvolto nel protocollo di laici di uova, è meno fattibile eseguire esperimenti su larga scala.
    1. Posizionare 4-12 adulti gravidi (vedere Nota dopo il passaggio 2.2.2) su una piastra NGM standard OP50 o HT115 (vedere la sezione 1 sopra per le raccomandazioni sui ceppi batterici). A seconda della scala degli esperimenti, è possibile utilizzare più piastre. Assicurarsi di documentare attentamente quanti animali sono su ogni piatto per il passaggio 2.2.
    2. Collocare gli animali alla temperatura desiderata per gli esperimenti (15-20 gradi centigradi) per 4-8 h.
      NOTA: Il numero di ore che gli animali vengono lasciati sul piatto determinerà quanto strettamente sincronizzato il primo uovo deposto e l'ultimo uovo deposto sarà, in modo che la tempistica può essere regolata in base alle esigenze. Poiché tempi di incubazione più brevi significano che ogni animale ha meno tempo per deporre le uova, più animali dovrebbero essere messi su piatti per garantire che vengano deposte abbastanza uova. Mentre l'effettivo tasso di deposizione delle uova non è completamente normalizzato a causa della tendenza degli animali a passare attraverso brevi raffiche di deposizione delle uova piuttosto che un tasso normalizzato di uova deposte, il tasso medio di uova deposte per animale può essere stimato a 5 ovuli all'ora per gli animali che espongono fecondità di tipo selvatico19. Quando si cerca di coltivare animali fino alla fase adulta del primo giorno, è il tempo di avere <100 uova per piatto per evitare la fame (fare riferimento alla Tabella 2 per ulteriori dettagli sugli animali raccomandati per piatto).
    3. Rimuovere gli animali adulti dai piatti. Assicurarsi che tutti gli animali adulti vengano rimossi dalle piastre, poiché gli animali continueranno a deporre le uova e a provocare una popolazione non sincronizzata e/o la fame della piastra.

3. Condizioni di crescita dei vermi per l'imaging di giornalisti trascrizionali

  1. Crescita dei vermi
    1. Cultura batterica inoculata di HT115 che ospita pLasmide di RNAi (EV) e/o portando una cassetta RNAi contro i geni bersaglio desiderati in supporti LB integrati con 100 g/mL di carcillina e tetraciclina da 20 g/mL.
    2. Coltivare la coltura durante la notte (16 ore) fino alla saturazione in un incubatore tremante di 37 gradi centigradi.
    3. Avvistale di 60 mm NGM RNAi con 200 litri di coltura batterica satura e piastre NGM RNAi da 100 mm con 1.000 l di coltura batterica satura. Lasciare asciugare a temperatura ambiente (22 gradi centigradi) durante la notte al buio (coperto liberamente con un foglio di alluminio).
    4. Collocare la popolazione sincronizzata di vermi transgenici che trasportano reporter fluorescenti (vedi tabella 3 per l'elenco completo) su piastre NGM RNAi seminata con batteri di scelta.
    5. Crescere a 15-20 gradi centigradi alle fasi richieste per giornalisti specifici, come descritto di seguito.
  2. Considerazioni per la messa in scena di worm per le sperimentazioni
    1. Eseguire esperimenti per i giornalisti trascrizionali al primo giorno di età adulta, ad eccezione dei saggi che richiedono animali L4. Secondo WormAtlas, gli animali L4 sono ottenuti circa 2,5 giorni (56 h) di crescita a 20 gradi centigradi dalla fase delle uova (www.wormatlas.org).
    2. Per gli adulti del primo giorno, utilizzare gli animali a circa 3-4 giorni (65-96 h) di crescita a 20 gradi centigradi dopo aver placcato le uova.
      NOTA: Questa vasta gamma è spiegata come segue: 65 h a 20 gradi centigradi è quando gli animali raggiungono la "deposizione delle uova", che è il vero stato di "età adulta". 96 h è quando gli animali entrano ciò che WormAtlas descrive come "uovo-deposizione massima", che è quando l'adulto è un adulto gravido e ha un sacco di uova pieno. Questo è quando gli animali sarebbero descritti come più vecchi del giorno 1 e possono iniziare a visualizzare le differenze, e quindi i protocolli descritti qui sono tutti raccomandati per iniziare in questa fase "giorno 1" a partire da 65 h e fino a 96 h. Per i saggi qui descritti, non sono state osservate grandi differenze quando si utilizzano animali in questa finestra di 65-96 h.
    3. Per le repliche di un singolo esperimento, utilizzare un punto di tempo simile per una riproducibilità più robusta (ad esempio, eseguire tutti gli esperimenti a 65 h o 96 h dopo la placcatura delle uova).
      NOTA: Alcuni animali transgenici e mutanti mostrano tassi di crescita rallentati. Per questo esistono due raccomandazioni. 1) Utilizzare una sincronizzazione sfalsata, in cui gli animali possono essere sbiancati in momenti diversi per poter eseguire la sperimentazione allo stesso tempo. Ciò è consigliato quando la variabilità tecnica nella saggia può essere maggiore delle variabili tecniche che possono derivare dal saggio di sincronizzazione (ad esempio, i test di sopravvivenza, che durano per lunghi durati possono soffrire se non vengono eseguiti contemporaneamente). 2) Utilizzare un'analisi sfalsata, in cui gli animali possono essere sbiancati contemporaneamente, ma il saggio stesso viene eseguito in momenti diversi. Questo è raccomandato per i saggi molto semplici che non hanno variabilità intrinseca (ad esempio, l'induzione di RNAi delle risposte allo stress).

4. Induzione delle risposte allo stress

  1. Utilizzo di hsp-4p::GFP come lettura per l'attivazione dell'UPRER
    1. Indurre lo stress ER usando RNAi
      1. Preparare piastre macchiate con batteri RNAi che prendono di mira il gene di interesse sulle piastre NGM RNAi (Tabella 1) come nella sezione 3. Utilizzare EV come controllo per i livelli basali di UPRER e il knockdown RNAi del tag-335 (enzima per la glicosilazione legata a N delle proteine residenti nel ER; Il knockdown dell'RNAi ha effetti simili al trattamento della tunicamicina) come controllo positivo per l'attivazione dell'UPRER sotto stress ER.
      2. Sincronizzare gli animali reporter hsp-4p::GFP utilizzando i metodi descritti nella sezione 2.
      3. Piatto uova su piastre di RNAi utilizzando i criteri raccomandati nella tabella 2.
      4. Incubare le uova a 20gradi centigradi per circa 3-4 giorni (65-96 h) per eseguire esperimenti al primo giorno di età adulta. Per gli esperimenti UPRER, ci sono differenze nella fluorescenza basale del reporter hsp-4::GFP se coltivato a temperature diverse. Pertanto, eseguire tutti gli esperimenti a 20 .
    2. Indurre lo stress ER utilizzando un agente chimico
      1. Sincronizzare gli animali reporterh-4p::GFP utilizzando i metodi descritti nella sezione 2 e crescere a 20 gradi centigradi fino a quando gli animali raggiungono lo stadio L4. Trasferire gli animali in un tubo di M9. Consentire ai vermi di stabilirsi (2-3 min per gravità o un giro di 30 s a 1.000 x g),quindi rimuovere M9.
      2. Diluire tunicamycin a 25 ng/mL in M9 (una diluizione 1:40 da 1 0mmg/mL di stock). Come controllo, diluire anche un volume equivalente di DMSO in M9.
      3. Aggiungere 25 ng/mL tunicamycin/M9 o controllare la soluzione DMSO/M9 ai vermi (utilizzare 400-500 mL per un tubo da 1,5 mL o 2 mL per un tubo conico da 15 mL). Incubare a 20 gradi centigradi su una piattaforma rotante per 3-4 ore.
        NOTA: La tunicamicina può anche essere diluita direttamente nella miscela worm/M9.
      4. Lasciare che i vermi si depositino, rimuovano la soluzione M9/TM e lavicono con 1 mL di M9.
      5. Trasferire gli animali su piastre NGM o piastre NGM RNAi e consentire di recuperare durante la notte (o 15-20 h) e raggiungere il giorno 1 dell'età adulta a 20 gradi centigradi prima di eseguire la microscopia fluorescente (sezione 5). Viene eseguito un recupero notturno per consentire l'accumulo di un livello rilevabile di GFP.
      6. In alternativa, indurre hsp-4p::GFP spostando gli animali L4 in piastre di agar contenenti 25 ng/L tunicamycin per 16-24 h. Questo ha un'induzione molto più robusta di hsp-4p::GFP a causa della maggiore durata dello stress, e quindi l'intervallo dinamico è molto più basso rispetto all'analisi descritta sopra.
  2. Utilizzo di hsp-6p::GFP come lettura per l'attivazione dell'UPRMT
    1. Indurre lo stress mitocondriale utilizzando RNAi
      1. Attivare UPRMT seguendo lo stesso protocollo della sezione 4.1.1, tranne usando il knockdown RNAi dei geni mitocondriali, come il cox-5b/cco-1 (sottounità citocromatica c oxidase 5B; il knockdown inibisce l'attività della catena di trasporto degli elettroni). Per l'attivazione UPRMT attraverso perturbazioni nella funzione della catena di trasporto degli elettroni, il knockdown RNAi deve essere eseguito durante lo sviluppo iniziale20. Pertanto, eseguire RNAi da tratteggio per questi esperimenti.
    2. Indurre lo stress mitocondriale usando un agente chimico
      1. Preparare piastre avvistate con batteri RNAi che prendono di mira il gene di interesse come nella sezione 3. Utilizzare batteri HT115 anche in esperimenti che non coinvolgono RNAi knockdown (vedi Sezione 1). Assicurarsi che entrambe le piastre DI RNAi NGM (o NGM RNAi , DMSO0.2) e le piastre NGM RNAi - antimicina A (Tabella 1) siano entrambe preparate per il passaggio 4.2.2.5.
      2. Sincronizzare gli animali reporter del reporter hsp-6p::GFP o hsp-60p::GFP utilizzando i metodi descritti nella sezione 2.
      3. Piatto uova su piastre di semi di scelta utilizzando i criteri raccomandati nella tabella 2. Poiché l'antimicina A è disciolta nella DMSO, far crescere gli animali su placche NGM RNAi - DMSO0.2 dal portello.
      4. Incubare le uova a 20gradi per 2 giorni (56 h) fino allo stadio L4. In alternativa, coltiva gli animali a 15 gradi centigradi per 3 giorni.
      5. Spostare i vermi da NGM RNAi - piastre DMSO0.2 a NGM RNAi - antimicina A piastre o PIastre NGM RNAi - DMSO0.2 come controllo. I vermi possono essere spostati manualmente con un plettro per esperimenti su piccola scala, ma per esperimenti su larga scala, si consiglia di lavare gli animali con M9, stabilirsi con centrifugazione, aspirare M9, e poi placcare a piastre NGM RNAi - antimicina A.
      6. Incubare i vermi per un ulteriore 20 h e immagine al giorno 1 adulto (sezione 5).
  3. Uso di gst-4p::GFP come lettura per la risposta allo stress ossidativo.
    1. Indurre OxSR utilizzando RNAi
      1. In alternativa, indurre gst-4p::GFP utilizzando RNAi-knockdown di wdr-23 (codifica un regolatore negativo di skn-1; così, il suo knockdown induce OxSR) utilizzando il protocollo descritto nella sezione 4.1.1.
    2. Indurre l'OxSR utilizzando l'esposizione all'idroperossido chimico ossidante Tert-butyl (TBHP)
      1. Preparare piastre avvistate con batteri RNAi che prendono di mira il gene di interesse come nella sezione 3. Utilizzare batteri HT115 anche in esperimenti che non coinvolgono RNAi knockdown (vedi Sezione 1).
      2. Sincronizzare gli animali reporter gst-4p::GFP utilizzando i metodi descritti nella sezione 2.
      3. Piatto uova su piastre di semi di scelta utilizzando i criteri raccomandati nella tabella 2. Assicurarsi di preparare più piastre del necessario come il protocollo di trattamento della droga provoca la perdita di >10-20% degli animali. Per l'imaging, iniziare con >100 animali e per la selezione, iniziare con >1,000 animali.
      4. Incubare le uova in 20 gradi centigradi per 2 giorni (56 h) fino allo stadio L4. In alternativa, coltiva gli animali a 15 gradi centigradi per 3 giorni.
      5. Lavare gli animali L4 dalle piastre e dividere in due tubi conici da 15 mL per condizione. Volume aspirato fino ad almeno 1 mL e aggiungere un volume uguale di appena fatto 2 mM TBHP. Utilizzare un volume liquido totale ad almeno 2 mL, poiché volumi più bassi possono causare una significativa mortalità di vermi durante la rotazione. Non lavare prima del trattamento farmacologico, poiché i batteri residui dalle piastre aiuteranno a garantire che i vermi non prevedano durante l'incubazione.
      6. Incubare i vermi sul rotatore per 4 ore a 20 gradi centigradi.
      7. Lavare i vermi ruotando a 1.000 x g,aspirando mix M9 e sostituendo con 15 mL di M9. Ripetere per un secondo lavaggio.
      8. Piastra di vermi su RNAi EV per il recupero durante la notte (16-24 h) a 20 gradi centigradi. I vermi possono essere recuperati sull'RNAi corrispondente di scelta, ma non sono state osservate differenze significative quando vengono recuperati su EV RNAi, quindi questo può essere fatto per la facilità di configurazione sperimentale. Prendere le immagini del giorno 1 adulti dopo il recupero.
        NOTA: viene eseguito un recupero notturno per consentire l'accumulo di un livello rilevabile di GFP. Senza questo recupero, non vi è alcun segnale GFP rilevabile. Se si desidera un recupero a breve termine, è possibile utilizzare il saggio descritto nella sezione 4.3.3.
    3. Indurre l'OxSR utilizzando l'esposizione al paraquat chimico ossidante (PQ)
      1. Ripetere tutti i passaggi nella sezione 4.2.2 per ottenere 2 lotti di animali L4 gst-4p::GFP in tubi conici da 15 mL per condizione.
      2. Volume aspirato fino ad almeno 1 mL e aggiungere un volume uguale di PQ fresco 100 M. Simile a 4.3.2.5, si consiglia un volume minimo di 2 mL.
      3. Incubare i vermi sul rotatore per 2 h a 20 gradi centigradi.
      4. Lavare i vermi ruotando a 1.000 x g,aspirando M9 e sostituendo con 15 mL di M9. Ripetere per un secondo lavaggio.
      5. Piastrare vermi su EV RNAi per recuperare per 2 h a 20 gradi centigradi, e poi prendere le immagini subito dopo il recupero.
        NOTA: 2 h di recupero è stato il recupero minimo richiesto per visualizzare l'induzione GFP.
  4. Utilizzo di hsp-16.2p::GFP e hsp-70p::GFP come lettura per l'attivazione HSR.
    1. Indurre HSR utilizzando l'esposizione a temperature elevate
      1. Preparare piastre avvistate con batteri RNAi che prendono di mira il gene di interesse come nella sezione 3. Utilizzare i batteri HT115, anche in esperimenti che non coinvolgono RNAi knockdown (vedi Introduzione).
      2. Sincronizzare gli animali reporter hsp-16.2p::GFP o hsp-70p::GFP utilizzando i metodi descritti nella sezione 2.
      3. Piatto uova su piastre di semi di scelta utilizzando i criteri raccomandati nella tabella 2. Assicurarsi di preparare 2 volte il numero di piastre necessarie in quanto metà del campione sarà esposta a temperature elevate per l'induzione di shock termico, e l'altra metà servirà come un controllo non riscaldato.
      4. Incubare le uova a 20gradi centigradi per circa 3-4 giorni (65-96 h) per eseguire esperimenti al primo giorno di età adulta. Non far crescere vermi a 15 gradi centigradi per esperimenti di shock termico in quanto vi sono solo piccole differenze tra gli animali che sperimentano shock termico su 15 .
      5. Spostare i gruppi sperimentali di animali in un'incubatrice di 34 gradi centigradi per 2 h. Posizionare le piastre nell'incubatrice come un unico strato (cioè senza impilamento di piastre) per garantire la distribuzione più rapida ed equa del calore attraverso le piastre.
      6. Spostare gli animali con shock termico in un'incubatrice di 20 gradi centigradi per recuperare per 2 h e quindi immagine immediatamente (vedere sezione 5). Gli animali possono essere recuperati più a lungo se necessario per una maggiore induzione di GFP.
        NOTA: 2 h di recupero è stato il recupero minimo richiesto per visualizzare l'induzione GFP.

