Mätningar av fysiologiska stressreaktioner i C. Elegans

* These authors contributed equally
JoVE Journal
Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Här karakteriserar vi cellulära proteotoxiska stresssvar i nematoden C. elegans genom att mäta aktiveringen av fluorescerande transkriptionella reportrar och analysera känslighet för fysiologisk stress.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Bar-Ziv, R., Frakes, A. E., Higuchi-Sanabria, R., Bolas, T., Frankino, P. A., Gildea, H. K., Metcalf, M. G., Dillin, A. Measurements of Physiological Stress Responses in C. Elegans. J. Vis. Exp. (159), e61001, doi:10.3791/61001 (2020).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Organismer utsätts ofta för fluktuerande miljöer och förändringar i intracellulära homeostas, vilket kan ha skadliga effekter på deras proteom och fysiologi. Således har organismer utvecklats riktade och specifika stressreaktioner avsedda för att reparera skador och upprätthålla homeostas. Dessa mekanismer inkluderar det ovikta proteinsvaret hos den endoplasmatiska reticulum (UPRER),mitokondriernas (UPRMT)utvecklade proteinrespons (HSR) och oxidativstressrespons (OxSR). De protokoll som presenteras här beskriver metoder för att upptäcka och karakterisera aktiveringen av dessa vägar och deras fysiologiska konsekvenser i nematoden, C. elegans. För det första beskrivs användningen av pathway-specifika fluorescerande transkriptionella reportrar för snabb cellulär karakterisering, läkemedelsscreening eller storskalig genetisk screening (t.ex. RNAi eller mutantbibliotek). Dessutom beskrivs kompletterande, robusta fysiologiska analyser, som kan användas för att direkt bedöma djurens känslighet för specifika stressfaktorer, vilket fungerar som funktionell validering av de transkriptionsreportrar. Tillsammans möjliggör dessa metoder snabb karakterisering av de cellulära och fysiologiska effekterna av interna och externa proteotoxiska störningar.

Introduction

En organisms förmåga att reagera på förändringar i den intra- och extracellulära miljön är avgörande för dess överlevnad och anpassning. Detta sker på cellnivå genom många skyddande vägar som säkerställer integriteten i cellen. Medan många cellulära komponenter är föremål för stress-associerade skador, en stor inblandning av cellulära stress svar är att reparera och skydda homeostas av cellulära proteom. Men uppdelningen av proteiner i speciella strukturer, som kallas organeller, utgör en utmaning för cellen, eftersom den inte kan förlita sig på en centraliserad form av proteinkvalitetskontroll för att säkerställa att alla proteiner i cellen är ordentligt vikta och funktionella. Därför, för att hantera störningar i sina proteiner, organeller har utvecklats dedikerade mekanismer för kvalitetskontroll, som kan känna felvikta proteiner och aktivera en stressrespons i ett försök att lindra stress inom detta utrymme. Cytosolen förlitar sig till exempel på värmechocksvaret (HSR), medan det endoplasmatiska reticulum (ER) och mitokondrierna förlitar sig på sina fackspecifika ovikta proteinsvar (UPR). OxSR tjänar till att lindra de toxiska effekterna av reaktiva syrearter (ROS). Varje stressrespons utlöses i närvaro av cellulära utmaningar och miljöföreskrifter och inducerar ett skräddarsytt transkriptionellt svar. Kännetecknen för dessa svar inkluderar syntetiserande molekyler som åter vika felvikta proteiner (såsom förkläde) riktade till rätt organell, eller alternativt ta bort skadade proteiner genom proteinnedbrytning. Underlåtenhet att aktivera dessa stressreaktioner resulterar i ansamling av skadade proteiner, cellulär dysfunktion förökas till systemisk fel i vävnader, och så småningom död av organismen. Funktionen och regleringen av de olika stressreaktionerna ses över någon annanstans1.

Många insikter om reglering och aktivitet av cellulära stressreaktioner har tillskrivits nematoden, Caenorhabditis elegans, en flercellig modell organism i genetisk forskning. Nematoder tillåter inte bara att studera aktivering av stressreaktioner på cellnivå, men också på organismnivå; nematoder har använts för att studera effekterna av genetiska störningar eller exponering för läkemedel och föroreningar på deras tillväxt och överlevnad. Deras snabba generationstid, isogeny, öppenhet, genetisk tractability, och användarvänlighet under experiment gör dem idealiska för sådana studier. Dessutom, den relativt snabba fysiologiska svar på stress (mellan timmar och några dagar) och den evolutionära bevarande av cellulära vägar gör nematoder ett framträdande verktyg för att studera stresstålighet.

Det finns två vanliga E. coli stammar som används som en näringskälla för att odla C. elegans:standard OP50, en B-stam där de flesta experiment har historiskt utförts2 och HT115, en K-12 stam som används för nästan alla RNAi experiment3,4. Det är viktigt att notera att det finns betydande skillnader mellan OP50 och HT115 bakteriell kost. Tillväxt på dessa olika bakteriella källor har visat sig orsaka stora skillnader i metabolisk profil, mitokondriellt DNA-kopieringsnummer, och flera stora fenotyper, inklusive livslängd5. Några av dessa skillnader tillskrivs vitamin B12 brist i samband med tillväxt på OP50 bakterier, vilket kan resultera i defekter i mitokondriell homeostas och ökad känslighet för patogener och påfrestningar. Alla dessa fenotyper har visat sig lindras genom tillväxt på HT115 bakterier, som har högre nivåer av vitamin B126. Därför rekommenderas att alla experiment på fysiologiska stressreaktioner utförs på HT115-bakterier, oavsett nödvändigheten av RNAi-tillstånd. På grund av att djuren är lätta att underhålla op50 kan dock all standardtillväxt (dvs. underhåll och förstärkning av djur) utföras på OP50, eftersom betydande skillnader i de experimentella paradigm som beskrivs här inte upptäcktes i maskar som upprätthålls på OP50 så länge de flyttades till HT115 efter synkronisering (dvs. från kläckning efter blekning med eller utan L1 gripande) fram till experiment.

Här beskrivs karakteriseringen av aktiviteten hos cellulära stressreaktioner med hjälp av två funktionella metoder. Det bör noteras att de protokoll som presenteras är främst inriktade på cellulära stressreaktioner och deras inverkan på protein homeostas. Först används fluorescerande transkriptionsreportrar, som regleras av endogena genpromotorer som är specifikt aktiverade som svar på olika cellulära påfrestningar. Dessa fluorescerande transkriptionella reportrar är baserade på transkriptionell induktion av specifika gener som är inbyggt en del av stressresponsen. Till exempel, HSP-4, en värmechock protein orthologous till den mänskliga förkläde HSPA5/BiP, aktiveras vid ER-stress och lokaliserar till ER för att lindra stress. Under förhållanden av ER-stress (t.ex. syntetiseras exponering för tunicamycin), ett grönt fluorescerande protein (GFP), som placeras enligt hsp-4-promotorns reglering, i höga nivåer som kan bedömas genom fluorescerande mikroskopi eller kvantitativt mätas med hjälp av stor partikelflödescytometri av nematoder7. På samma sätt används promotorn för ett mitokondriellt förkläde, hsp-6 (ortos till däggdjurs-HSPA9), för att övervaka aktiveringen av UPRMT8, och promotorn av cytosolic förkläde hsp-16,2 (ortos till de mänskliga crystallin alfagener) används för att bedöma aktiviteten hos HSR9. Dessa reportrar möjliggör en snabb karakterisering av de vägar som aktiveras som svar på olika störningar.

Ofta är de reportrar som presenteras här avbildade med hjälp av mikroskopi, vilket ger en kvalitativ effekt av aktivering av stressreaktioner. Men medan bildframställning tekniker ger både information om intensitet och vävnad plats för reportrar som beskrivs ovan, är dess kvantifiering inte alltid korrekt eller robust. Även om det är möjligt att kvantifiera fluorescerande aktivering med hjälp av bildanalysverktyg, är dessa metoder relativt låga genomströmning och provstorleken är liten, på grund av det relativt låga antalet avbildade djur. Den lätthet och förmåga att få stora mängder djur snabbt göra C. elegans en idealisk modell system för att analysera aktivering av fluorescerande stress reportrar med hjälp av en stor partikel flöde cytometer. En stor partikelflödescytmeter kan registrera, analysera och sortera baserat på storlek och fluorescens från många levande djur. Med den här metoden är det möjligt att få fluorescerande intensitet, storlek och även rumslig (2D) information för tusentals maskar. Systemet styrs med FlowPilot, vilket möjliggör datainsamling och analys i realtid av de uppmätta parametrarna. Här erbjuds metoder för både mikroskopisk avbildning och kvantitativ analys med hjälp av en stor partikelflödescytometer som metoder för att mäta aktivering av stressreaktioner.

Utöver reporteranalys kan djurens känslighet eller motståndskraft mot stress mätas med hjälp av fysiologiska stressanalyser. Detta uppnås genom att utsätta djur för stressiga miljöer som aktiverar specifika cellulära stressvägar. Här finns flera metoder för att mäta hela djurs känslighet för specifika typer av stressfaktorer.

ER stress appliceras på C. elegans med hjälp av det kemiska medlet, tunicamycin, som blockerar N-linked glykosylering, orsakar ansamling av felvikta proteiner i ER10. I C. elegans, tillväxt vid exponering för tunicamycin resulterar i stora störningar i ER funktion, och en betydligt minskad livslängd11. Genom att mäta djurens överlevnad på tunicamycinhaltiga plattor kan ER-stresskänsligheten hos djur kvantifieras. Till exempel, djur med ectopic UPRER induktion och därmed ökad motståndskraft mot protein felvikning stress i ER har en ökad överlevnad vid tunicamycin exponering jämfört med vilda djur12.

Oxidativ och mitokondriell stress appliceras på C. elegans genom att utsätta djur för det kemiska medlet, parakvat. Parakvat är en vanligt förekommande herbicid, som orsakar superoxid bildning specifikt i mitokondrierna13. På grund av den specifika lokaliseringen av mitokondrierna-härledda reaktiva syrearter (ROS), parakvat analyser används ofta som en "mitokondriell" stressanalys. Superoxid omvandlas dock snabbt till väteperoxid genom mitokondriell superoxiddismutaser (SODs)14. Väteperoxid kan därefter sprida sig ur mitokondrierna och orsaka oxidativ stress i andra delar av cellen. Därför beskriver vi parakvat överlevnadsanalyser som mätkänslighet för både mitokondriell och oxidativ stress (andra oxidativa stressanalyser kan hittas15).

Termotolerance analyser utförs i C. elegans genom att placera djur i förhöjda temperaturer. Omgivningstemperaturen för nematoder är ~15-20 °C och termisk stress framkallas vid temperaturer över 25 °C16,17. Termotolerance analyser utförs i allmänhet vid temperaturer från 30-37 °C, eftersom djur uppvisar stora cellulära defekter vid denna temperatur, och överlevnadsanalyser slutförs inom 24 timmar16,18. Här finns två alternativa metoder för att utföra termotoleranceanalyser: tillväxt vid 34 °C och tillväxt vid 37 °C. Tillsammans kan de protokoll som presenteras här användas för att utföra storskaliga skärmar i kombination med standardgen knock-down med RNA-interferens eller kemiska läkemedelsbibliotek.