5. Imaging con un microscopio stereo o un microscopio a campo largo/composto a basso ingrandimento

  1. Preparazione di vermi per la microscopia fluorescente
    1. Pipette 5-10 - L di 100 mM di azide di sodio sopra una piastra NGM standard (cioè nessun batterio).
      NOTA: La concentrazione di azide di sodio può essere abbassata a partire da 10 mM, anche se l'immobilizzazione più robusta è stata osservata a 100 mM di azie di sodio senza alcun effetto rilevabile sul segnale fluorescente.
    2. Sotto un microscopio dissezioso, scegli 10-20 animali da piastre sperimentali e trasferiscili nel punto di azide di sodio. Gli animali dovrebbero cessare il movimento poco dopo l'atterraggio nell'azide di sodio, e l'azide di sodio stesso evapora in pochi secondi.
    3. Una volta che l'azide di sodio è evaporato, allineare gli animali alla configurazione di imaging desiderato. Spostare gli animali fianco a fianco con i lati anteriori e posteriori nello stesso orientamento per tutti gli animali. Immagine di animali immediatamente.
      NOTA: non sono stati osservati cambiamenti nel segnale dei giornalisti per nessuno dei reporter trascrizionali nella tabella 3 per un massimo di 15 min dopo paralizzarsi nell'azide di sodio.
  2. Acquisizione di immagini con uno stereomicroscopio
    NOTA: Per questo protocollo, è stato utilizzato un microscopio Leica M205FA dotato di una telecamera CCD monocromatica Leica DFC3000G, filtro Leica GFP standard (ex 395-455, EM 480 LP) e software LAS X. Le impostazioni consigliate per i tempi di esposizione sono disponibili nella tabella 4.
    1. Avviare il programma LAS X.
    2. Avviare un nuovo progetto: aprire la scheda di acquisizione, fare clic su Apri progetti e fare clic su Cartella per aprire un nuovo progetto. Questo progetto può essere rinominato facendo clic con il pulsante destro del mouse sulla cartella e scorrendo verso il basso fino a Rinomina o facendo clic su F2. Nella scheda acquisizione, ci sono anche opzioni per regolare il tempo di esposizione e lo zoom alle impostazioni desiderate.
    3. Posizionare il campione di verme al microscopio e individuare il punto focale corretto dei vermi utilizzando l'impostazione del campo luminoso per ridurre al minimo lo sbiancamento fluorescente. Il centro del campione è dove la linea di uova è chiaramente visibile e non sfocata. Impostare il tempo di esposizione, lo zoom, la messa a fuoco e i condensatori dei campi luminosi sulle impostazioni desiderate.
    4. Acquisire un'immagine utilizzando il pulsante Acquisisci immagine.
    5. Salvare l'immagine in formato .lif (Leica Image File) in quanto salva tutte le immagini e i metadati non elaborati. Un TIFF può anche essere esportato facendo clic con il pulsante destro del mouse sull'immagine (o sul progetto) e sotto l'opzione Salva con nome fare clic su TIFF. Questo memorizzerà tutti i canali (ad esempio, bright-field e GFP) con eventuali modifiche (ad esempio, se il contrasto è stato regolato, questo verrà salvato nel TIFF).
  3. Analisi quantitativa delle immagini fluorescenti
    1. Se verrà eseguita l'analisi quantitativa, prendere immagini 3D. Questa operazione viene eseguita facendo clic sull'opzione della sezione z con la "z" in alto a destra. Le sezioni z saranno attive se questa casella è rossa.
    2. Ottimizzare le sezioni z selezionando l'intervallo e lo spessore della sezione in basso a sinistra delle opzioni regolabili. Quando possibile, utilizzare il pulsante Ottimizzazione sistema per le impostazioni ottimali.
    3. Acquisire l'immagine e memorizzarla come descritto in precedenza nella sezione 5.2. Allineare i vermi con spazi tra di loro per misurazioni più facili.
    4. Importare immagini TIFF nel software di imaging preferito (ad esempio, ImageJ).
    5. Per ImageJ, scegliere Imposta misuredal menu Analizza . Controllare quanto segue: area, valore grigio medio, densità integrata, etichetta di visualizzazione.
    6. Utilizzando lo strumento ROI (regione di interesse), disegnare un ROI. Misurare ogni verme singolarmente. Dal menu Analizza, scegliere Misura o premere M. Disegnare un ROI sullo sfondo dove non ci sono vermi, e quindi misurare lo sfondo nello stesso modo. Copiare o salvare le misure visualizzate nella finestra Risultati.
    7. Sottrarre la densità integrata dello sfondo dalla densità integrata di ogni ROI misurato. L'intensità dello sfondo per un ROI è definita come il prodotto del valore grigio medio dello sfondo e l'area del ROI disegnata.
  4. Acquisizione di immagini con un microscopio composto/wide-field
    NOTA: per l'imaging di reporter trascrizionali utilizzando un microscopio composto/wide-field, questo protocollo utilizza un microscopio Revolve ECHO R4 dotato di un obiettivo Olympus 4x Plan Fluorite NA 0.13, un filtro standard Olympus FITC (ex 470/40; em 525/50; DM 560) e un iPad Pro per la fotocamera e per guidare il software ECHO. Le impostazioni consigliate per i tempi di esposizione sono disponibili nella tabella 4.
    1. Utilizzare il touchpad per avviare il programma di controllo. Creare un nuovo album e un nuovo nome file.
    2. Piastra di posizione sotto l'obiettivo. Impostare il tempo di esposizione e l'intensità della fluorescenza utilizzando la linea di base (trattamento EV/controllo) e il controllo positivo, in modo che il segnale sia visibile ma non saturo.
    3. Salvare un'immagine a campo luminoso e un'immagine GFP/FITC.

6. Misurazioni quantitative dei giornalisti utilizzando un citometro di flusso di particelle di grandi dimensioni

NOTA: la crescita e la preparazione di vermi per l'analisi del citometro del flusso di particelle di grandi dimensioni possono seguire gli stessi paradigmi delle sezioni da 1 a 5 per la preparazione dei vermi per l'imaging fluorescente, con l'eccezione che è necessario un numero maggiore di animali. Utilizzare >500 animali per condizione, poiché alcuni animali vengono persi durante la manipolazione, non tutti gli animali superano i criteri di filtraggio durante la quantificazione e alcuni animali non vengono letti correttamente dal citometro di flusso. Lavare gli animali pronti per lo smistamento delle piastre in 5-10 mL di soluzione M9 in tubi conici da 15 mL per la successiva selezione sul citometro di flusso.

  1. Impostazione dell'ordinamento con un citometro di flusso di particelle di grandi dimensioni
    1. Prima di accendere il citometro di flusso
      1. Assicurarsi che la bottiglia liquida di corona non sia vuota. Preparare il liquido di ottana dallo stock 250x almeno un paio d'ore prima dell'uso della selezionatrice, in quanto vi è una piccola quantità di detersivo nel liquido di ottana, che può causare bolle che possono causare artefatti durante l'acquisizione.
      2. Assicurarsi che tutti i contenitori dei rifiuti non siano pieni.
    2. Accensione del citometro di flusso
      1. Accendere il compressore d'aria. Trasformarlo in Auto. Controllare il misuratore di pressione - dovrebbe essere di circa 30 psi.
      2. Accendere lo strumento. Utilizzare l'interruttore di alimentazione che si trova accanto al cavo di alimentazione a sinistra dello strumento.
      3. Accendere i laser. Una sorgente luminosa di 488 nm è in genere sufficiente per la maggior parte degli esperimenti, anche se è necessario utilizzare una sorgente luminosa da 561 nm se è necessaria un'eccitazione maggiore per la fluorescenza rossa.
      4. Aprire il software FlowPilot; lo strumento dovrebbe fare una serie di clic accendono le diverse valvole.
      5. Accendere i laser nella finestra del software facendo clic su Start. Avviare il laser nella finestra popup del controllo laser Argon facendo clic su Esegui. Questo dovrebbe causare il laser per accendere e raggiungere circa 12 mW. Il livello di sorgente luminosa 488 salirà a circa 12.
      6. Fare clic su Fine per chiudere la finestra.
    3. Controlli sul software prima di procedere
      1. Controllare i misuratori di pressione -Osservare i 4 valori di pressione visualizzati nella parte inferiore della finestra. I valori devono essere intorno alla configurazione originale (Sheath 5.5-5.7; Campione 5.7-6.0; Sorter 3.1-3.3; Pulire 8.5-8.7). Se l'aspetto è simile, selezionare la casella accanto a Pressione OK.
      2. Controllare la fluidicsina -Per assicurarsi che non ci siano bolle d'aria e detriti che bloccano il flusso di diame / campione attraverso la cella di flusso, fare clic su Pulisci più volte.
      3. Controllare la velocità di flusso della sequenza - Per questo, raccogliere la foia per 60 s. Switch Off Sort, quindi attivare la focherazione nei controlli manuali per avviare il flusso di focherazione. Raccogliere in un tubo da 15 mL per 60 s; la portata deve essere di 9-10 mL/min.
    4. Pulizia prima dell'uso del citometro di flusso
      1. Inserire nella raccolta 'cup' la soluzione di candeggina da 3-5 mL e fare clic su Acquisisci. Lasciare correre per 30 s, fare clic su Interrompie rimuovere l'eccesso con vuoto.
      2. Risciacquare la "tazza" della collezione con acqua deionizzata e rimuovere con vuoto. Ripetere 2x.
      3. Inserire 3-5 mL di soluzione di pulizia COPAS nella collezione 'cup' e fare clic su Acquisisci. Lasciare correre per 30 s, fare clic su Interrompie rimuovere la soluzione di pulizia in eccesso con vuoto.
      4. Risciacquare la "tazza" della collezione con acqua deionizzata e rimuovere con vuoto. Ripetere 2x.
      5. Inserire la soluzione M9 da 3-5 mL nella raccolta 'cup' e fare clic su Acquisisci. Lasciare correre per 30 s, fare clic su Interrompie rimuovere la soluzione M9 in eccesso con vuoto.
  2. Esecuzione di campioni su Sorter
    1. Regolare la potenza del PMT laser e il gating delle dimensioni in base alla condizione che causa l'attivazione più brillante del reporter trascrizionale di interesse. Le impostazioni consigliate sono disponibili nella tabella 4.
    2. Aggiungere vermi preparati a 'cup'. Fare clic su Acquisisci. Guardare per assicurarsi che tutto il liquido non sia assorbito nella macchina; questo farà sì che il citometro di flusso acquisisca aria e crei bolle nel rivelatore.
    3. Fare clic su Interrompi quando il campione è basso e/o sono stati raccolti un numero sufficiente di animali.
    4. Fare clic su Configurazione . Memorizzazione dei dati Solo gated. In questo modo i dati verranno salvati solo in base ai vincoli di dimensione. Fai clic su Store Gated e salva i dati gated. Fare clic su Cancella per cancellare i dati.
    5. Risciacquare la "tazza" della collezione con acqua deionizzata e rimuovere con vuoto. Ripetere 2x.
    6. Ripetere i passaggi 6.2.1-6.2.5 con il resto dei campioni.
  3. Calibrazione/ Controllo qualità - se necessario
    NOTA: Questo richiede il controllo in esecuzione 42 particelle fluorescenti GYR m fornite, per calibrare il laser 488.
    1. Premere il labbro metallico sulla parte superiore della tazza campione per rimuovere il tubo dell'aria. Svitare il tappo e utilizzare una siringa per rimuovere il liquido dalla tazza del campione.
    2. Mescolare bene la bottiglia di particelle di controllo prima dell'uso e aggiungere pochi millilitri nella tazza del campione. Chiudere il tappo e rimettere l'aria premendolo fino a quando non fa clic in posizione.
    3. Nel software, accedere all'opzione Strumenti e fare clic su Esegui particelledi controllo .
    4. Per le particelle di controllo, reimpostare i valori PMT su: GREEN - 325; GIALLO - 365; ROSSO - 575.
    5. Fare clic su Acquisisci. La fala deve essere accesa seguita dal campione. Una volta che le perline iniziano a passare attraverso la cella di flusso, la portata sarà visibile nella parte inferiore dello schermo. In modo ottimale, la portata deve essere compresa tra 5/s e 15/s. Se la portata è troppo bassa o zero, ruotare fisicamente la valvola campione in senso orario per aumentare la portata. Se la portata è troppo elevata, ruotare la valvola campione fisicamente in senso antiorario per ridurre la portata.
      NOTA: Normalmente, in modalità di risparmio di perline, 500 perline vengono lette prima di spegnere. I dati possono essere cancellati e perline ri-lette.
    6. Una volta completata la lettura, verificare la presenza di singoli picchi puliti per i 5 parametri e i valori CV. Il Coefficiente di varianza (CV) deve essere <15%. Inoltre, assicurati che i valori CV per i tre diversi canali fluorescenti siano vicini l'uno all'altro.
    7. Effettuare un record del controllo QC: nella scheda File, fare clic su Salva come immagine dello schermo.
  4. Pulizia e spegnimento
    1. Utilizzare un vuoto per rimuovere il campione dalla tazza campione e ripetere la sezione 4.1.4.
    2. Inserire 3-5 mL di acqua deionizzata nella raccolta 'cup' e fare clic su Acquisisci, lasciare correre per 30 s e quindi fare clic su Interrompi. Lasciare un po' d'acqua distillata nella tazza del campione.
    3. Svuotare la tazza di recupero del campione e la bottiglia di scarto.
    4. Spegnere il software. Nella scheda File fare clic su Esci. Nel menu a comparsa, fare clic su Disattiva senza eliminazione.
    5. Spegnere il laser, spegnere lo strumento, quindi spegnere il compressore d'aria. Chiudere il portello per coprire lo strumento.

7. Saggi fisiologici per misurare la sensibilità allo stress in C. elegans

  1. Misurazione della sensibilità allo stress ER mediante esposizione alla tunicamicina
    1. Preparare piastre DMSO NGM RNAi avvistate con batteri RNAi che prendono di mira il gene di interesse come nella sezione 3. Utilizzare batteri HT115 anche in esperimenti che non coinvolgono RNAi knockdown (vedi Sezione 1). Ricordatevi di seme anche piastre NGM RNAi TM (vedi Tabella 1). Semina una quantità sufficiente di piatti: pianifica le serie di placche NGM RNAi DMSO e 2-3 set di piastre NGM RNAi TM.
    2. Sincronizzare gli animali di scelta utilizzando i metodi descritti nella sezione 2.
    3. Piatto uova su NGM RNAi DMSO piastre di semi di scelta utilizzando i criteri raccomandati nella tabella 2. Assicurarsi di preparare 2 volte il numero di piastre necessarie in quanto metà del campione verrà trasferita alle piastre NGM RNAi TM.
    4. Incubare le uova a 20 gradi centigradi per circa 3-4 giorni (65-96 h) al primo giorno di età adulta.
    5. Al primo giorno, preparare le durate di vita trasferendo gli animali su piastre separate. Per conservare le piastre (poiché i costi TM sono elevati), utilizzare 8 piastre di 15 animali per condizione, per un totale di 120 animali per condizione. Questo permette un numero gestibile di animali per piatto per il punteggio e permette una quantità sufficiente di animali per analisi statistiche, anche con una certa censura.
    6. Per i primi 5-7 giorni, allontanagli gli animali adulti dalla progenie ogni giorno su un nuovo piatto fino a quando la progenie non è più visibile. Durante questa fase, censurare gli animali che sono insaccati, esporre sportrusioni/esplosioni volunti, o strisciare sui lati delle piastre, in quanto queste non sono morti associate con sensibilità allo stress ER. Si noti che il trattamento TM provoca l'arresto negli animali, e quindi solo 1-2 mosse di questi animali ogni 2-3 giorni è sufficiente a ridurre al minimo i costi associati alla produzione di piastre contenenti TM. Gli animali di tipo selvatico hanno una sopravvivenza media di 15-17 giorni su DMSO e 12-14 giorni su tunicamcyin.
    7. Dopo che gli animali hanno smesso di produrre progenie, segna la durata della vita ogni 1-2 giorni fino a quando tutti gli animali sono classificati come morti o censurati. TM-trattare gli animali ogni giorno durante il giorno 6-14 di età adulta per una risoluzione più alta.
  2. Misurazione della sensibilità allo stress mitocondriale e ossidativo utilizzando l'esposizione al paraquat
    1. Preparare piastre avvistate con batteri RNAi che prendono di mira il gene di interesse come nella sezione 3. Utilizzare batteri HT115 anche in esperimenti che non coinvolgono RNAi knockdown (vedi Introduzione).
    2. Sincronizzare gli animali di scelta utilizzando i metodi descritti nella sezione 2.
    3. Piatto uova su piastre di semi NGM RNAi a scelta utilizzando i criteri raccomandati nella tabella 1. Il saggio richiede 60-100 animali per condizione, quindi preparatevi di conseguenza.
    4. Incubare le uova a 20 gradi centigradi per circa 3-4 giorni (65-96 h) al primo giorno di età adulta.
    5. Preparare una fiala fresca da 100 mM in soluzione M9.
    6. Pipette 50-75 - L di M9-paraquat in altrettanti pozzi di una piastra piatta di 96 po' di fondo come desiderato. Si raccomanda generalmente di avere 8-10 pozzi per condizione contenenti 8-10 animali per pozzo. Ciò consente un numero facilmente visibile di animali per pozzo con 80 dollari per ceppo.
    7. Scegli 8-10 animali per condizione e trasferiscili in ogni pozzo contenente M9 paraquat. Utilizzare un plettro per trasferire gli animali nei pozzi piuttosto che pipettare per evitare differenze di volume e cambiamenti involontari nelle concentrazioni di paraquat.
    8. Ogni 2 h, punteggio per la morte di animali in ogni pozzo. Toccare delicatamente le piastre, che causerà gli animali vivi a thrash o piegarsi. Si noti che è possibile che gli animali vivi sono a volte paralizzati abbastanza a lungo da essere segnati come morti. Pertanto, se il numero di animali vivi supera il numero di animali vivi da un periodo di tempo precedente, è probabile che l'animale sia vivo e debba essere senza punteggio (ad esempio, se all'ora 4, 2/10 gli animali sono considerati morti, e all'ora 6, solo 1/10 animali sono morti, l'ora 4 dovrebbe essere indicata come 1/10 animali morti).
  3. Misurazione della sensibilità al calore mediante esposizione a temperature elevate
    1. Preparare piastre avvistate con batteri RNAi che prendono di mira il gene di interesse come nella sezione 3. Utilizzare batteri HT115 anche in esperimenti che non coinvolgono RNAi knockdown (vedi Sezione 1).
    2. Sincronizzare gli animali di scelta utilizzando i metodi descritti nella sezione 2.
    3. Piatto uova su piastre di semi di scelta utilizzando i criteri raccomandati nella tabella 1. Avere 60-100 animali per condizione per i saggi di termotolleranza. Per i saggi di termotolleranza, utilizzare i saggi laici di arresto L1 o di uova per la migliore sincronizzazione in quanto vi è una notevole variabilità in base all'età degli animali nel saggio.
    4. Incubare gli animali a 20oC per circa 3-4 giorni (65-96 h) per effettuare esperimenti al primo giorno di età adulta. Non far crescere vermi a 15 gradi centigradi per esperimenti di shock termico in quanto vi è una differenza minore tra gli animali che sperimentano shock termico da 15 s. contro 20 .
    5. Al primo giorno, preparare gli animali trasferendoli su piatti separati. Si raccomanda generalmente di avere 10-15 animali per piastra con 4-6 piastre, per un totale di 60 animali. Ciò consente un numero gestibile di animali per piastra per il punteggio e consente di estrarne un tempo minimo per gli animali dalle temperature elevate.
    6. Collocare gli animali in un'incubatrice di 37 gradi centigradi e segnare ogni 2 h. Iniziare a segnare per la termotolleranza a 37 gradi centigradi all'ora 5, in quanto poco o nessun decesso si verifica prima di 5 ore. La termotolleranza mediana viene eseguita a 9 ore, quindi le ore 7, 9 e 11 sono tempi critici, anche se a causa dell'incubatore e della variabilità da laboratorio a laboratorio, questo potrebbe dover essere titolato per laboratorio. Inoltre, qualsiasi metodo per ridurre la variabilità aiuterà (ad esempio, non impilare piastre, posizionare le piastre nella stessa area all'interno di una singola incubatrice, ridurre al minimo il tempo di apertura o chiusura dell'incubatrice, togliere solo le piastre dall'incubatrice alla volta per ridurre al minimo il tempo che gli animali trascorrono al di fuori di 37 gradi centigradi, ecc. Per una guida completa, vedere21).
    7. In alternativa al punto 7.3.6, collocare gli animali a 34 gradi centigradi invece di 37 gradi centigradi. La termotolleranza mediana a 34 gradi centigradi è di poco superiore a 14 h, quindi i punti temporali 12, 14 e 16 sono fondamentali per i saggi di termotolleranza a 34 gradi centigradi.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Utilizzo di reporter trascrizionali per misurare l'attivazione delle risposte allo stress
Qui vengono utilizzati reporter trascrizionali fluorescenti, che servono come strumenti robusti per misurare l'attivazione della maggior parte delle risposte allo stress in C. elegans. L'espressione GFP è guidata sotto il promotore di obiettivi canonici di regolatori trascrizionali principali coinvolti nella risposta alle sollecitazioni specifiche del compartimento. Un elenco completo dei giornalisti trascrizionali di uso comune è disponibile nella tabella 3.