Protokollet kan delas upp i 4 breda förfaranden- tillväxt av C. elegans och förberedelse för bildbehandling (avsnitt 1 och 2), avbildning av transkriptionella reportrar med fluorescerande mikroskopi (avsnitt 3-5), kvantitativa mätningar av reportrar med hjälp av en stor partikelflödescytometer (avsnitt 6) och fysiologiska analyser för att mäta stresskänslighet i C. elegans (avsnitt 7).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Standardtillväxtförhållanden för temperaturer och OP50 vs HT115

  1. Standardtillväxt och expansion
    1. Odla en odling av OP50 i LB(tabell 1)eller motsvarande media val för 24-48 h vid rumstemperatur (~ 22-25 °C). Odla bakterier i rumstemperatur eftersom OP50 är en uracil auxotroph och det finns en högre incidens av revertants (t.ex. suppressor mutanter) när de odlas vid 37 °C. Långtidslagring av OP50-kulturer rekommenderas inte (max 1 vecka vid 4 °C).
    2. Sådd en volym av ~100-200 μL mättad OP50-odling på en 60 mm NGM-platta (tabell 1) för underhåll av maskar och 1 ml mättad OP50-odling på en 100 mm platta för expanderande djur för försök.
    3. Låt plattorna torka över natten på en bänkskiva.
      OBS: 100 mm plattor kan behöva mer tid att torka, särskilt om du använder icke-ventilerade plattor. Förvara alla C. elegans-plattor i lufttäta behållare lagrade vid 4 °C. Använd inte plattor som är senaste 6 månader gamla eftersom uttorkning av plattor kommer att ske, vilket kommer att förändra djurfysiologi på plattorna på grund av olika osmotiska tryck och styvhet hos plattorna.
    4. För standardunderhåll, flytta 10-15 unga djur (ägg, L1 eller L2-steg) till en 60 mm platta, även om mer kan flyttas om det handlar om mutanter eller transgena djur med lägre fruktighet. För djur med utvecklings- eller fruktningsdefekter, bit en mer varierande pool av djur för att förhindra förlust av beståndet. Om djuren hålls vid 15 °C, flytta djuren varje vecka. för 20 °C, flytta djur var 3-4 dagar.
    5. Utför en ny tö av djur var 25-30 passager (~ 6 månader om djuren flyttas en gång i veckan och hålls vid 15 °C).
    6. För expansion, bit en hel 60 mm platta på 100 mm plattor för expansion. Som referensram kan djur med fruktning av vild typ ha en hel 60 mm platta skuren i 4ths-6ths och vara chunked på en stor platta vid 20 °C i 2 dagar eller 15 °C i 3 dagar för att skapa en full 100 mm platta utan att nå svält.

2. Mellanlagring/synkronisering av maskar med blekning

  1. Blekningsprotokoll för synkronisering av maskar
    1. Tvätta gravidmaskar (vuxna fulla av ägg) från agarplattor med M9 (tabell 1). Börja från en icke-synkroniserad population av maskar (dvs. chunked maskar från steg 1.1.6) till blekmedel för experiment, som betydande genetisk drift kan uppstå vid på varandra följande omgångar av synkronisering via blekning.
    2. Flytta mask/M9 blandning i en 15 ml konisk rör med hjälp av en glas pipett; flera plattor av maskar kan samlas in i en enda 15 ml konisk rör.
    3. Snurra djur ner för 30 s på 1000 x g. Aspirera M9 supernatant. Det är onödigt att tvätta bort kvarvarande bakterier om det inte finns en flagrant mängd kontaminering eller stora klumpar av bakterier. Om så är fallet, utför flera tvättar med M9.
    4. Bered ett nytt lager av blekningslösning (tabell 1). Blekningslösning kan hållas i flera dagar vid 4 °C, men använd nygjord blekningslösning eftersom ineffektiv blekning kan resultera i ojämn blekning, vilket kommer att orsaka skador på ägg innan alla maskkroppar elimineras.
    5. Tillsätt 2-10 ml blekningslösning till djuren (~1 ml blekmedelslösning för varje ~0,1 ml djurpellet). Invertera blekmedel och mask blandningen för ~ 5 min (inte överstiga 10 min; observera att blekning gånger kan variera och bör titreras speciellt för varje labb). Skaka kraftigt för att lösa upp maskkadaver snabbare och för optimal konservering av ägg. Titta regelbundet under ett dissekeringsmikroskop eller sätt det koniska röret i ett ljus för att observera när de vuxna maskkadaver har lösts upp helt och endast ägg kvar i röret.
    6. Pellet äggen genom att snurra på 1000 x g för 30 s och sedan aspirera supernatanten. Ägg kan centrifugeras snabbare än maskar utan att störa deras integritet, så om osäker på centrifughastighet, ägg kan knoppas ner på upp till 2.500 x g utan att påverka deras fysiologi.
    7. Tillsätt M9 upp till 15 ml och vänd röret för att rensa blekmedel från äggen.
    8. Upprepa steg 2.1.6-2.1.7 (tvätt/pelletprocess) 2-3 gånger till för att avlägsna blekmedel.
    9. Pipettägg/M9 blandas på tallrikar och odla vid 15-20 °C för experiment. För att få ett mått på hur många maskar som ska användas, utför ungefärliga äggvärden genom att pipettera 5 μL äggblandning på en agarplatta eller rutschkana och dividera antalet ägg med 5 för att bestämma antalet ägg per 1 μl volym. I genomsnitt 3 oberoende räknas kan förbättra noggrannheten. För att undvika svält finns en tabell med rekommenderade äggvärden per platta i tabell 2.
    10. Vid behov, L1 arrestera djur för hårdare tidsmässig synkronisering genom att placera ägg/M9 blanda i en rotator vid 20 °C i upp till 24 timmar. För vilda djur upptäcktes inga defekter i djurfysiologi när L1 griper i upp till 48 timmar. Mutanter som är känsliga för svält (t.ex. lyssom- eller autofagimutanter) gör dock mycket dåligt med L1-arrestering, och därför rekommenderas det inte att utföra denna synkroniseringsmetod för mutanter som är kända för att vara känsliga för svält. Om hårdare synkronisering krävs för djur som inte kan L1 arresteras, använd den äggläggningsmetod som beskrivs i avsnitt 2.2.
  2. Ägg-lay protokoll för synkronisering av maskar
    OBS: Som en alternativ metod till blekning kan en ägg-lay analys utföras. Äggläggning används vid blekning av djur inte ger en tillräckligt nära synkronisering, eftersom ägg i äggsäcken hos vuxna djur kan vara så olika som 8-12 h från varandra. För experimentella paradigm där det är avgörande för djur att vara så nära iscensatt som möjligt, men där L1-arrestering inte är möjlig (t.ex. i svältmutanter) rekommenderas ägglagdanalyser. Det bör dock noteras att på grund av det arbete som deltar i ägg-låg protokollet, är det mindre möjligt att utföra storskaliga experiment.
    1. Placera 4-12 gravida vuxna (se Anmärkning efter steg 2.2.2) på en standard OP50 eller HT115-seedade NGM-platta (se avsnitt 1 ovan för rekommendationer om bakteriestammar). Beroende på omfattningen av experiment, kan flera plattor användas. Var noga med att noggrant dokumentera hur många djur som finns på varje platta för steg 2.2.
    2. Placera djuren vid önskad temperatur för experiment (15-20 °C) i 4-8 timmar.
      OBS: Antalet timmar djur är kvar på plattan kommer att avgöra hur nära synkroniserade det första ägget som och det sista ägget som kommer att vara, så tidpunkten kan justeras efter behov. Eftersom kortare inkubationstider kommer att innebära att varje djur har mindre tid att lägga ägg, bör fler djur placeras på tallrikar för att säkerställa att tillräckligt med ägg läggs. Medan den faktiska äggläggningshastigheten inte är helt normaliserad på grund av djurens tendens att gå igenom korta skurar av äggläggning snarare än en normaliserad hastighet av äggläggning, kan den genomsnittliga andelen ägg som per djur uppskattas till ~ 5 ägg / timme för djur som uppvisar vild typ fruktsamhet19. När du försöker odla djur till dag 1 vuxen steg, tid ägg-låg för att ha <100 ägg per tallrik för att undvika svält (se tabell 2 för mer information om rekommenderade djur per tallrik).
    3. Ta bort vuxna djur från tallrikar. Se till att alla vuxna djur avlägsnas från plattorna, eftersom djuren kommer att fortsätta att lägga ägg och resultera i en osynchroniserad population och/eller svält av plattan.

3. Tillväxtvillkor för maskar för avbildning av transkriptionella reportrar

  1. Tillväxt av maskar
    1. Inokulera bakterieodling av HT115 som hyser pL4440 RNAi plasmid (EV) och/eller bär en RNAi-kassett mot önskad målgen(er) i LB-media kompletterat med 100 μg/mL karbensillin och 20 μg/mL tetracyklin.
    2. Odla kultur över natten (~ 16 timmar) till mättnad i en skakande 37 ° C inkubator.
    3. Spot 60 mm NGM RNAi plattor med 200 μL mättad bakteriekultur och 100 mm NGM RNAi plattor med 1000 μL mättad bakteriekultur. Låt torka vid rumstemperatur (~ 22 °C) över natten i mörker (täckt löst med aluminiumfolie).
    4. Placera synkroniserad population av transgena maskar som transporterar fluorescerande reportrar (se tabell 3 för fullständig lista) på NGM RNAi plattor sådd med bakterier val.
    5. Väx vid 15-20 °C till nödvändiga steg för specifika reportrar enligt beskrivningen nedan.
  2. Överväganden för iscensättning av maskar för experiment
    1. Utför experiment för transkriptionsreportrar dag 1 i vuxen ålder, med undantag för analyser som kräver L4-djur. Enligt WormAtlas, L4 djur erhålls cirka 2,5 dagar (~ 56 h) av tillväxt vid 20 ° C från äggstadiet (www.wormatlas.org).
    2. För "dag 1 vuxna," använda djur på cirka 3-4 dagar (~ 65-96 h) av tillväxt vid 20 °C efter plätering ägg.
      OBS: Detta breda spektrum förklaras på följande sätt: ~ 65 h vid 20 °C är när djur når "äggläggning", vilket är den sanna "vuxenlivet" tillstånd. 96 h är när djur kommer in vad WormAtlas beskriver som "äggläggning maximal", vilket är när den vuxna är en gravid vuxen och har en full äggsäck. Det är då djur skulle beskrivas som äldre än dag 1 och kan börja visa skillnader, och därmed de protokoll som beskrivs här är alla rekommenderas att starta i denna "dag 1" skede börjar så tidigt som 65 h och så sent som 96 h. För de analyser som beskrivs här, observerades inte stora skillnader när man använder djur i detta ~ 65-96 h fönster.
    3. För replikat av ett enda experiment, använd en liknande tidpunkt för mer robust reproducerbarhet (t.ex. utföra alla experiment på ~ 65 h eller ~ 96 h efter plätering ägg).
      OBS: Vissa transgena djur och mutanter visar långsammare tillväxttakt. För detta finns det två rekommendationer. 1) Använd förskjuten synkronisering, där djur kan blekas vid olika tidpunkter för att försök ska utföras samtidigt. Detta rekommenderas när den tekniska variationen i analysen kan vara större än de tekniska variationer som kan uppstå vid synkroniseringsanalysen (t.ex. överlevnadsanalyser som löper under långa löptider kan bli lidande om de inte utförs samtidigt). 2) Använd förskjuten analys, där djur kan blekas samtidigt, men analysen i sig utförs vid olika tidpunkter. Detta rekommenderas för mycket enkla analyser som inte har inneboende variationer (t.ex. RNAi-induktion av stressreaktioner).

4. Induktion av stressreaktioner

  1. Använda hsp-4p::GFP som en avläsning för aktivering av UPRER
    1. Inducera ER-stress med RNAi
      1. Förbered plattor som är fläckiga med RNAi-bakterier som riktar sig mot den gen som är av intresse på NGM RNAi-plattor (tabell 1) som i avsnitt 3. Använd EV som en kontroll för basala UPRER-nivåer och RNAi knockdown av tag-335 (enzym för N-linked glykosylering av ER bosatta proteiner; RNAi knockdown har liknande effekter som tunicamycin behandling) som en positiv kontroll för aktivering av UPRER under ER stress.
      2. Synkronisera hsp-4p::GFP-reporterdjur med metoder som beskrivs i avsnitt 2.
      3. Plåtägg på RNAi-plattor med de kriterier som rekommenderas i tabell 2.
      4. Inkubera ägg vid 20 °C i cirka 3-4 dagar (~65-96 h) för att utföra experiment dag 1 i vuxen ålder. För UPRER-experimenten finns det skillnader i basalfluorescens av hsp-4::GFP-reportern när den odlas vid olika temperaturer. Utför därför alla experiment vid 20 °C.
    2. Inducera ER-stress med hjälp av ett kemiskt agens
      1. Synkronisera hsp-4p::GFP reporter djur med metoder som beskrivs i avsnitt 2 och växa vid 20 °C tills djuren når L4-stadiet. Överför djur till ett rör av M9. Låt maskar bosätta sig (~2-3 min med tyngdkraft eller 30 s spinn vid 1 000 x g)och ta sedan bort M9.
      2. Späd tunicamycin till 25 ng/ml i M9 (en spädning på 1:40 från 1 mg/ml-lager). Som en kontroll, späd också en motsvarande volym DMSO i M9.
      3. Tillsätt 25 ng/mL tunicamycin/M9 eller kontrollera DMSO/M9-lösningen på maskar (använd 400-500 ml för ett 1,5 ml-rör eller 2 ml för ett koniskt rör på 15 ml). Inkubera vid 20 °C på en roterande plattform i 3-4 timmar.
        OBS: Tunicamycin kan också spädas direkt i mask/M9 blandning.
      4. Låt maskarna bosätta sig, ta bort M9/TM-lösning och tvätta med 1 ml M9.
      5. Överför djur till NGM-plattor eller NGM RNAi-plattor och låt det återhämta sig över natten (eller ~15-20 h) och nå dag 1 i vuxen ålder vid 20 °C innan fluorescerande mikroskopi utförs (avsnitt 5). En återhämtning över natten utförs för att möjliggöra en påvisbar nivå av GFP att ackumuleras.
      6. Alternativt kan du inducera hsp-4p::GFP genom att flytta L4-djur till agarplattor som innehåller 25 ng/μL tunicamycin i 16-24 timmar. Detta har en mycket mer robust induktion av hsp-4p::GFP på grund av den längre varaktigheten av stress, och därmed det dynamiska omfånget är mycket lägre än analysen som beskrivs ovan.
  2. Använda hsp-6p::GFP som en avläsning för aktivering av UPRMT
    1. Inducera mitokondriell stress med RNAi
      1. Aktivera UPRMT enligt samma protokoll som avsnitt 4.1.1, förutom att använda RNAi knockdown av mitokondriella gener, såsom cox-5b/cco-1 (cytokrom c oxidas underavdelning 5B; knockdown hämmar elektrontransportkedjans aktivitet). För UPRMT-aktivering genom störningar i elektrontransportkedjans funktion måste RNAi knockdown utföras under tidig utveckling20. Utför därför RNAi från luckan för dessa experiment.
    2. Inducera mitokondriell stress med hjälp av ett kemiskt agens
      1. Förbered plattor fläckiga med RNAi-bakterier som riktar sig mot den gen av intresse som i avsnitt 3. Använd HT115-bakterier även i experiment som inte involverar RNAi knockdown (se avsnitt 1). Se till att båda NGM RNAi-plattorna (eller NGM RNAi + DMSO0.2) och NGM RNAi + antimycin A-plattor(tabell 1)båda är förberedda för steg 4.2.2.5.
      2. Synkronisera hsp-6p::GFP eller hsp-60p::GFP-reporterdjur med metoder som beskrivs i avsnitt 2.
      3. Tallriksägg på val av sådd tallrik med de kriterier som rekommenderas i tabell 2. Eftersom antimycin A löses upp i DMSO, odla djuren på NGM RNAi + DMSO0.2 plattor från luckan.
      4. Inkubera ägg vid 20 °C i 2 dagar (~56 h) till L4-stadiet. Alternativt odla djur vid 15 °C i 3 dagar (~ 75 h) istället.
      5. Flytta maskar från NGM RNAi + DMSO0.2 plattor till NGM RNAi + antimycin A plattor eller NGM RNAi + DMSO0.2 plattor som en kontroll. Maskar kan flyttas manuellt med en plockning för småskaliga experiment, men för storskaliga experiment rekommenderar vi att tvätta djur med M9, lösa med centrifugering, aspirera M9, och sedan plätering till NGM RNAi + antimycin A plattor.
      6. Inkubera maskar för ytterligare ~20 h och bild dag 1 vuxen (avsnitt 5).
  3. Använda gst-4p::GFP som en avläsning för oxidativstrestrationsrespons.
    1. Inducera OxSR med RNAi
      1. Alternativt inducera gst-4p::GFP med RNAi-knockdown av wdr-23 (det kodar en negativ regulator av skn-1; alltså inducerar dess knockdown OxSR) med hjälp av det protokoll som beskrivs i avsnitt 4.1.1.
    2. Inducera OxSR med hjälp av exponering för den kemiska oxidanten Tert-butylhydroperoxid (TBHP)
      1. Förbered plattor fläckiga med RNAi-bakterier som riktar sig mot den gen av intresse som i avsnitt 3. Använd HT115-bakterier även i experiment som inte involverar RNAi knockdown (se avsnitt 1).
      2. Synkronisera gst-4p::GFP-reporterdjur med metoder som beskrivs i avsnitt 2.
      3. Tallriksägg på val av sådd tallrik med de kriterier som rekommenderas i tabell 2. Var noga med att förbereda fler plattor än nödvändigt eftersom läkemedelsbehandling protokollet resulterar i förlust av >10-20% av djuren. För avbildning, börja med >100 djur och för sortering, börja med >1 000 djur.
      4. Inkubera ägg i 20 °C i 2 dagar (~56 h) till L4-stadiet. Alternativt odla djur vid 15 °C i 3 dagar (~ 75 h) istället.
      5. Tvätta L4 djur från plattorna och delas upp i två 15 ml koniska rör per tillstånd. Sug ner volymen till minst 1 ml och tillsätt en lika stor volym nygjord 2 mM TBHP. Använd en total vätskevolym till minst 2 ml, eftersom lägre volymer kan orsaka betydande död av maskar vid spinning. Tvätta inte före läkemedelsbehandling, eftersom kvarvarande bakterier från plattor kommer att bidra till att säkerställa maskar att inte överstöka under inkubation.
      6. Inkubera maskar på rotatorn i 4 timmar vid 20 °C.
      7. Tvätta maskar genom att snurra på 1000 x g, aspirera M9 + TBHP mix, och ersätta med 15 ml M9. Upprepa för en andra tvätt.
      8. Platta maskar på EV RNAi att återhämta sig över natten (~ 16-24 h) vid 20 °C. Maskar kan återvinnas på matchande RNAi val, men inga betydande skillnader sågs när återvinnas på EV RNAi, så detta kan göras för enkel experimentell set-up. Ta bilder av dag 1 vuxna efter återhämtning.
        OBS: En återhämtning över natten utförs för att möjliggöra en påvisbar nivå av GFP att ackumuleras. Utan denna återhämtning finns det ingen detekterbar GFP-signal. Om en återhämtning på kortare sikt önskas är det möjligt att använda den analys som beskrivs i avsnitt 4.3.3.
    3. Inducera OxSR med hjälp av exponering för den kemiska oxidant parakvat (PQ)
      1. Upprepa alla steg i avsnitt 4.2.2 för att få 2 partier L4 gst-4p::GFP-djur i 15 ml koniska rör per tillstånd.
      2. Sug ner volymen till minst 1 ml och tillsätt en lika stor volym nygjord 100 μM PQ. I likhet med 4.3.2.5 rekommenderas en minsta volym på 2 ml.
      3. Inkubera maskar på rotatorn i 2 h vid 20 °C.
      4. Tvätta maskar genom att snurra på 1000 x g, aspirera M9 + PQ mix, och ersätta med 15 ml M9. Upprepa för en andra tvätt.
      5. Pläterar maskar på EV RNAi att återhämta sig för 2 h vid 20 °C, och sedan ta bilder omedelbart efter återhämtning.
        OBS: 2 h av återvinning var den minimala återhämtning som krävs för att visualisera GFP induktion.
  4. Använda hsp-16.2p::GFP och hsp-70p::GFP som en avläsning för HSR-aktivering.
    1. Inducera HSR med exponering för förhöjda temperaturer
      1. Förbered plattor fläckiga med RNAi-bakterier som riktar sig mot den gen av intresse som i avsnitt 3. Använd HT115-bakterier, även i experiment som inte involverar RNAi knockdown (se Inledning).
      2. Synkronisera hsp-16.2p::GFP eller hsp-70p::GFP reporter djur med metoder som beskrivs i avsnitt 2.
      3. Tallriksägg på val av sådd tallrik med de kriterier som rekommenderas i tabell 2. Var noga med att förbereda 2x antalet plattor som behövs eftersom hälften av provet kommer att utsättas för förhöjda temperaturer för värme-chock induktion, och den andra hälften kommer att fungera som en icke-värme-chockad kontroll.
      4. Inkubera ägg vid 20 °C i cirka 3-4 dagar (~65-96 h) för att utföra experiment dag 1 i vuxen ålder. Odla inte maskar vid 15 °C för värmechocksexperiment, eftersom det endast finns mindre skillnader mellan djur som upplever värmechock av 15 °C jämfört med 20 °C.
      5. Flytta försöksgrupper av djur till en 34 °C-inkubator för 2 h. Placera plattorna i inkubatorn som ett enda lager (dvs. ingen stapling av plattor) för att säkerställa den snabbaste och mest lika fördelning av värme över plattorna.
      6. Flytta värmechockade djur till en 20 °C-inkubator för att återhämta sig i 2 timmar och sedan bild omedelbart (se avsnitt 5). Djur kan återvinnas längre om det behövs för högre GFP induktion.
        OBS: 2 h av återvinning var den minimala återhämtning som krävs för att visualisera GFP induktion.