Perturbando l'omeostasi ER tramite proteine spiegate o piegate in modo non corretto o lo stress del bistrato lipidico provoca l'attivazione della risposta proteica spiegata del ER (UPRER) per ripristinare la qualità e la funzione ER. L'UPRER è costituito da 3 rami distinti definiti dai sensori transmembrani: proteina inositolo che richiede 1 (IRE1), attivazione del fattore di trascrizione 6 (ATF6) e proteina chinasi RNA (PKR)-come chinasi ER (PERK), tutti conservati in C. elegans7,22,23. Lo strumento più comune per monitorare l'attivazione dell'UPRER nel nematode, è il ceppo di reporter trascrizionale che esprime GFP sotto il controllo del promotore hsp-4 (hsp-4p::GFP)7. Il gene hsp-4 codifica un ortologo di mammifero Hsp70, HSPA5 (o BiP/Grp78). In caso di stress ER quando l'UPRER è attivato, il ceppo di reporter hsp-4p::GFP esprime GFP. Questo reporter ha un'espressione basale minima in assenza di stress, ma mostra una solida espressione GFP quando gli animali sono esposti alla tunicamycin (Figura 1A). Queste differenze possono anche essere quantificate utilizzando un citometro di flusso di particelle di grandi dimensioni (Figura 1B). Inoltre, l'induzione di hsp-4p::GFP sotto stress ER può essere completamente soppressa da RNAi-knockdown di xbp-1, in quanto l'attivazione di questo reporter transcrittivo dipende dal fattore di trascrizione, XBP-112.

Simile all'UPRER, i mitocondri ospitano un proprio meccanismo protettivo contro lo stress proteotossico. Questo meccanismo, chiamato UPR mitocondriale (UPRMT)24, è principalmente regolato dal fattore di trascrizione, ATFS-1, che non riesce a entrare nei mitocondri sotto stress a causa della diminuzione dell'efficienza delle importazioni, con conseguente ingresso di ATFS-1 nel nucleo25. È interessante notare che diverse perturbazioni ai processi mitocondriali possono attivare questa risposta, tra cui l'aggregazione delle proteine, abbattere le sottounità dei complessi della catena di trasporto elettronico (ETC), lo stress da replicazione del DNA mitocondriale e la traduzione delle proteine mitocondriali8,26. L'attivazione dell'UPRMT è stata monitorata utilizzando vermi che esprimono un costrutto transgenico in cui la GFP è stata posta sotto la regolazione dei promotori dei geni chaperone mitocondriale, hsp-6 e hsp-608. Simile a hsp-4p::GFP animali, hsp-6p::GFP animali mostrano minimo segnale basale in assenza di stress. Il metodo più robusto per indurre l'UPRMT è attraverso RNAi-knockdown delle seguenti proteine mitocondriali: cox-5B, la sottounità citocromatica c ossidase Vb/COX4 (Complex IV)20, nuo-4, la proteina dehydrogenasi NADH (Complesso I)27, o mrps-5, una proteina ribosomica mitocondriale28, attivato il reporter hsp-6p::GFP. L'espressione GFP attraverso questo reporter è attivata in modo robusto e può essere facilmente visualizzata e quantificata in queste condizioni (Figura 2A-B). L'UPR MT può essere attivato anche attraverso l'inibizione chimica della catena di trasporto degli elettroni (ETC), come ad esempio con l'antimicina A, che inibisce la riduzione citocromatica dellactrazione (complesso III). Simile all'RNAi-knockdown dei componenti ETC, il trattamento con antimicina A provoca una robusta induzione di hsp-6p::GFP (Figura 2C-D).

La capacità per gli organismi di percepire e rispondere allo stress ossidativo è un processo conservato presente dai batteri agli esseri umani29. In C. elegans, l'omologo NRF2, SKN-1, funge da importante fattore di trascrizione, sensibile ai cambiamenti redox dovuti a cistein ereattivi in tutta la proteina. SKN-1 funge da attivatore trascrizionale dell'OxSR attraverso il legame alla sequenza di consenso conservata altamente simile agli elementi di risposta antiossidante vincolati da NRF230. Nell'uomo, NRF2 è regolato negativamente da KEAP1, che è pensato per essere sensibile ai cambiamenti redox a causa di cisteinre reattivi in tutta la proteina31. Mentre non esiste un ortologo diretto di KEAP1 nei worm, SKN-1 è regolato negativamente dalla proteina WD-repeat, WDR-23, in un modo che è meccanicamente distinto dall'inibizione KEAP1/NRF232. Dopo lo stress ossidativo, come l'idroperossido di tert-butyl (TBHP), SKN-1 attiva geni disintossicanti e antiossidanti come gst-4, un Glutathione S-Transferase. Per misurare lo stress ossidativo, l'espressione GFP è posta sotto il promotore di gst-4, un glutathione S-transferase33. A differenza degli altri regolatori trascrizionali qui presentati, gst-4p::GFP ha un'alta espressione basale. Tuttavia, questa espressione può ancora essere attivata in modo robusto in condizioni di stress ossidativo, che può essere eseguito sia geneticamente che chimicamente. Per indurre geneticamente lo stress ossidativo, abbattiamo wdr-23, che codifica una proteina che svolge un ruolo nella degradazione proteasomica di SKN-134. Wdr-23 knockdown si traduce in una robusta attivazione di gst-4p::GFP. Inoltre, il trattamento dei vermi con l'ossidante chimico, TBHP, si traduce in un'attivazione più lieve, ma ancora significativa, di gst-4p::GFP (Figura 3). Sia l'attivazione chimica che quella genetica di gst-4p::GFP possono essere quasi completamente soppresse dal knockdown RNAi dello skn-1, il gene che codifica il principale regolatore trascrizionale dell'OxSR.

La maggior parte delle proteine cellulari sono tradotte nel citoplasma e vi risiedono, anche se solo temporaneamente prima di essere prese di mira altrove. Così, il citoplasma ospita una vasta gamma di chaperones che promuovono il corretto ripiegamento e funzione delle proteine, così come gli enzimi e le proteine responsabili del degrado delle proteine danneggiate, disfunzionali o in eccesso. Per proteggere questo complesso paesaggio proteico del citoplasma, la cellula ha sviluppato diversi percorsi di risposta allo stress citoplasmatico, tra cui la risposta allo shock termico (HSR)35,36. L'HSR è un percorso dedicato alla promozione dell'omeostasi proteica in condizioni di stress termico ed è modulato dal regolatore trascrizionale principale, HSF-137. In condizioni di stato costante, HSF-1 è vincolato da chaperoni citoplasmici, HSP90 e HSP70/40, che lo mantiene bloccato in uno stato monomerico e inattivo. In condizioni di calore o stress simile, un aumento delle proteine misfolded si traduce in titolazione di chaperones lontano da HSF-1, permettendogli di tagliare e traslocare al nucleo per attivare l'HSR38,39. Forse gli obiettivi a valle più studiati dell'HSF-1 nell'attivazione dell'HSR sono le proteine da shock termico (HSP), come HSP70, HSP90, DNAJ e HSP6017,40. In C. elegans, i giornalisti trascrizionali per HSR sono stati sintetizzati guidando l'espressione di GFP sotto i promotori di HSp canonici HSp, hsp-16.2 e hsp-709,41. Come le loro controparti UPRMT e UPRER, hsp-16.2p::GFP e hsp-70p::GFP mostrano un'espressione basale minima in assenza di stress. Tuttavia, entrambi i reporter sono robustamente indotti in condizioni di stress termico, che può essere facilmente visualizzato mediante microscopia o quantificato utilizzando un citometro di flusso di particelle di grandi dimensioni (Figura 4). Entrambi i giornalisti hanno un ampio raggio dinamico, e l'induzione è completamente dipendente da hsf-1, come RNAi-knockdown di hsf-1 sopprime completamente l'induzione di hsp-16.2p::GFP e hsp-70p::GFP. Mentre questi reporter possono essere utilizzati in modo intercambiabile per la maggior parte delle situazioni, potrebbero esserci differenze nei livelli di espressione e nell'espressione tra i tessuti.

Saggi fisiologici per misurare la sensibilità allo stress in C. elegans
C. elegans sono un grande organismo modello per misurare la sensibilità allo stress a causa del basso costo in manutenzione e sperimentazione e facilità di editing del genoma o knockdown genetico utilizzando RNAi, che fornisce la capacità di eseguire esperimenti su larga scala in un intero organismo. Per testare la tolleranza allo stress dello stress ER, esponiamo C. elegans all'agente chimico, la tunicamicina, che causa l'accumulo di proteine danneggiate nel ER bloccando la glicosilazione N-linked10. Gli animali sono esposti alla tunicamicina post-sviluppo, poiché il farmaco causa difetti dello sviluppo. Quando esposti alla tunicamicina, i vermi adulti presentano un marcato declino della durata della vita. Inoltre, l'abbattimento del gene, xbp-1, che codifica uno dei principali fattori di trascrizione coinvolti nell'induzione di UPRER, si traduce in un aumento significativo della sensibilità alla tunicamicina (Figura 5A)12. Così, questo serve come un saggio robusto per misurare la sensibilità allo stress ER nei vermi adulti.

Per misurare lo stress ossidativo e lo stress mitocondriale, esponiamo gli animali all'agente chimico, il paraquat. Paraquat provoca stress mitocondriale per sintesi di ROS all'interno della matrice mitocondriale, che può quindi essere convertito in perossido di idrogeno e diffuso dai mitocondri per causare danni ossidativi intercellulari13. Simile ai saggi di stress DEL ER, esponiamo gli animali al paraquat in età adulta. Tuttavia, eseguiamo analisi paraquat in liquido per ridurre i costi e il lavoro manuale e i test agar-based per la maggior parte dei laboratori sarebbe difficile per la maggior parte dei laboratori. Qui, mostriamo che gli animali esposti al paraquat in liquido mostrano la sopravvivenza mediana di circa 5 ore (Figura 5B). Inoltre, knockdown del recettore insulinico, daf-2, si traduce in una maggiore resistenza al paraquat come attivazione di DAF-16/FOXO si traduce in una maggiore espressione di coinvolti nello sgombero di ROS, come sod-342,43. I test di sopravvivenza dei paraquati sono brevi e durano fino a 14 ore, e quindi servono come metodo efficace per interrogare le risposte allo stress mitocondriale e ossidativo.

Infine, la sopravvivenza a temperature elevate viene utilizzata per interrogare la risposta fisiologica allo stress termico. Questi saggi possono essere eseguiti sia in agar liquido o solido, e ci sono numerosi protocolli diversi delineati21. Si raccomanda di standardizzare un singolo saggio in laboratorio per diminuire la variabilità, che è eccezionalmente alta in questo saggio. La termotolleranza deve essere eseguita nel giorno 1 animali adulti su piastre di agar standard, sia a 34 o 37 gradi centigradi. A 37 gradi centigradi, la maggior parte della morte si verifica tra 7-11 ore, rendendo questo un semplice analisi di un giorno, mentre gli esperimenti di 12-16 ore a 34 gradi centigradi sono più facilmente eseguiti durante la notte(Figura 5C-E). La mutazione nel gene, ttx-3, provoca il fallimento della specifica degli interneuroni AIY responsabili del circuito neurale termosensoriale e provoca un aumento significativo della termosensibilità44. Mentre i dati di termotolleranza possono essere tracciati come una curva di sopravvivenza (Figura 5C), questi saggi dovrebbero essere eseguiti almeno 4-6 volte e tutte le repliche dovrebbero essere tracciate l'una contro l'altra(Figura 5D-E), poiché la termotolleranza mostra una variabilità incredibilmente elevata rispetto ad altri saggi di stress. Ciò è dovuto alle numerose avvertenze che esistono nella creazione di questi esperimenti, tra cui la variabilità nelle tensioni di interesse, il ciclo ineguale dell'aria nelle incubatrici, le piastre di agar irregolari, ecc.21. A 34 gradi centigradi, la sopravvivenza mediana si verifica a circa 14 ore, e simile a 37 gradi centigradi, i mutanti ttx-3 mostrano una diminuzione della sopravvivenza a 34 gradi centigradi (Figura 5E).