5. Bildbehandling med stereomikroskop eller ett wide-field/compound-mikroskop med låg förstoring

  1. Beredning av maskar för fluorescerande mikroskopi
    1. Pipetter 5-10 μL 100 mM natriumazid ovanpå en vanlig NGM-platta (dvs. inga bakterier).
      OBS: Natriumazid koncentration kan sänkas så lågt som 10 mM, även om den mest robusta immobilisering observerades vid 100 mM natriumazid utan detekterbar effekt på fluorescerande signal.
    2. Under ett dissekerande mikroskop, plocka 10-20 djur från försökstallrikar och överför till platsen för natriumazid. Djuren bör upphöra med sin rörelse strax efter landning i natriumazid, och natriumazid själv kommer att avdunsta inom några sekunder.
    3. När natriumazid har avdunstat, rada upp djur till önskad bildbehandling setup. Flytta djuren sida vid sida med främre och bakre sidor i samma riktning för alla djur. Bild djur omedelbart.
      OBS: Inga förändringar i reporter signal observerades för någon av de transkriptionella reportrar i tabell 3 i upp till 15 min efter förlamning i natriumazid.
  2. Bildinsamling med hjälp av ett stereomikroskop
    OBS: För detta protokoll, en Leica M205FA mikroskop utrustad med en Leica DFC3000G monokromatisk CCD kamera, standard Leica GFP filter (ex 395-455, EM 480 LP), och LAS X programvara användes. Rekommenderade inställningar för exponeringstider finns i tabell 4.
    1. Starta LAS X-programmet.
    2. Starta ett nytt projekt: Öppna fliken förvärv, klicka på Öppna projekt och klicka på Mapp för att öppna ett nytt projekt. Det här projektet kan döpas om genom att högerklicka på mappen och rulla nedåt för att byta namn eller klicka på F2. På fliken förvärv finns det också alternativ för att justera exponeringstiden och zooma till önskade inställningar.
    3. Placera maskprovet under mikroskopmålet och lokalisera maskarnas korrekta brännpunkt med hjälp av inställningen för ljusa fält för att minimera fluorescerande blekning. Mitten av provet är där ägglinjen är tydligt synlig och inte suddig. Ställ in exponeringstiden, zoomen, fokuset och kondensorerna med ljusa fält till önskade inställningar.
    4. Hämta en bild med knappen Ta bilder.
    5. Spara bilden i Lif-format (Leica Image File), eftersom det sparar alla råa bilder och metadata. En TIFF kan också exporteras genom att högerklicka på bilden (eller projektet) och klicka på TIFFunder alternativet Spara som . Detta kommer att lagra alla kanaler (t.ex. ljusa fält och GFP) med eventuella ändringar (t.ex. om kontrasten justerades, kommer detta att sparas i TIFF).
  3. Kvantitativ analys av fluorescerande bilder
    1. Om kvantitativ analys kommer att utföras, ta 3D-bilder. Detta utförs genom att klicka på z-sektionsalternativet märkt med "z" längst upp till höger. Z-sektionerna är aktiva om den här rutan är röd.
    2. Optimera z-sektioner genom att välja intervall och segmenttjocklek längst ned till vänster om justerbara alternativ. Använd knappen Systemoptimerad när det är möjligt för optimala inställningar.
    3. Ta bilden och lagra bilden enligt beskrivningen ovan i avsnitt 5.2. Rada upp maskar med mellanslag mellan dem för enklare mätningar.
    4. Importera TIFF-bilder till det bildhanteringsprogram som du väljer (t.ex.
    5. För ImageJ väljer du Ange måttmenyn Analysera. Kontrollera följande: område, genomsnittligt grått värde, integrerad densitet, bildskärmsetikett.
    6. Rita en avkastning med verktyget ROI (region av intresse). Mät varje mask individuellt. Välj Mät eller Measure tryck på Mpå menyn Analysera . Rita en roi i bakgrunden där det inte finns några maskar och mät sedan bakgrunden på samma sätt. Kopiera eller spara mått som visas i fönstret Resultat.
    7. Subtrahera den integrerade bakgrundsdensiteten från den integrerade densiteten för varje uppmätt avkastning på sysselsatt kapital. Bakgrundsintensiteten för en ROI definieras som produkten av bakgrundsmedelvärdet grått värde och området för roi-draget.
  4. Bildinsamling med hjälp av ett sammansatt/brett fältmikroskop
    OBS: För bildbehandling av transkriptionella reportrar med hjälp av en sammansatt / bredfält mikroskop, använder detta protokoll en Revolve ECHO R4 mikroskop utrustad med en Olympus 4x Plan Fluorite NA 0,13 objektiv, en standard Olympus FITC filter (ex 470/40; em 525/50; DM 560) och en iPad Pro för kameran och för att köra ECHO-programvaran. Rekommenderade inställningar för exponeringstider finns i tabell 4.
    1. Använd pekplattan för att starta kontrollprogrammet. Skapa ett nytt album och ett nytt filnamn.
    2. Placera plattan under objektivet. Ställ in exponeringstiden och fluorescensintensiteten med hjälp av baslinjen (EV/control treatment) och positiv kontroll, så att signalen syns men inte mättas.
    3. Spara en bild med ljusa fält och en GFP/FITC-bild.

6. Kvantitativa mätningar av reportrar med hjälp av en stor partikelflödescytmeter

OBS: Tillväxt och beredning av maskar för analys av stora partikelflödescytometer kan följa samma paradigm som avsnitt 1-5 för beredning av maskar för fluorescerande avbildning, med undantag för att ett större antal djur krävs. Använd >500 djur per tillstånd, eftersom vissa djur går förlorade under manipulering, inte alla djur passerar filtreringskriterierna under kvantifieringen, och vissa djur läss inte korrekt av flödescytometern. Tvätta djuren redo för sortering av plattor i 5-10 ml M9 lösning i 15 ml koniska rör för efterföljande sortering på flödescytometern.

  1. Sorteringsinställning med hjälp av en stor partikelflödescytmeter
    1. Innan du slår på flödescytometern
      1. Se till att hytsens flytande flaska inte är tom. Förbered hyvlar vätska från 250x lager minst några timmar före användning av sorteraren, eftersom det finns en liten mängd tvättmedel i slidan vätska, vilket kan orsaka bubblor som kan orsaka artefakter under förvärvet.
      2. Se till att alla avfallsbehållare inte är fulla.
    2. Slå på flödescytometern
      1. Slå på luftkompressorn. Vrid den till Auto. Kontrollera tryckmätaren - det bör vara runt 30 psi.
      2. Slå på instrumentet. Använd strömbrytaren som finns bredvid nätsladden till vänster om instrumentet.
      3. Slå på lasrar. En 488 nm ljuskälla är vanligtvis tillräcklig för de flesta experiment, även om en 561 nm ljuskälla måste användas om högre excitering krävs för röd fluorescens.
      4. Öppna FlowPilot-programvaran. instrumentet bör göra en serie klick som slår på de olika ventilerna.
      5. Slå på lasrarna i programfönstret genom att klicka på Start. Initiera laser i argon laserkontroll popup-fönstret genom att klicka på Kör. Detta bör leda till att lasern slås på och når runt 12 mW. Den 488 ljuskälla nivå kommer att gå upp till cirka 12.
      6. Klicka på Klar för att stänga fönstret.
    3. Kontrollerar programvara innan den fortskrider
      1. Kontrollera tryckmätare -Titta på de 4 tryckvärden som visas längst ned i fönstret. Värdena ska vara runt den ursprungliga inställningen (Slidan 5,5-5,7; Prov 5.7-6.0; Sorterare 3.1-3.3; Rengör 8,5-8,7). Om det ser likadant ut markerar du rutan bredvid Tryck OK.
      2. Kontrollera fluidics -För att se till att det inte finns några luftbubblor och skräp som blockerar flödet av slida / prov genom flödescellen, klicka på Rengör flera gånger.
      3. Kontrollera hyrda flöde -För detta, samla manteln för 60 s. Stäng av sort, sedan slå på slidan i de manuella kontrollerna för att starta flödet av slidan. Samla i en 15 ml rör för 60 s; flödet ska vara ~9-10 ml/min.
    4. Rengöring före användning av flödescytometern
      1. Sätt ~ 3-5 ml 10% blekmedel lösning i samlingen "kopp" och klicka på Förvärva. Låt köra för ~ 30 s, klicka på Avbryt, och ta bort överskott med vakuum.
      2. Skölj kollektionen "kopp" med avjoniserat vatten och ta bort med vakuum. Upprepa 2x.
      3. Sätt ~ 3-5 ml COPAS rengöringslösning i samlingen "kopp" och klicka på Förvärva. Låt köra i ~30 s, klicka på Avbrytoch ta bort överflödig rengöringslösning med vakuum.
      4. Skölj kollektionen "kopp" med avjoniserat vatten och ta bort med vakuum. Upprepa 2x.
      5. Sätt ~ 3-5 ml M9 lösning i samlingen "kopp" och klicka på Förvärva. Låt köra för ~ 30 s, klicka på Stoppa, och ta bort överskott M9 lösning med vakuum.
  2. Köra prover på sorterare
    1. Justera laser PMT makt och storlek gating baserat på det tillstånd som orsakar den ljusaste aktiveringen av transkriptionella reporter av intresse. Rekommenderade inställningar finns i tabell 4.
    2. Lägg beredda maskar till "kopp". Klicka på Hämta. Titta för att se till att all vätska inte tas upp i maskinen; Detta kommer att orsaka flödet cytometer att ta in luft och skapa bubblor i detektorn.
    3. Klicka på Avbryt när provet är lågt och/eller tillräckligt många djur har samlats in.
    4. Klicka på Installationsprogrammet | Lagring av uppgifter | Endast gated. Detta sparar endast data baserat på storleksbegränsningar. Klicka på Lagra gated och spara gated data. Klicka på Radera om du vill radera data.
    5. Skölj kollektionen "kopp" med avjoniserat vatten och ta bort med vakuum. Upprepa 2x.
    6. Upprepa steg 6.2.1-6.2.5 med resten av proverna.
  3. Kalibrering/kvalitetskontroll - vid behov
    OBS: Detta kräver löpkontroll 42 μM GYR fluorescerande partiklar som tillhandahålls, för att kalibrera 488-lasern.
    1. Tryck metallläppen på provkoppens ovantillslag för att ta bort luftröret. Skruva loss locket och använd en spruta för att avlägsna vätska från provkoppen.
    2. Blanda flaskan med kontrollpartiklar i god tid före användning och tillsätt några milliliter i provkoppen. Stäng locket och sätt på luften igen genom att trycka på den tills den klickar på plats.
    3. Gå till alternativet Verktyg i programvaran och klicka på Kör kontrollpartiklar.
    4. För kontrollpartiklar återställer du PMT-värdena till: GRÖN - 325; GUL - 365; RÖD - 575.
    5. Klicka på Hämta. Slidan ska slås på följt av prov. När pärlorna börjar gå igenom flödescellen kommer flödet att ses längst ned på skärmen. Optimalt bör flödet vara mellan 5/s och 15/s. Om flödet är för lågt eller noll vrider du provventilen fysiskt medurs för att öka flödet. Om flödet är för högt vrider du provventilen fysiskt moturs för att minska flödet.
      OBS: Normalt, under pärlsparläge, 500 pärlor avläs innan avstängning. Uppgifterna kan raderas och pärlorna läsas på igen.
    6. När avläsningen är klar, kontrollera om det finns rena enstaka toppar för de 5 parametrarna samt CV-värdena. Varianskoefficienten (CV) ska vara <15 %. Se också till att CV-värdena för de tre olika fluorescerande kanalerna är nära varandra.
    7. Gör en inspelning av QC-kontrollen: klicka på Spara som skärmbildunder fliken Arkiv .
  4. Rengöring och avstängning
    1. Använd ett vakuum för att ta bort provet från provkoppen och upprepa avsnitt 4.1.4.
    2. Sätt ~ 3-5 ml avjoniserat vatten i samlingen "kopp" och klicka på Förvärva,låt köra för ~ 30 s, och klicka sedan abortera. Lämna lite destillerat vatten kvar i provkoppen.
    3. Töm provåtervinningskoppen och avfallsflaskan.
    4. Stäng av programvaran. Klicka på Avslutaunder fliken Arkiv . Klicka på Stäng av utan rensningpå popup-menyn.
    5. Stäng av lasern, stäng av instrumentet och stäng sedan av luftkompressorn. Stäng luckan för att täcka instrumentet.

7. Fysiologiska analyser för att mäta stresskänslighet i C. elegans

  1. Mätning av ER-stresskänslighet med hjälp av tunicamycinexponering
    1. Förbered NGM RNAi DMSO plattor fläckig med RNAi bakterier som riktar sig till genen av intresse som i avsnitt 3. Använd HT115-bakterier även i experiment som inte involverar RNAi knockdown (se avsnitt 1). Kom ihåg att även så NGM RNAi TM-plattor (se tabell 1). Utsäde en tillräcklig mängd plattor: planera för ~ 5-7 uppsättningar NGM RNAi DMSO plattor och ~ 2-3 uppsättningar av NGM RNAi TM plattor.
    2. Synkronisera valfria djur med metoder som beskrivs i avsnitt 2.
    3. Tallriksägg på NGM RNAi DMSO-seedade plattor med hjälp av kriterier som rekommenderas i tabell 2. Var noga med att förbereda 2x antalet plattor som behövs eftersom hälften av provet kommer att överföras till NGM RNAi TM plattor.
    4. Inkubera ägg vid 20 °C i ca 3-4 dagar (~65-96 h) till dag 1 i vuxen ålder.
    5. Vid dag 1, förbereda livslängden genom att överföra djur på separata plattor. För att spara plattor (som TM kostnaderna är höga), använd 8 plattor av 15 djur per tillstånd, för totalt 120 djur per tillstånd. Detta möjliggör ett hanterbart antal djur per platta för poängsättning och tillåter en tillräcklig mängd djur för statistiska analyser, även med viss censur.
    6. Under de första 5-7 dagarna, flytta vuxna djur bort från avkomma varje dag på en ny tallrik tills avkomman inte längre är synlig. Under detta skede, censurera djur som är påsatta, uppvisar vulval utsprång / explosioner, eller krypa upp sidorna av plattorna, eftersom dessa inte dödsfall i samband med ER stress känslighet. Observera att TM behandling orsakar gripande hos djur, och därmed endast 1-2 drag av dessa djur var 2-3 dagar är tillräckligt för att minimera kostnaderna i samband med att producera TM-innehållande plattor. Vilda djur har en genomsnittlig överlevnad på ~ 15-17 dagar på DMSO och 12-14 dagar på tunicamcyin.
    7. När djuren har slutat producera avkomma, poäng livslängd var 1-2 dagar tills alla djur poäng som döda eller censureras. TM-behandla djur varje dag under dag 6-14 av vuxen ålder för högre upplösning.
  2. Mätning av mitokondriell och oxidativ stresskänslighet med hjälp av exponering för parakvat
    1. Förbered plattor fläckiga med RNAi-bakterier som riktar sig mot den gen av intresse som i avsnitt 3. Använd HT115-bakterier även i experiment som inte involverar RNAi knockdown (se Inledning).
    2. Synkronisera valfria djur med metoder som beskrivs i avsnitt 2.
    3. Tallriksägg på NGM RNAi-seedade plattor med hjälp av kriterier som rekommenderas i tabell 1. Analysen kräver ~ 60-100 djur per tillstånd, så förbered därefter.
    4. Inkubera ägg vid 20 °C i ca 3-4 dagar (~65-96 h) till dag 1 i vuxen ålder.
    5. Förbered en fräsch injektionsflaska på 100 mM paraquat i M9-lösning.
    6. Pipett 50-75 μL M9+parakvat i så många brunnar av en platt botten 96-brunnsplatta som önskas. Det rekommenderas allmänt att ha ~ 8-10 brunnar per tillstånd som innehåller ~ 8-10 djur per brunn. Detta möjliggör ett väl synligt antal djur per brunn med ~ 80 djur per stam.
    7. Välj 8-10 djur per tillstånd och överför dem till varje brunn som innehåller M9 +paraquat. Använd en plockning för att överföra djur till brunnarna snarare än pipettering för att undvika skillnader i volym och oavsiktliga förändringar i paraquat koncentrationer.
    8. Varje 2 h, poäng för död av djur i varje brunn. Knacka plattorna försiktigt, vilket kommer att orsaka levande djur att slå eller böja. Observera att det är möjligt att levande djur ibland är förlamad tillräckligt länge för att poängsättas som döda. Om antalet levande djur överstiger antalet levande djur från en tidigare tidpunkt är det därför troligt att djuret levde och bör vara oreda (t.ex. om 2/10 djur per timme 4, 2/10 görs som döda och vid 6 års tid endast 1/10 djur är döda, bör timme 4 ombetalas som 1/10 djur döda).
  3. Mätning av värmekänslighet med exponering för förhöjda temperaturer
    1. Förbered plattor fläckiga med RNAi-bakterier som riktar sig mot den gen av intresse som i avsnitt 3. Använd HT115-bakterier även i experiment som inte involverar RNAi knockdown (se avsnitt 1).
    2. Synkronisera valfria djur med metoder som beskrivs i avsnitt 2.
    3. Tallriksägg på valiga tallrikar med de kriterier som rekommenderas i tabell 1. Har 60-100 djur per tillstånd för termotolerance analyser. För termotolerance analyser, använd L1 gripande eller ägg låg analyser för bästa synkronisering eftersom det finns stora variationer baserat på ålder av djur i analysen.
    4. Inkubera djur vid 20 °C i cirka 3-4 dagar (~65-96 h) för att utföra experiment dag 1 i vuxen ålder. Odla inte maskar vid 15 °C för värmechocksexperiment eftersom det finns en mindre skillnad mellan djur som upplever värmechock av 15 °C jämfört med 20 °C.
    5. Vid dag 1, förbereda djur genom att överföra dem till separata plattor. Det rekommenderas allmänt att ha ~10-15 djur per platta med 4-6 plattor, för totalt 60 djur. Detta möjliggör ett hanterbart antal djur per platta för poängsättning och möjliggör minimal tid för djur som ska dras ut ur förhöjda temperaturer.
    6. Placera djuren i en 37 °C-inkubator och poäng var 2:e timme Börja göra mål för termotolerance vid 37 °C vid timme 5, så liten eller ingen död inträffar före 5 timmar. Median thermotolerance uppnås på ~ 9 timmar, så timme 7, 9 och 11 är kritiska tidspunkter, men på grund av inkubator och lab-till-lab variabilitet, detta kan behöva titreras per labb. Dessutom kommer alla metoder för att minska variabiliteten att hjälpa (t.ex. inte stapling plattor, placera plattor i samma område inom en enda inkubator, minimera tid inkubatorn öppnas eller stängas, med så få plattor ur inkubatorn i taget för att minimera tiden djur tillbringar utanför 37 °C, etc. För en fullständig guide, se21).
    7. Som ett alternativ till steg 7.3.6, placera djur vid 34 °C i stället för 37 °C. Mediantermoomans vid 34 °C är på lite över 14 timmar, så tidspunkterna 12, 14 och 16 är kritiska för 34 °C termotoleranceanalyser.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Använda transkriptionella reportrar för att mäta aktivering av stressreaktioner
Här används fluorescerande transkriptionsreportrar, som fungerar som robusta verktyg för att mäta aktivering av de flesta stressreaktioner i C. elegans. GFP-uttrycket drivs under initiativtagare till kanoniska mål för master transkriptionella tillsynsmyndigheter som arbetar med att reagera på fackspecifika påfrestningar. En omfattande förteckning över vanliga transkriptionsreportrar finns i tabell 3.

Perturbing ER homeostas via ovikta eller felvikta proteiner eller lipid bilayer stress orsakar aktivering av den ovikta protein svar ER (UPRER) för att återställa ER kvalitet och funktion. UPRER består av 3 olika grenar som definieras av transmembransensorerna: inositol-kräver protein 1 (IRE1), aktiverande transkriptionsfaktor 6 (ATF6) och proteinkinas RNA (PKR)-liknande ER kinas (PERK), som alla bevaras i C. elegans7,,22,23. Det vanligaste verktyget för att övervaka aktiveringen av UPRER i nematoden, är den transkriptionella reporterstam som uttrycker GFP under kontroll av hsp-4 promotorn(hsp-4p::GFP)7. Genen hsp-4 kodar en orthologue av däggdjur Hsp70, HSPA5 (eller BiP/Grp78). I tider av ER stress när UPRER aktiveras, hsp-4p:: GFP reporter stam uttrycker GFP. Denna reporter har minimalt basalt uttryck i avsaknad av stress, men uppvisar robusta GFP uttryck när djur utsätts för tunicamycin (Figur 1A). Dessa skillnader kan också kvantifieras med hjälp av en stor partikelflödescytmeter (figur 1B). Dessutom kan induktion av hsp-4p:: GFP under ER stress helt undertryckas av RNAi-knockdown av xbp-1, som aktivering av denna transkriptionella reporter är beroende av transkriptionsfaktorn, XBP-112.