Figure 1
Figura 1: Utilizzo di hsp-4p::GFP come reporter per l'induzione di UPRER. (A) Micrografie fluorescenti rappresentative di hsp-4p::GFP che esprimono animali coltivati su vettore vuoto di controllo (EV) o xbp-1 RNAi. Gli animali sono stati coltivati su RNAi da hatch a L4 a 20 s, poi trattati con 25 ng/ tunicamycin o 1% DMSO galleggiante in M9 a 20 gradi per 4 ore, e recuperati su una piastra OP50 per 16 ore a 20 gradi centigradi prima dell'imaging. Gli animali sono rimasti paralizzati in un'azide di sodio da 100 m su una piastra di agar NGM e immagini utilizzando uno stereomicroscopio. (B) Analisi quantitativa di (A) utilizzando un biosortio di grandi particelle. I dati sono rappresentati come intensità di fluorescenza integrata su tutto l'animale dove ogni punto rappresenta un singolo animale; Il controllo DMSO è in grigio e gli animali trattati con tunicamicina sono in rosso. La linea centrale rappresenta la mediana e i baffi rappresentano l'intervallo interquartile. n 123-291 animali per ceppo. p < 0.001 utilizzando test Mann-Whitney non parametrici. Fare clic qui per visualizzare una versione più grande di questa figura.

Figure 2
Figura 2: Utilizzo di hsp-6p::GFP come reporter per l'induzione dell'UPRMT. (A) Micrografie fluorescenti rappresentative di hsp-6p::GFP che esprimono animali coltivati su vettore vuoto di controllo (EV), cco-1, mrps-5o nuo-4 RNAi. Gli animali sono stati coltivati su RNAi da portello e immagine il giorno 1 dell'età adulta a 20 . Gli animali sono rimasti paralizzati in azide di sodio da 100 M su una piastra di agar NGM e immagini con un microscopio composto. (B) Analisi quantitativa di (A) utilizzando un biosortio di grandi particelle. I dati sono rappresentati come intensità di fluorescenza integrata su tutto l'animale dove ogni punto rappresenta un singolo animale; Il controllo EV è in animali grigi trattati con RNAi sono in rosso. La linea centrale rappresenta la mediana e i baffi rappresentano l'intervallo interquartile. n - 303-384 animali per ceppo. p < 0.001 rispetto al controllo EV utilizzando test Mann-Whitney non parametrici. (C) Immagini rappresentative di animali hsp-6p::GFP trattati con DMSO o Antimycin A. Gli animali sono stati coltivati da scalini su piastre DMSO 0,2% e trasferiti su piastre contenenti 0,2% DMSO o 3 mM di antimicina A per 16 ore prima dell'imaging su un microscopio composto Revolve ECHO R4. Tutta la crescita è stata eseguita a 20 gradi centigradi. (D) Analisi quantitativa di (C) utilizzando un biosortio di grandi particelle simile a (B). I controlli DMSO sono in grande, e gli animali trattati con Antimycin A sono in rosso. n - 495 per il DMSO e 219 perp l'Antimycin A. Fare clic qui per visualizzare una versione più grande di questa figura.

Figure 3
Figura 3: Utilizzo di gst-4p::GFP come reporter per l'OxSR. (A) Micrografie fluorescenti rappresentative di gst-4p::GFP che esprimono animali coltivati su vettore vuoto di controllo (EV), skn-1o wdr-23 RNAi. Gli animali sono stati coltivati su RNAi dallo stadio L4 fino allo stadio L4 a 20 . Gli animali sono stati coltivati su RNAi dal portello fino a L4 a 20 , poi trattati con 2 mM TBHP in M9 o solo M9 per il controllo "non trattato" a 20 gradi centigradi per 4 ore, e recuperati su una piastra EV per 16 ore a 20 gradi centigradi prima dell'imaging. Gli animali sono rimasti paralizzati in azide di sodio da 100 M su una piastra di agar NGM e immagini con un microscopio composto. (B) Analisi quantitativa di (A) utilizzando un biosortio di grandi particelle. I dati sono rappresentati come intensità di fluorescenza integrata su tutto l'animale dove ogni punto rappresenta un singolo animale; controllo non trattato è in grigio e gli animali trattati con TBHP sono in rosso. La linea centrale rappresenta la mediana e i baffi rappresentano l'intervallo interquartile. n 101-204 animali per ceppo. p < 0.001 rispetto al rispettivo controllo EV utilizzando test Mann-Whitney non parametrici. Fare clic qui per visualizzare una versione più grande di questa figura.

Figure 4
Figura 4: Utilizzo di hsp16.2p::GFP e hsp-70p::GFP come reporter per la risposta di shock termico. (A) Micrografie fluorescenti rappresentative di hsp16.2p::GFP che esprimono animali coltivati su vettore vuoto di controllo (EV) o RNAi hsf-1. Gli animali sono stati coltivati su RNAi da botole a 20 s fino al primo giorno. Gli animali del primo giorno sono stati lasciati a 20 gradi centigradi (non trattati) o esposti a 2 ore di stress termico a 34 gradi centigradi, per poi essere recuperati per 2 ore a 20 gradi centigradi. Gli animali sono rimasti paralizzati in un'azide di sodio da 100 m su una piastra di agar NGM e immagini utilizzando uno stereomicroscopio. (B) Analisi quantitativa di (A) utilizzando un biosortio di grandi particelle. I dati sono rappresentati come intensità di fluorescenza integrata su tutto l'animale dove ogni punto rappresenta un singolo animale; controllo non trattato è in grigio e gli animali riscaldati sono in rosso. La linea centrale rappresenta la mediana e i baffi rappresentano l'intervallo interquartile. n - 320-364 animali per ceppo. p < 0.001 utilizzando test Mann-Whitney non parametrici. (C) Micrografie fluorescenti rappresentative di hsp-70p::GFP che esprimono animali coltivati su EV di controllo EV e hsf-1 RNAi e trattati come descritto in (A). (D) Analisi quantitativa di (C) come descritto in (B). n 773-941 animali per ceppo. Fare clic qui per visualizzare una versione più grande di questa figura.

Figure 5
Figura 5: i test di sopravvivenza fisiologici sotto stress in C. elegans. (A) Durata dei nematodi coltivati su 1% DMSO contenenti 25 placchi ng/Lunicamycin (TM). Gli animali sono stati coltivati su piastre DMSO dell'1% dal portello fino al primo giorno e trasferiti alle rispettive piastre TM al giorno 1. Gli animali sono stati tenuti sotto controllo vettore vuoto (EV) o xbp-1 RNAi dal portello fino alla fine del saggio a 20 gradi centigradi. Gli animali adulti vengono spostati manualmente dalla progenie ogni giorno fino al giorno 7-8, quando la progenie non è più stata rilevata, quindi segnati ogni 2 giorni fino a quando tutti gli animali sono stati registrati come morti o censurati. Gli animali con impacchettamento, sporgenza/esplosioni vulvali, o quelli che strisciavano sui lati delle tavole erano considerati censurati. (B) Curva di sopravvivenza dei nematodi in paraquat da 100 mM (PQ) disciolta nella soluzione M9. Gli animali sono stati coltivati su EV o daf-2 RNAi dal portello fino al giorno 1 di età adulta a 20 . Gli animali sono stati collocati in 50 - L di M9 : soluzione PQ in un pozzo di 96 gradi a 20 gradi centigradi e visualizzati ogni 2 ore fino a quando tutti gli animali non erano immobili. (C) Curva di sopravvivenza dei nematodi a 37 gradi centigradi. Gli animali di tipo selvaggio (N2), ttx-3 (KS5)e sur-5p::hsf-1 sono stati coltivati su placche di eV dal portello fino al primo giorno a 20 gradi centigradi. Al primo giorno, gli animali sono stati spostati a 37 gradi centigradi e hanno segnato ogni 2 ore fino a quando tutti gli animali sono stati segnati come morti o censurati. (D) Dati raggruppati di tutti i saggi di termotolleranza eseguiti a 37 gradi centigradi. I dati sono rappresentati come percentuale attiva all'ora 9 di un'analisi della termotolleranza, con ogni linea che rappresenta un esperimento corrispondente eseguito nello stesso giorno. (E) Dati raggruppati di tutti i saggi di termotolleranza eseguiti a 34 gradi centigradi. I dati sono rappresentati come percentuale attiva all'ora 14 di un saggio di termotolleranza, con ogni linea che rappresenta un esperimento corrispondente eseguito nello stesso giorno. Tutte le statistiche per A-C sono state eseguite utilizzando i test Log-Rank (Mantel-Cox) e sono reperibili nella tabella 5. Fare clic qui per visualizzare una versione più grande di questa figura.

Reagente Ricetta
Brodo di lisogenesi (LB) In questo protocollo, è stato utilizzato LB commerciale (vedi Materiali), ma tutte le ricette standard LB fatte in casa utilizzando Bacto-tryptone, estratto di lievito, e NaCl sono sufficienti.
Nematode Crescita Media (NGM) 1 mM CaCl2, 5 g/mL colesterolo, 25 mM KPO4 pH 6,0, 1 mM MgSO4, 2% (w/v) agar, 0.25% (w/v) Bacto-Peptone, 51,3 mM NaCl
Soluzione di candeggina 1,8% (v/v) ipoclorito di sodio, 0,375 M KOH
Soluzione M9 22 mM KH2PO4 monobasic, 42,3 mM Na2HPO4, 85,6 mM NaCl, 1 mM MgSO4
Piastre NGM RNAi 1 mM CaCl2, 5 g/mL di colesterolo, 25 mM KPO4 pH 6,0, 1 m MgSO4, 2% (w/v) agar, 0.25% (w/v) Bacto-Peptone, 51,3 mM NaCl, 1 mM IPTG, 100 g/mL carbenicillin/ampillina. Conservare a 4 gradi centigradi al buio per un massimo di 3 mesi
Tetraciclina Soluzione di stock da 10 mg/mL (500x) in etanolo 100%. Conservare a -20 gradi centigradi
Carbenicillina Soluzione di magazzino da 100 mg/mL (1000x) in acqua. Conservare a 4 gradi centigradi per un massimo di 6 mesi o -20 gradi centigradi per lo stoccaggio a lungo termine
Azide di sodio 1 M di azioni (6,5%) soluzione di sodio in acqua. Conservare al buio a 4 gradi centigradi. Si tratta di una soluzione 10volte che viene diluita in uno stock di lavoro di 100 mM per la maggior parte degli esperimenti di imaging
Tunicamycina Soluzione di stock da 2,5 mg/mL in DMSO 100%. Conservare a -80 gradi centigradi per lo stoccaggio a lungo termine. Si tratta di una soluzione 100x (soluzione di lavoro 25 ng/zL)
Antimicina A 15 mM di antimicina Una soluzione di stock in 100% DMSO. Conservare a -20 gradi centigradi. Si tratta di una soluzione 5000x (3 stock di lavoro M)
Paraquat Soluzione 50 M in acqua – deve essere preparata fresca
Idroperossido tert-butyl (TBHP) soluzione 7,7 M in acqua. Questa è una soluzione 3850x (2 mM di magazzino)
NGM RNAi - DMSO0.2 1 mM CaCl2, 5 g/mL di colesterolo, 25 mM KPO4 pH 6,0, 1 m MgSO4, 2% (w/v) agar, 0.25% (w/v) Bacto-Peptone, 51,3 mM NaCl, 1 mM IPTG, 100 g/mL carbenicillin/ampicillina, 0.2%
(controllo per antimicina A)
NGM RNAi - antimicina A 1 mM CaCl2, 5 g/mL di colesterolo, 25 mM KPO4 pH 6,0, 1 mM MgSO4, 2% (w/v) agar, 0,25% (w/v) Bacto-Peptone, 51,3 mM NaCl, 1 mM IPTG, 100 g/mL carbenicillin/ampicillina, 0.2% DM, 3 min
NGM RNAi DMSO 1 mM CaCl2, 5 g/mL di colesterolo, 25 mM KPO4 pH 6,0, 1 m MgSO4, 2% (w/v) agar, 0.25% (w/v) Bacto-Peptone, 51,3 mM NaCl, 1 mM IPTG, 100 g/mL carbenicillin/ampillina; 1% DMSO
(controllo per tunicamycin)
NGM RNAi TM 1 mM CaCl2, 5 g/mL di colesterolo, 25 mM KPO4 pH 6,0, 1 m MgSO4, 2% (w/v) agar, 0.25% (w/v) Bacto-Peptone, 51,3 mM NaCl, 1 mM IPTG, 100 g/mL carbenicillin/ampillina; 1% DMSO, 25 ng/L tunicamicina
IPTG (informazioni in stato IPTG) Soluzione da 1 M in acqua.