I likhet med UPRER, mitokondrierna hus sin egen skyddsmekanism mot proteotoxisk stress. Denna mekanism, som kallas mitokondriell UPR (UPRMT)24, regleras huvudsakligen av transkriptionsfaktorn ATFS-1, som inte kommer in i mitokondrierna under stress på grund av minskad importeffektivitet, vilket resulterar i inträde av ATFS-1 i kärnan25. Intressant, olika störningar till mitokondriellt processer kan aktivera detta svar, inklusive protein aggregering, knock down av elektron transportkedjan (ETC) komplex underenheter, mitokondriellt DNA-replikation stress, och mitokondriellt protein översättning8,26. Aktiveringen av UPRMT har övervakats med hjälp av maskar som uttrycker en transgen konstruktion där GFP placerades enligt reglering av initiativtagarna till mitokondriella förklädegener, hsp-6 och hsp-608. I likhet med hsp-4p::GFP djur, hsp-6p::GFP djur uppvisar minimal basal signal i avsaknad av stress. Den mest robusta metoden för att inducera UPRMT är genom RNAi-knockdown av följande mitokondriella proteiner: cox-5B, cytokrom c oxidas underavdelning Vb/COX4 (Complex IV)20, nuo-4, NADH dehydrogenas protein (Complex I)27, eller mrps-5, en mitokondriell ribosomal protein28, aktiverat hsp-6p::GFP reporter. GFP-uttrycket genom denna reporter aktiveras kraftfullt och kan enkelt visualiseras och kvantifieras under dessa förhållanden (figur 2A-B). UPRMT kan också utlösas genom kemisk hämning av elektrontransportkedjan (ETC), till exempel med antimycin A, som hämmar cytokrom c reduktas (komplex III). I likhet med RNAi-knockdown av ETC-komponenter, antimycin A behandling orsakar en robust induktion av hsp-6p::GFP (Figur 2C-D).

Förmågan för organismer att känna och reagera på oxidativ stress är en bevarad process närvarande från bakterier till människor29. I C. elegansfungerar NRF2-homologen, SKN-1, som en viktig transkriptionsfaktor, som är känslig för redoxförändringar på grund av reaktiva cysteiner i hela proteinet. SKN-1 fungerar som en av de transkriptionella aktivator av OxSR genom bindning till bevarade konsensus sekvens mycket liknar antioxidant svar element bundna av NRF230. Hos människor, NRF2 regleras negativt av KEAP1, som tros vara känslig för redox förändringar på grund av reaktiva cysteiner i hela proteinet31. Även om det inte finns någon direkt ortos av KEAP1 i maskar, SKN-1 är negativt reglerad av WD-upprepa protein, WDR-23, på ett sätt som är mekanistiskt skiljer sig från KEAP1/NRF2 hämning32. Vid oxidativ stress, såsom tert-butylhydroperoxid (TBHP), AKTIVERAR SKN-1 avgiftning och antioxidant gener som gst-4, en glutation S-Transferase. För att mäta oxidativ stress placeras GFP-uttrycket under initiativtagare till gst-4, en glutation S-transferase33. Till skillnad från de andra transkriptionella tillsynsmyndigheter som presenteras här, gst-4p:: GFP har hög basal uttryck. Detta uttryck kan dock fortfarande aktiveras robust under förhållanden av oxidativ stress, som kan utföras både genetiskt och kemiskt. För att genetiskt inducera oxidativ stress, slår vi ner wdr-23, som kodar ett protein som spelar en roll i proteasomal nedbrytning av SKN-134. wdr-23 knockdown resulterar i robust aktivering av gst-4p::GFP. Dessutom resulterar behandling av maskar med den kemiska oxidanten, TBHP, i en mildare, men fortfarande betydande, aktivering av gst-4p::GFP (figur 3). Både kemisk och genetisk aktivering av gst-4p::GFP kan nästan helt undertryckas av RNAi knockdown av skn-1, genen kodning befälhavaren transkriptionella regulator av OxSR.

De flesta cellulära proteiner översätts i cytoplasma och bor där, även om det bara tillfälligt innan de riktas någon annanstans. Således är cytoplasma värd ett varierat utbud av förkläde som främjar korrekt protein vikning och funktion, samt enzymer och proteiner som ansvarar för förnedrande skadade, dysfunktionella, eller överskott proteiner. För att skydda detta komplexa proteinlandskap av cytoplasman har cellen utvecklat flera cytoplasmatiska stressresponsvägar, inklusive värmechocksvaret (HSR)35,36. HSR är en väg för att främja protein homeostas under förhållanden av värmestress och moduleras av befälhavaren transkriptionella regulator, HSF-137. Under steady state-förhållanden är HSF-1 bundet av cytoplasmatiska förkläde, HSP90 och HSP70/40, vilket håller den låst i ett monomeriskt, inaktivt tillstånd. Under värmeförhållanden eller liknande stress leder en ökning av felvikta proteiner till titrering av förkläde från HSF-1, vilket gör det möjligt att trimma och flytta till kärnan för att aktivera HSR38,39. Kanske de mest studerade nedströmsmålen för HSF-1 under HSR-aktivering är värmechockproteinerna (HSP70, HSP90, DNAJ och HSP6017,40. I C. elegans, transkriptionella reportrar för HSR har syntetiserats genom att köra uttryck för GFP under initiativtagarna till kanoniska HSP, hsp-16,2 och hsp-709,41. Liksom deras UPRMT och UPRER motsvarigheter, hsp-16.2p::GFP och hsp-70p::GFP visar minimalt basalt uttryck i avsaknad av stress. Båda reportrarna är dock starkt inducerade under värmestrålning, som lätt kan visualiseras genom mikroskopi eller kvantifieras med hjälp av en stor partikelflödescytometer (figur 4). Båda reportrarna har stort dynamiskt omfång, och induktion är helt beroende av hsf-1, som RNAi-knockdown av hsf-1 helt dämpar induktion av hsp-16.2p::GFP och hsp-70p::GFP. Även om dessa reportrar kan användas omväxlande för de flesta situationer, kan det finnas skillnader i uttrycksnivåer och uttryck över vävnader.

Fysiologiska analyser för att mäta stresskänslighet i C. elegans
C. elegans är en stor modell organism för att mäta stresskänslighet på grund av den låga kostnaden för underhåll och experiment och enkel genomredigering eller genetisk knockdown med RNAi, som ger kapacitet att utföra storskaliga experiment i en hel organism. För att analysera stresstolerans mot ER stress, exponerar vi C. elegans till det kemiska medlet, tunicamycin, som orsakar ansamling av skadade proteiner i ER genom att blockera N-linked glykosylering10. Djur utsätts för tunicamycin efter utveckling, eftersom läkemedlet orsakar utvecklingsdefekter. När de utsätts för tunicamycin uppvisar vuxna maskar en markant nedgång i livslängden. Dessutom leder knockdown av genen, xbp-1, som kodar en av de primära transkriptionsfaktorer som är involverade i UPRER induktion, till en betydande ökning av känsligheten för tunicamycin (figur 5A)12. Således fungerar detta som en robust analys för att mäta ER stresskänslighet i vuxna maskar.

För att mäta oxidativ stress och mitokondriell stress utsätter vi djur för det kemiska medlet parakvat. Parakvat orsakar mitokondriell stress genom syntes av ROS inom mitokondriell matris, som sedan kan omvandlas till väteperoxid och sprida ut ur mitokondrierna att orsaka hela cellen oxidativ skada13. I likhet med ER stressanalyser, utsätter vi djur för parakt vid vuxen ålder. Men vi utför parakvat analyser i vätska för att minska kostnaderna och manuellt arbete och agar platta-baserade analyser skulle vara svårt för de flesta laboratorier. Här visar vi att djur som exponeras för parakvat i vätska uppvisar medianöverlevnad på cirka 5 timmar (figur 5B). Dessutom, knockdown av insulinreceptorn, daf-2, resulterar i en ökad motståndskraft mot parakvat som aktivering av DAF-16/FOXO resulterar i ökat uttryck för inblandade i clearance av ROS, såsom sod-342,43. Parakvat överlevnadsanalyser är korta, varar upp till 14 timmar, och därmed fungera som en effektiv metod för att förhöra mitokondriellt och oxidativ stress svar.

Slutligen används överlevnad vid förhöjda temperaturer för att förhöra den fysiologiska reaktionen på värmestress. Dessa analyser kan utföras både i flytande eller fast agar, och det finns många olika protokoll som beskrivs21. Det rekommenderas att standardisera en enda analys i labbet för att minska variabiliteten, vilket är exceptionellt hög i denna analys. Termotolerance bör utföras i dag 1 vuxna djur på standardagarplattor, antingen vid 34 °C eller 37 °C. Vid 37 °C inträffar en majoritet av dödsfallet mellan 7-11 timmar, vilket gör detta till en enkel endagsanalys, medan 12-16 timmars experiment vid 34 °C lättast utförs över natten (figur 5C-E). Mutation i genen, ttx-3, resulterar i fel specifikation av AIY interneurons som ansvarar för termosensoriska neurala kretsen, och orsakar en betydande ökning av thermosensitivity44. Även om termotolerancedata kan ritas som en överlevnadskurva (figur 5C), bör dessa analyser utföras minst 4-6 gånger och alla replikat bör ritas mot varandra ( figur5D-E), som termotolerance visar otroligt hög variabilitet jämfört med andra stressanalyser. Detta beror på de många förbehåll som finns i inrättandet av dessa experiment, inklusive variationer i stammar av intresse, ojämlik cykling av luft i inkubatorer, ojämna agar plattor, etc.21. Vid 34 °C sker medianöverlevnaden vid cirka 14 timmar och liknar 37 °C, ttx-3 mutanter uppvisar minskad överlevnad vid 34 °C(figur 5E).

Figure 1
Bild 1: Använda hsp-4p::GFP som reporter för UPR ER-induktion.ER (A)Representativa fluorescerande mikrografer av hsp-4p::GFP som uttrycker djur som odlas på kontroll tom vektor (EV) eller xbp-1 RNAi. Djuren odlades på RNAi från luckan till L4 vid 20 °C, sedan behandlades med 25 ng/μL tunicamycin eller 1% DMSO flytande i M9 vid 20 °C i 4 timmar, och återhämtade sig på en OP50-skylt i 16 timmar vid 20 °C före avbildning. Djur förlamades i 100 μM natriumazid på en NGM agar platta och avbildas med hjälp av ett stereomikroskop. b)Kvantitativ analys av(A)med hjälp av ett stort partikelbiosorter. Uppgifterna representeras som integrerad fluorescensintensitet över hela djuret där varje punkt representerar ett enda djur. DMSO kontroll är i grått och tunicamycin behandlade djur är i rött. Centrallinje representerar medianen och morrhår representerar interkvartilområdet. n = 123-291 djur per stam. p < 0.001 med icke-parametrisk Mann-Whitney-testning. Klicka här för att se en större version av denna siffra.

Figure 2
Bild 2: Använda hsp-6p::GFP som reporter för UPR MT-induktion.MT (A)Representativa fluorescerande mikrografer av hsp-6p::GFP som uttrycker djur som odlas på kontroll tom vektor (EV), cco-1, mrps-5eller nuo-4 RNAi. Djur odlades på RNAi från luckan och avbildas på dag 1 i vuxen ålder vid 20 °C. Djuren förlamats i 100 μM natriumazid på en NGM agar platta och avbildas med hjälp av en sammansatt mikroskop. b)Kvantitativ analys av(A)med hjälp av ett stort partikelbiosorter. Uppgifterna representeras som integrerad fluorescensintensitet över hela djuret där varje punkt representerar ett enda djur. EV kontroll är i grå RNAi-behandlade djur är i rött. Centrallinje representerar medianen och morrhår representerar interkvartilområdet. n = 303-384 djur per stam. p < 0,001 jämfört med EV-kontroll med icke-parametrisk Mann-Whitney-testning. C)Representativa bilder av hsp-6p::GFP-djur som behandlats med DMSO eller Antimycin A. Djur odlades från luckan på 0,2 % DMSO-plattor och överfördes till plattor som innehåller 0,2 % DMSO eller 3 mM antimycin A i 16 timmar före avbildning på ett roterande ECHO R4-sammansatt mikroskop. All tillväxt utfördes vid 20 °C.All growth was performed at 20 °C. D)Kvantitativ analys av(C)med hjälp av ett stort partikelbiosorter som liknar(B). DMSO kontroller är i stor, och Antimycin A-behandlade djur är i rött. n = 495 för DMSO och 219 för Antimycin A. ***p < 0,001 jämfört med EV-kontroll med icke-parametrisk Mann-Whitney-testning. Klicka här för att se en större version av denna siffra.

Figure 3
Figur 3: Använda gst-4p::GFP som reporter för OxSR. aA) Representativa fluorescerande mikrografer av gst-4p::GFP som uttrycker djur som odlas på kontroll tom vektor (EV), skn-1eller wdr-23 RNAi. Djur odlades på RNAi från luckan till L4 steg vid 20 °C. Djuren odlades på RNAi från luckan till L4 vid 20 °C, behandlades sedan med 2 mM TBHP i M9 eller endast M9 för "obehandlad" kontroll vid 20 °C i 4 timmar och återfanns på en EV-skylt i 16 timmar vid 20 °C före avbildning. Djuren förlamats i 100 μM natriumazid på en NGM agar platta och avbildas med hjälp av en sammansatt mikroskop. b)Kvantitativ analys av(A)med hjälp av ett stort partikelbiosorter. Uppgifterna representeras som integrerad fluorescensintensitet över hela djuret där varje punkt representerar ett enda djur. obehandlad kontroll är i grått och TBHP-behandlade djur är i rött. Centrallinje representerar medianen och morrhår representerar interkvartilområdet. n = 101-204 djur per stam. p < 0,001 jämfört med respektive EV-kontroll med icke-parametrisk Mann-Whitney-testning. Klicka här för att se en större version av denna siffra.

Figure 4
Bild 4: Använda hsp16.2p::GFP och hsp-70p::GFP som reportrar för värme-chock svar. (A)Representativa fluorescerande mikrografer av hsp16.2p::GFP som uttrycker djur som odlas på kontroll tom vektor (EV) eller hsf-1 RNAi. Djur odlades på RNAi från luckan vid 20 °C till dag 1. Dag 1 djur lämnades antingen vid 20 °C (obehandlad) eller utsätts för 2 timmars värmestretshet vid 34 °C och återfanns sedan i 2 timmar vid 20 °C. Djur förlamades i 100 μM natriumazid på en NGM agar platta och avbildas med hjälp av ett stereomikroskop. b)Kvantitativ analys av(A)med hjälp av ett stort partikelbiosorter. Uppgifterna representeras som integrerad fluorescensintensitet över hela djuret där varje punkt representerar ett enda djur. obehandlad kontroll är i grått och värmechockade djur är i rött. Centrallinje representerar medianen och morrhår representerar interkvartilområdet. n = 320-364 djur per stam. p < 0.001 med icke-parametrisk Mann-Whitney-testning. C)Representativa fluorescerande mikrografer av hsp-70p::GFP som uttrycker djur som odlas på kontroll EV och hsf-1 RNAi och behandlas enligt beskrivningen i(A). D)Kvantitativ analys av(C)enligt beskrivningen iB. n = 773-941 djur per stam. Klicka här för att se en större version av denna siffra.

Figure 5
Figur 5: Fysiologiska överlevnadsanalyser under stress i C. elegans. (A)Livslängder på nematoder som odlas på 1% DMSO innehållande 25 ng/μL tunicamycin (TM) plattor. Djur odlades på 1% DMSO plattor från luckan till dag 1, och överförs till respektive TM plattor på dag 1. Djuren hölls på kontroll tom vektor (EV) eller xbp-1 RNAi från luckan till slutet av analysen vid 20 °C. Vuxna djur flyttas manuellt bort från avkomman varje dag tills ~ dag 7-8 när avkomman inte längre upptäcktes, sedan poängsätts varannan dag tills alla djur registrerades som döda eller censurerade. Djur med uppsamlare, vulval utskjutande delar / explosioner, eller de som kröp upp sidorna av plattorna ansågs censurerade. (B)Överlevnadskurva av nematoder i 100 mM parakvat (PQ) upplöst i M9-lösning. Djur odlades på EV eller daf-2 RNAi från luckan till dag 1 i vuxen ålder vid 20 °C. Djuren placerades i 50 μl M9 + PQ-lösning i en 96-brunnsplatta vid 20 °C och visualiserades varannan timme tills alla djur var orörliga. CCÖverlevnadskurva av nematoder vid 37 °C. Wild-type (N2), ttx-3(KS5)och sur-5p::hsf-1 djur odlades på EV-plattor från luckan till dag 1 vid 20 °C. På dag 1 flyttades djuren till 37 °C och fick poäng varannan timme tills alla djur fick samma poäng som döda eller censurerade. D)Poolade data för alla termotoleranceanalyser som utförts vid 37 °C. Data representeras som procent levande vid timme 9 av en termotolerance analys, med varje rad som representerar en matchad experiment utförs på samma dag. E)Poolade data för alla termotoleranceanalyser som utförts vid 34 °C. Data representeras som procent levande vid timme 14 av en termotolerance analys, med varje rad som representerar en matchad experiment utförs på samma dag. All statistik för A-C utfördes med Log-Rank (Mantel-Cox) testning och finns i tabell 5. Klicka här för att se en större version av denna siffra.

Reagens Recept
Lysogeny Buljong (LB) I detta protokoll, kommersiella LB användes (se material), men alla vanliga LB hemgjorda recept med Bacto-tryptone, jäst extrakt, och NaCl är tillräckliga.
Nematode Tillväxt Media (NGM) 1 mM CaCl2, 5 μg/mL-kolesterol, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (w/v) agar, 0,25% (w/v) Bacto-Peptone, 51,3 mM NaCl
Blekmedel lösning 1,8% (v/ v) natriumhypoklorit, 0,375 M KOH
M9-lösning 22 mM KH2PO4 monobasic, 42,3 mM Na2HPO4, 85,6 mM NaCl, 1 mM MgSO4
NGM RNAi plattor 1 mM CaCl2, 5 μg/mL-kolesterol, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (w/v) agar, 0,25% (w/v) Bacto-Peptone, 51,3 mM NaCl, 1 mM IPTG, 100 μg/mL carbenicillin/ampicillin. Förvaras vid 4 ° C i mörker i upp till 3 månader
Tetracyklin 10 mg/ml-stamlösning (500x) i 100% etanol. Förvaras vid -20 °C
Karenicillin 100 mg/ml-stamlösning (1000x) i vatten. Förvaras vid 4 °C i upp till 6 månader eller -20 °C för långtidsförvaring
Natriumazid 1 M lager (~ 6,5%) stamlösning av natriumazid i vatten. Förvaras i mörker vid 4 °C. Detta är en 10x lösning och späds ut till ett arbetslager på 100 mM för de flesta bildexperiment
Tunicamycin (2019) 2,5 mg/ml-stamlösning i 100% DMSO. Förvaras vid -80 °C för långtidsförvaring. Detta är en 100x lösning (25 ng/μL arbetslösning)
Antimycin A 15 mM antimycin En stamlösning i 100% DMSO. Förvaras vid -20 °C. Detta är en 5000x lösning (3 μM arbetslager)
Paraquat (paraquat) 50 μM lösning i vatten – ska beredas färskt
Tert-butylhydroperoxid (TBHP) 7,7 M lösning i vatten. Detta är en 3850x lösning (2 mM arbetslager)
NGM RNAi + DMSO0.2 1 mM CaCl2, 5 μg/ml-kolesterol, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (w/v) agar, 0,25% (w/v) Bacto-Peptone, 51,3 mM NaCl, 1 mM IPTG, 100 μg/mL carbenicillin/ampicillin, 0,2% DMSO
(kontroll för antimycin A)
NGM RNAi + antimycin A 1 mM CaCl2, 5 μg/ml-kolesterol, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (w/v) agar, 0,25% (w/v) Bacto-Peptone, 51,3 mM NaCl, 1 mM IPTG, 100 μg/mL carbenicillin/ampicillin, 0,2% DMSO, 3 mM antimycin A
NGM RNAi DMSO 1 mM CaCl2, 5 μg/mL-kolesterol, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (w/v) agar, 0,25% (w/v) Bacto-Peptone, 51,3 mM NaCl, 1 mM IPTG, 100 μg/mL carbenicillin/ampicillin; 1% DMSO
(kontroll för tunicamycin)
NGM RNAi TM 1 mM CaCl2, 5 μg/mL-kolesterol, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (w/v) agar, 0,25% (w/v) Bacto-Peptone, 51,3 mM NaCl, 1 mM IPTG, 100 μg/mL carbenicillin/ampicillin; 1% DMSO, 25 ng/μL tunicamycin
IPTG (på andra) 1 M lösning i vatten.

Tabell 1: Rekommenderade recept för använda reagenser. Alla exakta recept av reagenser som används i detta protokoll beskrivs här. Särskilda företag där reagenser köptes finns också i materialregistret. Många olika kemikalier testades, och de som anges i tabellen över material är de som uppvisade de mest robusta och reproducerbara resultaten.

Plåtstorlek Bakterietyp # av djur för att nå dag 1 vuxen ålder Antal djur för att nå L4-stadiet
60 mm OP50 (PÅ) 100-150 150-300
60 mm HT115 (HT115) 70-100 120-200
100 mm OP50 (PÅ) 600-1000 1500-2000
100 mm HT115 (HT115) 350-600 700-1300

Tabell 2: Rekommenderat antal djur som ska plattan efter synkroniseringen för att undvika svält. För att undvika svält rekommenderar vi att du plätering ett visst antal djur per tillstånd. Eftersom OP50 växer tätare än HT115 kan fler djur pläteras. Alla nummer som anges här är de riktlinjer som används i vårt labb, och antalet kan vara något annorlunda på grund av flera variabler och skillnader mellan laboratorieförhållanden. Därför, eller rekommenderade tal är på den nedre sidan i fetstil. Max nummer är vad som kan pläteras under optimala förhållanden i vårt labb utan att nå svält, men det rekommenderas inte att använda dessa värden utan att först titrera dina villkor. Alla siffror bestäms med antagandet att bakterier sås på plattor och får växa i ~ 24 timmar vid rumstemperatur (~ 22 °C) på plattor innan maskar placeras på dem. Även om det inte finns någon större skillnad i svält priser vid plätering ägg eller L1s, rekommenderar vi plätering ~ 10% högre antal vid plätering ägg, eftersom inte alla ägg kommer att kläckas efter blekning.