Tabella 1: Ricette consigliate per i reagenti utilizzati. Tutte le ricette esatte dei reagenti utilizzati in questo protocollo sono descritte qui. Specifiche aziende in cui sono stati acquistati reagenti sono disponibili anche nella Tabella dei Materiali. Sono state testate molte fonti diverse di sostanze chimiche, e quelle elencate nella Tabella dei Materiali sono quelle che hanno mostrato i risultati più robusti e riproducibili.

Dimensione piastra Tipo di batteri N. di animali per raggiungere il primo giorno di età adulta N. di animali per raggiungere lo stadio L4
60 mm OP50 (OP50) 100-150 150-300
60 mm HT115 70-100 120-200
100 mm OP50 (OP50) 600-1000 1500-2000
100 mm HT115 350-600 700-1300

Tabella 2: Numero consigliato di animali da placcare dopo la sincronizzazione per evitare la fame. Per evitare la fame, si consiglia di placcare un numero specifico di animali per condizione. Poiché OP50 cresce più denso dell'HT115, è possibile placcare più animali. Tutti i numeri elencati qui sono le linee guida utilizzate nel nostro laboratorio, e i numeri possono essere leggermente diversi a causa di diverse variabili e differenze tra le condizioni di laboratorio. Pertanto, o numeri consigliati sono sul lato inferiore in grassetto. I numeri massimi sono quelli che potrebbero essere placcati in condizioni ottimali nel nostro laboratorio senza raggiungere la fame, ma non è consigliabile utilizzare questi valori senza prima tifare le condizioni. Tutti i numeri sono determinati partendo dal presupposto che i batteri vengono seminati su piastre e hanno permesso di crescere per 24 ore a temperatura ambiente (22 gradi centigradi) sulle piastre prima che i vermi vengano posti su di essi. Anche se non c'è differenza importante nei tassi di fame quando si placcano le uova o gli L1, si consiglia di moltiplicare il numero superiore del 10% quando si placcano le uova, dal momento che non tutte le uova si schiudono dopo lo sbiancamento.

Nome deformazione Transgene Scopo Applicazione raccomandata(e) di stress fonte
SJ4005 hsp-4p::GFP UPRER tunicamycin 25 g/mL Cgc
SJ4100 hsp-6p::GFP UPRMT 3 antimicino A; Cgc
RNAi contro ETC o ribosoma mitocondriale
SJ4058 hsp-60p::GFP UPRMT 3 antimicino A; Cgc
RNAi contro ETC o ribosoma mitocondriale
CL2070 hsp-16.2p::GFP risposta di shock termico 34 gradi centigradi 2 ore Cgc
AM446 hsp-70p::GFP risposta di shock termico 34 gradi centigradi 2 ore Laboratorio Morimoto
CL2166 gst-4p::GFP OxSR paraquat da 50 mM; Cgc
2 mM di idroperide tert-butile
CF1553 sod-3p::GFP OxSR e segnalazione insulinca RNAi contro daf-2 (recettore dell'insulina) Cgc
AU78 T24B8.5p::GFP risposta immunitaria innata esposizione al patogeno (ad es. P. aeruginosa) Cgc

Tabella 3: Reporter trascrizionali per valutare l'attivazione delle risposte allo stress cellulare. I ceppi qui elencati sono tutti disponibili tramite CGC o attraverso richieste speciali ai laboratori per l'uso sia nei metodi di imaging qualitativi che quantitativi descritti in questo manoscritto. Questi ceppi sono tutti derivati dallo sfondo Bristol N2. Sono inoltre forniti metodi consigliati per applicare lo stress per attivare i reporter. Tutti i giornalisti, ad eccezione di sod-3p::GFP45 e T24B8.5p::GFP46 sono descritti nel testo.

Transgene Applicazione raccomandata(e) di stress Tempo di esposizione con un microscopio stereo Leica M2250FA Tempo di esposizione con un microscopio Revolve ECHO Valori PMT con un biosortio Union Biometrica COPAS
hsp-4p::GFP 25 tunicamycin (4 ore con recupero notturno) 200 ms 275 ms 450
hsp-6p::GFP 3 antimicino A (16 ore); 100 ms 50 ms 350
RNAi contro ETC o ribosoma mitocondriale (da tratteggio)
hsp-60p::GFP 3 antimicino A (16 ore); 200 ms 100 ms 450
RNAi contro ETC o ribosoma mitocondriale (da tratteggio)
hsp-16.2p::GFP 34 gradi centigradi 2 ore 400 ms 200 ms 500
hsp-70p::GFP 34 gradi centigradi 2 ore 400 ms 300 ms 500
gst-4p::GFP paraquat da 50 mM (2 ore); 100 ms 50 ms 350
2 mM di idroperide tert-butyl (4 ore con recupero notturno)
sod-3p::GFP RNAi contro daf-2 (recettore dell'insulina) 300 ms 300 ms 475
T24B8.5p::GFP esposizione al patogeno (ad es. P. aeruginosa) 100 ms 50 ms 350

Tabella 4: Impostazioni consigliate per la microscopia e la quantificazione fluorescente utilizzando un biosortio di particelle di grandi dimensioni. Questa tabella funge da guida per i tempi di esposizione consigliati per la microscopia fluorescente o i valori di PMT per il biosortio di grandi particelle. Questi serviranno come buoni punti di partenza, ma il tempo di esposizione e il valore di PMT dovrebbero essere regolati per ogni esperimento per garantire che non si verifichi alcuna saturazione e che i valori fluorescenti superino il limite di rilevamento del segnale di fondo. Se il campione con il segnale più luminoso per un esperimento è noto (ad esempio, controlli positivi per l'induzione della sollecitazione), tali campioni possono essere utilizzati per determinare il tempo di esposizione o la PMT più elevati che possono essere utilizzati senza saturare il segnale. Se i campioni più luminosi non sono noti, è possibile utilizzare il controllo e può essere utilizzato un tempo di esposizione o PMT al centro della gamma dinamica del sistema.

Figura corrispondente Deformazione, Trattamento Durata mediana - Decessi/ Totale Variazione percentuale della durata mediana valore p (Log-Rank; Uomo-Cox)
5A N2, vettore RNAi, 1% DMSO 22 giorni 95/120 -- --
N2, xbp-1 RNAi, 1% DMSO 14 giorni 92/120 -36.4 < 0.001
N2, vettore RNAi, 25 ng/L TM 14 giorni 97/120 -36.4 < 0.001
N2, xbp-1 RNAi, 25 ng/L TM 12 giorni 98/120 -45.4 < 0.001
5B (in modo N2, vettore RNAi, 100 mM PQ 5 ore 73/73 -- --
N2, daf-2 RNAi, 100 mM PQ 6,5 ore 74/74 30 < 0.001
5C N2, vettore RNAi, 37 gradi centigradi 8 ore 59/60 -- --
ttx-3(KS5), vettore RNAi, 37 c 7 ore 60/60 -12.5 0.002
sur-5p::hsf-1, vettore RNAi, 37 c Ore 9 59/60 12.5 0.012

Tabella 5: Statistiche per la durata della vita e i test di sopravvivenza allo stress. Tutte le dimensioni dei campioni, le statistiche e i tassi di censura per la figura 5 sono disponibili qui.

Risposta allo stress Gene bersaglio Primer in avanti Primer inverso
UPRER hsp-3 TCGCTGGATTGAACGTTGTTG GTTGCGTTCTCCGTCCTCTTCTTG
UPRER hsp-4 GAACAACCTACTCGTGCGTTGG GAACAACCTACTCGTGCGTTGG
UPRER sel-11 TTGATCTCTGGAAACGCACG TTGATCTCTGGAAACGCACG
UPRER ire-1 TCCTCAACCGCTCCATCAACAT TCCTCAACCGCTCCATCAACAT
UPRER xbp-1 (informazioni in due) GGACTTCTCTGGCTGGGGAGT GGACTTCTCTGGCTGGGGAGT
UPRER xbp-1 (spliced) GGTGGATGGAGGGAAGATT GGTGGATGGAGGGAAGATT
UPRER crt-1 GAAGTAATAGGGGGAAGC GAAGTAATAGGGGGAAGC
UPRER T14G8.3 CACCTCCATCAACACACAACATCAT CACCTCCATCAACACACAACATCAT
Hsr hsp-17 TCGTTTTCCACCATTCTCCCCA TGTTTGATCGGCCCGTATGGT
Hsr hsp-70 TGTTTGATCGGCCCGTATGGT TTCGCAATGAGAAGGGACGACT
Hsr F44E5.4 TTCGCAATGAGAAGGGACGACT CGTTGTTGCTCTGTCTCTCTCTCTT
Hsr hsp-16.2 TCCATCTGAGTCTCTCTGAGAATT
GTTA
TGGTTTAAACTGTGAGTGTGA
Hsr hsf-1 TTTGCATTTTCTCTCTCTCTCTCTCTC TCTATTTCCAGCACACCTCGT
UPRMT hsp-6 GAGATCGTGGAACCGGAAGGA CGGCATTCTTTTGGCTCTCTCTCTCTT
UPRMT hsp-60 CGGCATTCTTTTGGCTCTCTCTCTCTT CGTCGTTGCAGAGCTCAAGAAG
UPRMT ymel-1 CAAAACCTGATCTCTCGGGGGG TTCTCAATGTGGCGGCTCCAGT
UPRMT clpp-1 TGATAAGTGCACCGTCCC TGATTCTGGAGTTCGGGAGA
UPRMT lonp-1 CGATGATGGCCATTGTGCAG CGCTTTGAAACATCATTCAT
Cca
OxSR gst-4 GATGCTCGTGCTCTTG CCGAATTGTCTCTCCATCGAC
OxSR gst-6 CCGAATTGTCTCTCCATCGAC TTTGGCAGTTGTTGTTGAG
OxSR gst-7 TTTGGCAGTTGTTGTTGAG TGGGTAATCTGGACGGTTTG
OxSR gcs-1 TGGGTAATCTGGACGGTTTG ATGTTTGCCTCTCGACAATGTT
OxSR skn-1 GGACAACAGAATCCCAAAGG TCAGGACGTCAACAGCAGAC
OxSR sod-3 GTAACGGGCGATAGGAGAGA GCGAGAGCACATTGATGAC
OxSR ptps-1 AATCGATTCCTTTGGAGACC CAATCTACTGCTCGCCTCTCTCTTCT
CAAAGC (CaAAGC)
Riferimento pmp-3 TGGCCGGATGATGGTGC ACGAACAATGCCAAAGGCCAGC
Riferimento Y45F10.4 CGAGAACCCGCGAAATGTCGGA CGGTTGCCAGGGAAGATGAGAGAGC
Riferimento linfa-49 TGGCGGATCGTCGTGCTTCC ACGAGTCTCTCGTTCGTCCCA
Riferimento tba-1 TCAACACTGCCATCCCCC TCCAAGCGAGACCAGGCTGCG

Tabella 6: Obiettivi genici consigliati e coppie di primer per misurare la regolazione di uptrascrizione dei geni di risposta allo stress.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Qui, vengono descritti metodi per interrogare le risposte allo stress cellulare in C. elegans,utilizzando reporter trascrizionali fluorescenti e analisi di sopravvivenza allo stress fisiologico. Tutti i giornalisti utilizzano l'espressione GFP guidata sotto il promotore di un obiettivo trascrizionale a valle dei fattori di trascrizione coinvolti nel montaggio delle risposte allo stress cellulare. L'uso di hsp-4p::GFP modulato da UPRERmediato da XBP-1s , hsp-6p::GFP controllato da ATFS-1-mediato UPRMT, gst-4p::GFP sotto SKN-1-mediato OxSR, e hsp16.2p::GFP e hsp-70p::GFP sotto hSF-1-mediato risposta di shock termico sono spiegati. Altri reporter trascrizionali standardizzati sono disponibili nella tabella 3. Tutti i reporter trascrizionali qui presentati hanno un'ampia gamma dinamica e possono essere attivati in modo robusto applicando lo stress attraverso perturbazioni genetiche o l'esposizione a sostanze chimiche che inducono stress. Inoltre, questi giornalisti possono essere tutti soppressi dall'abbattimenti dei fattori di trascrizione a monte dei promotori impiegati. Infine, ogni reporter trascrizionale è associato a uno specifico test di sopravvivenza allo stress fisiologico per fornire una lettura fisiologica dell'impatto dell'attivazione o della reprimenza di una specifica risposta allo stress.

Per utilizzare con successo l'uso di reporter trascrizionali, è essenziale determinare la gamma dinamica di ogni reporter. A causa della grande variabilità da laboratorio a laboratorio causata da differenze nei media, agar, ambiente ambientale, ecc., si consiglia di titrate ogni paradigma di induzione di droga o stress per le concentrazioni e la tempistica utilizzando le nostre raccomandazioni come base. Successivamente, è fondamentale assicurarsi che gli animali siano sani e correttamente sincronizzati. Gli animali che hanno subito una sorta di stress (ad esempio, fame, esposizione a lungo termine alla luce, esposizione a temperature elevate, ecc.) dovrebbero essere recuperati per diverse generazioni prima della sperimentazione. Una corretta sincronizzazione può essere ottenuta utilizzando i metodi descritti nella sezione 2, che è essenziale in quanto diverse risposte allo stress hanno diversi livelli di attivazione durante il processo di invecchiamento. Infine, i protocolli di imaging sono essenziali per standardizzare, in quanto ci sono varie cose che possono influenzare la qualità dell'immagine e dei dati. Ad esempio, la durata degli animali nell'azide di sodio dovrebbe essere ridotta al minimo, in quanto ciò causa stress agli animali e può influire sul segnale dei reporter. Inoltre, le specifiche del microscopio e del biosortio devono essere impostate correttamente per massimizzare il rapporto segnale-rumore e la gamma dinamica, senza causare saturazione. I pixel saturi possono causare problemi importanti nell'analisi quantitativa dei campioni, poiché il segnale fluorescente massimo può essere gravemente sottovalutato.

Mentre i reporter trascrizionali qui descritti forniscono un mezzo robusto ed efficiente per misurare l'attivazione delle risposte allo stress, è fondamentale capire che si tratta di un singolo bersaglio genetico di un fattore di trascrizione noto. Pertanto, mentre serve come un metodo affidabile per schermi su larga scala o test di prima passaggio di ceppi di interesse, devono essere eseguite valide appropriate. Si consiglia di eseguire qPCR per misurare diversi geni bersaglio canonici attivati al momento dell'induzione di ogni risposta allo stress di cui viene pedita. Un elenco di bersagli genetici suggeriti è riportato nella tabella 6. Inoltre, la profilazione del trascrittoma attraverso l'RNA-seq è un'altra alternativa per uno sguardo più ampio agli effetti su più bersagli trascrizionali contemporaneamente. Di particolare nota, l'imaging di reporter fluorescenti fornisce informazioni spaziali per quanto riguarda i tessuti che sono interessati dalle perturbazioni. Tali informazioni non possono essere ottenute da qRT-PCR o RNA-seq, in quanto utilizza estratti di verme intero, ad eccezione di scRNA-seq, FISH e protocolli RNAseq specifici del tessuto47. Infine, questi reporter di stress sono generalmente caratterizzati come specifici per il loro meccanismo di risposta allo stress. Tuttavia, è importante ricordare che non tutti i paradigmi di risposta allo stress sono unici e distinti. Ad esempio, lo stress ER può attivare OxSR e viceversa48, e le sovrapposizioni tra la risposta di shock termico e le risposte di stress ER sono stati comunemente trovati49. Questi sono solo alcuni dei molti esempi nella letteratura della comunicazione incrociata e della sovrapposizione tra le risposte allo stress, e quindi è importante capire che tutti i saggi dovrebbero anche essere testati per la specificità per trarre conclusioni finali.

Un'altra limitazione dei metodi descritti è che l'imaging e la quantificazione attraverso un biosortio hanno una velocità effettiva limitata. Mentre la quantificazione del biosortio può essere eseguita in piastre di 96 pozze per una maggiore produttività, è comunque limitata dalla necessità di trasferire i vermi in soluzione, mentre l'imaging è limitato dalla capacità dello sperimentatore di preparare i vermi ed eseguire la microscopia. Pertanto, gli schermi su larga scala molto probabilmente coinvolgeranno solo uno screening visivo del segnale dei reporter fluorescente, con solo hit che vengono immagine e quantificati.

Un'importante avvertenza con l'utilizzo di questi reporter fluorescenti è che l'attivazione o la soppressione delle risposte allo stress non sempre contribuiscono a fenotipi fisiologicamente significativi, o possono riflettere altri effetti globali (ad esempio, diminuzione della sintesi proteica). Pertanto, ogni reporter trascrizionale è accoppiato a un metodo per testare la sopravvivenza allo stress. Si raccomanda di eseguire saggi di sopravvivenza tunicamicina per l'UPRER, analisi di sopravvivenza del paraquat per l'UPRMT e l'OxSR, e la sopravvivenza a temperature elevate per la risposta di scossa di calore. Sebbene questi siano generalmente robusti, veloci e semplici saggi, richiedono un lavoro manuale intensivo, e quindi sono fortemente limitati in termini di scalabilità. Inoltre, quasi tutti i saggi di termotolleranza pubblicati fino ad oggi hanno una notevole variabilità, rendendo un gran numero di repliche quasi essenziali21. Mentre i saggi di sopravvivenza tunicamycin e paraquat non soffrono di questa mancanza di riproducibilità, hanno le loro sfide, tra cui un ampio lavoro pratico e la durata del protocollo. Poiché nascono nuove tecnologie nell'automatizzare i test di sopravvivenza e di sopravvivenza, è probabile che questi saggi di sopravvivenza allo stress possano diventare anche50. Tuttavia, fino a quando questi saggi automatizzati non diventano standard, i saggi di sopravvivenza sono attualmente limitati alla convalida delle conseguenze fisiologiche nell'alterare le dinamiche dell'attività di risposta allo stress.

Al di là dei saggi di sopravvivenza allo stress descritti qui, ci sono una serie di altri metodi per misurare la fisiologia negli animali. Ad esempio, un analizzatore Seahorse XFp disponibile in commercio può consentire il monitoraggio della respirazione cellulare, che fornisce ulteriori informazioni meccanicistiche51. Un'altra alternativa ai giornalisti trascrizionali è l'uso della localizzazione nucleare di fattori di trascrizione etichettati fluorescentmente. Ci sono numerose varianti di questa tecnica, ma di particolare interesse per i metodi descritti qui includono: HSF-1::GFP per la risposta di calore-shock52, DVE-1::GFP per l'UPRMT53, e DAF-16::GFP e SKN-1::GFP per l'OxSR54,55. Infine, può essere eseguito l'interrogatorio diretto della morfologia di organelli specifici di interesse. Ad esempio, la morfologia mitocondriale può essere visualizzata utilizzando un fluoroforo mirato alla matrice mitocondriale utilizzando una sequenza di localizzazione mitocondriale56. La morfologia ER può essere visualizzata utilizzando un fluoroforo mirato al ER attraverso una sequenza di segnale fusa al capolinea N e HDEL fusa al C-terminus57 o GFP fusa su una proteina della membrana ER58. Infine, l'integrità citoscheletro aggericale actin può essere utilizzata come proxy per la sensibilità allo stress termico a valle di HSF-1. Il citoscheletro di actina è regolato da bersagli trascrizionali di HSF-1, in particolare durante l'invecchiamento e lo stress termico, e quindi l'organizzazione actin può essere visualizzata per determinare la lettura funzionale di HSF-1 e lo stress termico59,60.

Tutti i metodi qui descritti possono essere utilizzati in modo indipendente o in combinazione tra loro per un'analisi completa di geni o farmaci di interesse e il loro impatto sulla risposta allo stress. Gli schermi su larga scala possono essere eseguiti utilizzando analisi trascrizionali ad alta velocità e gli schermi secondari possono essere eseguiti utilizzando analisi quantitative di questi reporter. Una volta identificate le liste gene/farmaco candidati gestibili, è possibile eseguire saggi fisiologici per identificare i candidati che hanno un impatto diretto sulla fisiologia animale intero. Gli altri metodi sopra suggeriti possono essere utilizzati anche come convalida o ulteriore indagine.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori non hanno nulla da rivelare.

Acknowledgments

R.BZ. è supportato dalla borsa di studio A lungo termine EMBO e dalla Larry L. Hillblom Foundation. R.H.S è supportato dalla sovvenzione 5F32AG032023-02 attraverso il National Institute of Aging (NIA) e la Glenn Foundation for Medical Research Postdoctoral Fellowship. A.F. è sostenuta dalla sovvenzione F32AG051355 attraverso la NIA. H.K.G. è supportato dalla sovvenzione DGE1752814 attraverso il National Science Foundation Graduate Research Fellowship Program. M.G.M. è supportato da 1F31AG060660-01 attraverso NIA. A.D. è supportato dalla Thomas and Stacey Siebel Foundation, dall'Howard Hughes Medical Institute e dal 4R01AG042679-04 e da 5R01AG055891-02 della NIA e da 5R01ES021667-09 del NIEHS. Ringraziamo Larry Joe, Melissa Sanchez, Naame Kelet e Anel Esquivel per un'assistenza tecnica significativa. Ringraziamo il laboratorio Morimoto e il CGC (finanziato dal NIH Office of Research Infrastructure Program P40 OD010440) per le varietà.

Materials

Name Company Catalog Number Comments
Antimycin A Sigma-Aldrich A8674 for mitochondrial stress
Bacto Peptone Fisher Scientific DF0118072 for NGM plates
BD Difco granulated agar VWR 90000-782 for NGM plates
Calcium chloride dihydrate VWR 97061-904 for NGM plates
Carbenicillin BioPioneer C0051-25 for RNAi
Cholesterol Sigma-Aldrich 57-88-5 for NGM plates
COPAS Biosorter Union Biometrica 350-5000-000 equipped with a 488 nm light source.
COPAS Cleaning Solution Union Biometrica 300-5072-000 to use with COPAS
COPAS Sheath Solution Union Biometrica 300-5070-100 to use with COPAS
DMSO Sigma-Aldrich 472301 solvent for drugs
IPTG dioxane free Denville Scientific CI8280-4 for RNAi
LB Broth Miller Fisher Scientific BP1426500 for LB
M205FA stereoscope Leica 10450040 equipped with a Leica DFC3000G monochromatic CCD camera, standard Leica GFP filter (ex 395-455, EM 480 LP), and LAS X software
Magnesium sulfate heptahydrate VWR EM-MX0070-3 for NGM plates, M9
Paraquat Sigma-Aldrich 36541 for oxidative/mitochondrial stress
Potassium Chloride Fisher P217-500 for bleach soluton
Potassium phosphate dibasic VWR EM-PX1570-2 for NGM plates
Potassium phosphate monobasic VWR EM-PX1565-5 for M9
Revolve ECHO 75990-514 equipped with an Olympus 4x Plan Fluorite NA 0.13 objective lens, standard Olympus FITC filter (ex 470/40; em 525/50; DM 560), and an iPad Pro for camera and to drive ECHO software
Sodium Azide Sigma-Aldrich 71289-50G for imaging
Sodium Chloride EMD Millipore SX0420-5 for NGM plates, M9
Sodium phosphate dibasic VWR 71003-472 for M9
Tert-butyl hydroperoxide Sigma-Aldrich 458139 for oxidative stress
Tetracycline hydrochloride Sigma-Aldrich T7660-5G for RNAi
Tunicamycin Sigma-Aldrich T7765-50MG for ER stress