Sila namn Transgene (transgene) Syfte Rekommenderad applicering(er) av stress Källkod
SJ4005 hsp-4p::GFP UPRER 25 μg/mL tunicamycin Cgc
SJ4100 (SJ4100) hsp-6p::GFP UPRMT 3 μM antimycin A; Cgc
RNAi mot ETC eller mitokondriell ribosoma
SJ4058 (SJ4058) hsp-60p::GFP UPRMT 3 μM antimycin A; Cgc
RNAi mot ETC eller mitokondriell ribosoma
CL2070 hsp-16.2p::GFP värmechockrespons 34 °C 2 timmar Cgc
AM446 (PÅ ANDRA) hsp-70p::GFP värmechockrespons 34 °C 2 timmar Morimoto Lab
CL2166 (på andra) gst-4p::GFP Oxsr (oxsr) 50 mM paraquat; Cgc
2 mM tert-butylhydroperoxid
CF1553 sod-3p::GFP OxSR- och insulinsignalering RNAi mot daf-2 (insulinreceptor) Cgc
AU78 (på andra sätt) T24B8.5p::GFP medföt immunsvar patogenexponering (t.ex. P. aeruginosa Cgc

Tabell 3: Transkriptionella reportrar för bedömning av aktivering av cellulära stressreaktioner. De stammar som anges här är alla tillgängliga via CGC eller genom särskilda önskemål till laboratorier för användning i både kvalitativa och kvantitativa bildframställningsmetoder som beskrivs i detta manuskript. Dessa stammar kommer alla från Bristol N2 bakgrund. Rekommenderade metoder för att tillämpa stress för att aktivera reportrar tillhandahålls också. Alla reportrar, med undantag för sod-3p::GFP45 och T24B8.5p::GFP46 beskrivs i texten.

Transgene (transgene) Rekommenderad applicering(er) av stress Exponeringstid med ett Leica M2250FA stereomikroskop Exponeringstid med hjälp av ett Kretse ECHO-mikroskop PMT-värden med hjälp av en Union Biometrica COPAS-biosorter
hsp-4p::GFP 25 μg/mL tunicamycin (~4 timmar med återhämtning över natten) 200 ms 275 ms 450
hsp-6p::GFP 3 μM antimycin A (~16 timmar); 100ms (100ms) 50 ms 350
RNAi mot ETC eller mitokondriell ribosoma (från lucka)
hsp-60p::GFP 3 μM antimycin A (~16 timmar); 200 ms 100 ms 450
RNAi mot ETC eller mitokondriell ribosoma (från lucka)
hsp-16.2p::GFP 34 °C 2 timmar 400 ms 200 ms 500
hsp-70p::GFP 34 °C 2 timmar 400 ms 300 ms 500
gst-4p::GFP 50 mM paraquat (~2 timmar); 100 ms 50 ms 350
2 mM tert-butylhydroperoxid (~ 4 timmar med natten återhämtning)
sod-3p::GFP RNAi mot daf-2 (insulinreceptor) 300 ms 300 ms 475
T24B8.5p::GFP patogenexponering (t.ex. P. aeruginosa 100 ms 50 ms 350

Tabell 4: Rekommenderade inställningar för fluorescerande mikroskopi och kvantifiering med hjälp av en stor partikelbio. Denna tabell fungerar som riktlinje för rekommenderade exponeringstider för fluorescerande mikroskopi eller PMT-värden för de stora partikelbiosorterna. Dessa kommer att fungera som bra utgångspunkter, men exponeringstiden och PMT-värdet bör justeras för varje experiment för att säkerställa att ingen mättnad inträffar och att fluorescerande värden överskrider detektionsgränsen för bakgrundssignal. Om provet med den ljusaste signalen för ett experiment är känt (t.ex. positiva kontroller för stressinduktion) kan dessa prover användas för att bestämma den högsta exponeringstiden eller PMT som kan användas utan mättande signal. Om de ljusaste proverna inte är kända kan kontrollen användas och en exponeringstid eller PMT i mitten av systemets dynamiska omfång kan användas.

Motsvarande siffra Stam, Behandling Median livslängd # Dödsfall / # Totalt % förändring i medianlivslängden p-värde (Log-Rank; Mantel-Cox)
5A (PÅ) N2, vektor RNAi, 1% DMSO 22 dagar 95/120 -- --
N2, xbp-1 RNAi, 1% DMSO 14 dagar 92/120 -36.4 < 0.001
N2, vektor RNAi, 25 ng/μL TM 14 dagar 97/120 -36.4 < 0.001
N2, xbp-1 RNAi, 25 ng/μL TM 12 dagar 98/120 -45.4 < 0.001
5B (5) N2, vektor RNAi, 100 mM PQ 5 timmar 73/73 -- --
N2, daf-2 RNAi, 100 mM PQ 6,5 timmar 74/74 30 < 0.001
5C (5C) N2, vektor RNAi, 37 °C 8 timmar 59/60 -- --
ttx-3(KS5),vektor RNAi, 37 °C 7 timmar 60/60 -12.5 0.002
sur-5p::hsf-1, vektor RNAi, 37 °C 9 timmar 59/60 12.5 0.012

Tabell 5: Statistik för livslängd och stressöverlevnadsanalyser. Alla urvalsstorlekar, statistik och censurpriser för figur 5 finns här.

Stressrespons Mål Gen Framåt Primer Omvänd primer
UPRER hsp-3 TCGCTGGATTGAACGTTGTTCG GTTGCGTTCTCCGTCCTTCTTG
UPRER hsp-4 GAACAACCTACTCGTGCGTTGG GAACAACCTACTCGTGCGTTGG
UPRER sel-11 TTGATCTCCGGAAAACGCAACG TTGATCTCCGGAAAACGCAACG
UPRER ire-1 TCCTCAACCGCTCCATCAACAT TCCTCAACCGCTCCATCAACAT
UPRER xbp-1 GGACTTCTTCGGCTTCTGGAGT GGACTTCTTCGGCTTCTGGAGT
UPRER xbp-1 (skarvad) GGTGGATGGAGGGAGATT GGTGGATGGAGGGAGATT
UPRER crt-1 GAAGTAATAGCCGAGGGAAGC GAAGTAATAGCCGAGGGAAGC
UPRER T14G8.3 CACCTCCATCAACAACAACAT CACCTCCATCAACAACAACAT
Hsr hsp-17 TCGTTTTCCACCATTCTCCA TGTTTGATCGGCCCAGTATGGT
Hsr hsp-70 TGTTTGATCGGCCCAGTATGGT TTCGCAATGAGAGGACGACT
Hsr F44E5.4 TTCGCAATGAGAGGACGACT CGTTGTGCTGCGTCTTCTCTTT
Hsr hsp-16,2 TCCATCTGAGTCTTCTGAGATT
GTTA (PÅ)
TGGTTTAAACTGTGAGACGTTGA
Hsr hsf-1 TTTGCATTTTCTCGTCTCTGTCC TCTATTTCCAGCACACCTCGT
UPRMT hsp-6 GAGATCGTGGAACCGGAAAGGA CGGCATTCTTTTCGGCTTCCTT
UPRMT hsp-60 CGGCATTCTTTTCGGCTTCCTT CGTCGTTGCAGAGCTCAAGAAG
UPRMT ymel-1 CAAAACCTGATCTCGCTGGG TTCTCAATGTCGGCTCCAGT
UPRMT clpp-1 TGATAAGTGCACCAGTGTCCA TGATTCTGGAGTTCGGGAGA
UPRMT lonp-1 CGATGATGGCCATTGTGCAG CGCTTTGAAACATCAATTTCAT
Cca
Oxsr (oxsr) gst-4 GATGCTCGTGCTCTTGCTG CCGAATTGTTCTCCATCGAC
Oxsr (oxsr) gst-6 CCGAATTGTTCTCCATCGAC TTTGGCAGTTGTTGAGGAG
Oxsr (oxsr) gst-7 TTTGGCAGTTGTTGAGGAG TGGGTAATCTGGACGGTTTG
Oxsr (oxsr) gcs-1 TGGGTAATCTGGACGGTTTG ATGTTTGCCTCGACAATGTT
Oxsr (oxsr) skn-1 GGACAACAGAATCCCAAAGG TCAGGACGTCAACAGCAGAC
Oxsr (oxsr) sod-3 GTAACGGGCGATAGCATGAG GCGAGAGCACATTGATGAC
Oxsr (oxsr) ptps-1 AATCGATTCCTTTGGAGACC CAATCTACTGCTCGCACTGCTT
CAAAGC
Referens pmp-3 TGGCCGGATGATGGTGTCGC ACGAACAATGCCAAAGGCCAGC
Referens Y45F10,4 CGAGAACCCGCGAAATGTCGGA CGGTTGCCAGGGAAGATGAGGC
Referens sap-49 TGGCGGATCGTCGTGCTTCC ACGAGTCTCCTCGTTCGTCCCA
Referens tba-1 TCAACACTGCCATCGCCGCC TCCAAGCGAGACCAGGCTTCAG

Tabell 6: Rekommenderade genmål och primerpar för mätning av transkriptionsuppreglering av stressresponsgener.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Här beskrivs metoder för att förhöra cellulära stressreaktioner i C. elegans– med hjälp av fluorescerande transkriptionsreportrar och fysiologiska stressöverlevnadsanalyser. Reportrarna använder alla GFP uttryck drivs under initiativtagare till en nedströms transkriptionella mål för transkription faktorer som är inblandade i montering cellulära stressreaktioner. Användningen av hsp-4p::GFP moduleras av XBP-1s-medierad UPRER, hsp-6p::GFP kontrolleras av ATFS-1-medierad UPRMT, gst-4p::GFP under SKN-1-medierad OxSR, och hsp16.2p::GFP och hsp-70p::GFP under HSF-1-medierad värmechock svar förklaras. Andra standardiserade avskriftsreportrar finns i tabell 3. Alla transkriptionella reportrar som presenteras här har ett brett dynamiskt omfång och kan aktiveras på ett kraftfullt sätt genom att tillämpa stress antingen genom genetiska störningar eller exponering för stressframkallande kemikalier. Dessutom kan dessa reportrar alla undertryckas genom knockdown av transkription faktorer uppströms de anställda initiativtagarna. Slutligen är varje transkriptionsreporter ihopkopplad med en specifik fysiologisk stressöverlevnadsanalys för att ge en fysiologisk avläsning av effekterna av att antingen aktivera eller undertrycka en specifik stressreaktion.

För att framgångsrikt använda transkriptionella reportrar, är det viktigt att bestämma det dynamiska omfånget för varje reporter. På grund av större lab-till-lab variabilitet som orsakas av skillnader i media, agar, omgivande miljö, etc., Det rekommenderas att titrera varje läkemedel eller stress induktion paradigm för koncentrationer och timing med hjälp av våra rekommendationer som baslinje. Därefter är det viktigt att se till att djuren är friska och korrekt synkroniserade. Djur som har upplevt någon