DOWNLOAD MATERIALS LIST

References

  1. Higuchi-Sanabria, R., Frankino, P. A., Paul, J. W., Tronnes, S. U., Dillin, A. A Futile Battle? Protein Quality Control and the Stress of Aging. Developmental Cell. 44, (2), 139-163 (2018).
  2. Brenner, S. The genetics of Caenorhabditis elegans. Genetics. 77, (1), 71-94 (1974).
  3. Rual, J. F., et al. Toward improving Caenorhabditis elegans phenome mapping with an ORFeome-based RNAi library. Genome Research. 14, (10B), 2162-2168 (2004).
  4. Timmons, L., Court, D. L., Fire, A. Ingestion of bacterially expressed dsRNAs can produce specific and potent genetic interference in Caenorhabditis elegans. Gene. 263, (1-2), 103-112 (2001).
  5. Reinke, S. N., Hu, X., Sykes, B. D., Lemire, B. D. Caenorhabditis elegans diet significantly affects metabolic profile, mitochondrial DNA levels, lifespan and brood size. Molecular Genetics and Metabolism. 100, (3), 274-282 (2010).
  6. Revtovich, A. V., Lee, R., Kirienko, N. V. Interplay between mitochondria and diet mediates pathogen and stress resistance in Caenorhabditis elegans. PLOS Genetics. 15, (3), e1008011 (2019).
  7. Calfon, M., et al. IRE1 couples endoplasmic reticulum load to secretory capacity by processing the XBP-1 mRNA. Nature. 415, (6867), 92-96 (2002).
  8. Yoneda, T., Benedetti, C., Urano, F., Clark, S. G., Harding, H. P., Ron, D. Compartment-specific perturbation of protein handling activates genes encoding mitochondrial chaperones. Journal of Cell Science. 117, (Pt 18), 4055-4066 (2004).
  9. Link, C. D., Cypser, J. R., Johnson, C. J., Johnson, T. E. Direct observation of stress response in Caenorhabditis elegans using a reporter transgene. Cell Stress & Chaperones. 4, (4), 235-242 (1999).
  10. Heifetz, A., Keenan, R. W., Elbein, A. D. Mechanism of action of tunicamycin on the UDP-GlcNAc:dolichyl-phosphate Glc-NAc-1-phosphate transferase. Biochemistry. 18, (11), 2186-2192 (1979).
  11. Struwe, W. B., Hughes, B. L., Osborn, D. W., Boudreau, E. D., Shaw, K. M. D., Warren, C. E. Modeling a congenital disorder of glycosylation type I in C. elegans: a genome-wide RNAi screen for N-glycosylation-dependent loci. Glycobiology. 19, (12), 1554-1562 (2009).
  12. Taylor, R. C., Dillin, A. XBP-1 is a cell-nonautonomous regulator of stress resistance and longevity. Cell. 153, (7), 1435-1447 (2013).
  13. Castello, P. R., Drechsel, D. A., Patel, M. Mitochondria are a major source of paraquat-induced reactive oxygen species production in the brain. The Journal of Biological Chemistry. 282, (19), 14186-14193 (2007).
  14. Oberley, L. W., Buettner, G. R. Role of Superoxide Dismutase in Cancer: A Review. Cancer Research. 39, (4), 1141-1149 (1979).
  15. Senchuk, M. M., Dues, D. J., Van Raamsdonk, J. M. Measuring Oxidative Stress in Caenorhabditis elegans: Paraquat and Juglone Sensitivity Assays. Bio-protocol. 7, (1), (2017).
  16. Lithgow, G. J., White, T. M., Hinerfeld, D. A., Johnson, T. E. Thermotolerance of a long-lived mutant of Caenorhabditis elegans. Journal of Gerontology. 49, (6), B270-B276 (1994).
  17. Labbadia, J., Morimoto, R. I. The Biology of Proteostasis in Aging and Disease. Annual Review of Biochemistry. 84, (1), 435-464 (2015).
  18. Park, H. E. H., Jung, Y., Lee, S. J. V. Survival assays using Caenorhabditis elegans. Molecules and Cells. 40, (2), 90-99 (2017).
  19. Waggoner, L. E., Hardaker, L. A., Golik, S., Schafer, W. R. Effect of a Neuropeptide Gene on Behavioral States in Caenorhabditis elegans Egg-Laying. Genetics. 154, (3), 1181-1192 (2000).
  20. Durieux, J., Wolff, S., Dillin, A. The cell-non-autonomous nature of electron transport chain-mediated longevity. Cell. 144, (1), 79-91 (2011).
  21. Zevian, S. C., Yanowitz, J. L. Methodological Considerations for Heat Shock of the Nematode Caenorhabditis elegans. Methods (San Diego, Calif). 68, (3), 450-457 (2014).
  22. Shen, X., Ellis, R. E., Sakaki, K., Kaufman, R. J. Genetic interactions due to constitutive and inducible gene regulation mediated by the unfolded protein response in C. elegans. PLoS genetics. 1, (3), e37 (2005).
  23. Frakes, A. E., Dillin, A. The UPR(ER): Sensor and Coordinator of Organismal Homeostasis. Molecular Cell. 66, (6), 761-771 (2017).
  24. Martinus, R. D., et al. Selective induction of mitochondrial chaperones in response to loss of the mitochondrial genome. European Journal of Biochemistry. 240, (1), 98-103 (1996).
  25. Nargund, A. M., Pellegrino, M. W., Fiorese, C. J., Baker, B. M., Haynes, C. M. Mitochondrial import efficiency of ATFS-1 regulates mitochondrial UPR activation. Science (New York, N.Y). 337, (6094), 587-590 (2012).
  26. Baker, B. M., Haynes, C. M. Mitochondrial protein quality control during biogenesis and aging. Trends in Biochemical Sciences. 36, (5), 254-261 (2011).
  27. Shore, D. E., Carr, C. E., Ruvkun, G. Induction of Cytoprotective Pathways Is Central to the Extension of Lifespan Conferred by Multiple Longevity Pathways. PLOS Genetics. 8, (7), e1002792 (2012).
  28. Houtkooper, R. H., et al. Mitonuclear protein imbalance as a conserved longevity mechanism. Nature. 497, (7450), 451-457 (2013).
  29. Chiang, S. M., Schellhorn, H. E. Regulators of oxidative stress response genes in Escherichia coli and their functional conservation in bacteria. Archives of Biochemistry and Biophysics. 525, (2), 161-169 (2012).
  30. Blackwell, T. K., Steinbaugh, M. J., Hourihan, J. M., Ewald, C. Y., Isik, M. SKN-1/Nrf, stress responses, and aging in Caenorhabditis elegans. Free Radical Biology & Medicine. 88, (Pt B), 290-301 (2015).
  31. Nguyen, T., Nioi, P., Pickett, C. B. The Nrf2-antioxidant response element signaling pathway and its activation by oxidative stress. The Journal of Biological Chemistry. 284, (20), 13291-13295 (2009).
  32. Lo, J. Y., Spatola, B. N., Curran, S. P. WDR23 regulates NRF2 independently of KEAP1. PLOS Genetics. 13, (4), e1006762 (2017).
  33. Link, C., Johnson, C. Reporter Transgenes for Study of Oxidant Stress in Caenorhabditis elegans. Methods in enzymology. 353, 497-505 (2002).
  34. Choe, K. P., Przybysz, A. J., Strange, K. The WD40 Repeat Protein WDR-23 Functions with the CUL4/DDB1 Ubiquitin Ligase To Regulate Nuclear Abundance and Activity of SKN-1 in Caenorhabditis elegans. Molecular and Cellular Biology. 29, (10), 2704-2715 (2009).
  35. Velazquez, J. M., Lindquist, S. hsp70: nuclear concentration during environmental stress and cytoplasmic storage during recovery. Cell. 36, (3), 655-662 (1984).
  36. Tissières, A., Mitchell, H. K., Tracy, U. M. Protein synthesis in salivary glands of Drosophila melanogaster: relation to chromosome puffs. Journal of Molecular Biology. 84, (3), 389-398 (1974).
  37. Gomez-Pastor, R., Burchfiel, E. T., Thiele, D. J. Regulation of heat shock transcription factors and their roles in physiology and disease. Nature Reviews Molecular Cell Biology. (2017).
  38. Guisbert, E., Czyz, D. M., Richter, K., McMullen, P. D., Morimoto, R. I. Identification of a tissue-selective heat shock response regulatory network. PLoS genetics. 9, (4), e1003466 (2013).
  39. Hentze, N., Le Breton, L., Wiesner, J., Kempf, G., Mayer, M. P. Molecular mechanism of thermosensory function of human heat shock transcription factor Hsf1. eLife. 5, (2016).
  40. Li, J., Labbadia, J., Morimoto, R. I. Rethinking HSF1 in Stress, Development, and Organismal Health. Trends in Cell Biology. (2017).
  41. Morley, J. F., Morimoto, R. I. Regulation of longevity in Caenorhabditis elegans by heat shock factor and molecular chaperones. Molecular Biology of the Cell. 15, (2), 657-664 (2004).
  42. Senchuk, M. M., et al. Activation of DAF-16/FOXO by reactive oxygen species contributes to longevity in long-lived mitochondrial mutants in Caenorhabditis elegans. PLoS Genetics. 14, (3), (2018).
  43. Henderson, S. T., Bonafè, M., Johnson, T. E. daf-16 protects the nematode Caenorhabditis elegans during food deprivation. The Journals of Gerontology. Series A, Biological Sciences and Medical Sciences. 61, (5), 444-460 (2006).
  44. Prahlad, V., Cornelius, T., Morimoto, R. I. Regulation of the Cellular Heat Shock Response in Caenorhabditis elegans by Thermosensory Neurons. Science. 320, (5877), 811-814 (2008).
  45. Libina, N., Berman, J. R., Kenyon, C. Tissue-specific activities of C. elegans DAF-16 in the regulation of lifespan. Cell. 115, (4), 489-502 (2003).
  46. Shivers, R. P., Kooistra, T., Chu, S. W., Pagano, D. J., Kim, D. H. Tissue-specific activities of an immune signaling module regulate physiological responses to pathogenic and nutritional bacteria in C. elegans. Cell Host & Microbe. 6, (4), 321-330 (2009).
  47. Kaletsky, R., et al. Transcriptome analysis of adult Caenorhabditis elegans cells reveals tissue-specific gene and isoform expression. PLoS Genetics. 14, (8), (2018).
  48. Glover-Cutter, K. M., Lin, S., Blackwell, T. K. Integration of the Unfolded Protein and Oxidative Stress Responses through SKN-1/Nrf. PLOS Genetics. 9, (9), e1003701 (2013).
  49. Liu, Y., Chang, A. Heat shock response relieves ER stress. The EMBO journal. 27, (7), 1049-1059 (2008).
  50. Stroustrup, N., Ulmschneider, B. E., Nash, Z. M., López-Moyado, I. F., Apfeld, J., Fontana, W. The Caenorhabditis elegans Lifespan Machine. Nature Methods. 10, (7), 665-670 (2013).
  51. Leung, D. T. H., Chu, S. Measurement of Oxidative Stress: Mitochondrial Function Using the Seahorse System. Methods in molecular biology (Clifton, N.J). 1710, 285-293 (2018).
  52. Morton, E. A., Lamitina, T. Caenorhabditis elegans HSF-1 is an essential nuclear protein that forms stress granule-like structures following heat shock. Aging Cell. 12, (1), 112-120 (2013).
  53. Haynes, C. M., Petrova, K., Benedetti, C., Yang, Y., Ron, D. ClpP mediates activation of a mitochondrial unfolded protein response in C. elegans. Developmental Cell. 13, (4), 467-480 (2007).
  54. Kwon, E. S., Narasimhan, S. D., Yen, K., Tissenbaum, H. A. A new DAF-16 isoform regulates longevity. Nature. 466, (7305), 498-502 (2010).
  55. An, J. H., et al. Regulation of the Caenorhabditis elegans oxidative stress defense protein SKN-1 by glycogen synthase kinase-3. Proceedings of the National Academy of Sciences of the United States of America. 102, (45), 16275-16280 (2005).
  56. Daniele, J. R., Esping, D. J., Garcia, G., Parsons, L. S., Arriaga, E. A., Dillin, A. High-Throughput Characterization of Region-Specific Mitochondrial Function and Morphology. Scientific Reports. 7, (1), 6749 (2017).
  57. Daniele, J. R., et al. A non-canonical arm of UPRER mediates longevity through ER remodeling and lipophagy. bioRxiv. 471177 (2018).
  58. Xu, N., et al. The FATP1-DGAT2 complex facilitates lipid droplet expansion at the ER-lipid droplet interface. The Journal of Cell Biology. 198, (5), 895-911 (2012).
  59. Baird, N. A., et al. HSF-1-mediated cytoskeletal integrity determines thermotolerance and life span. Science (New York, N.Y.). 346, (6207), 360-363 (2014).
  60. Higuchi-Sanabria, R., et al. Spatial regulation of the actin cytoskeleton by HSF-1 during aging. Molecular Biology of the Cell. 29, (21), 2522-2527 (2018).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics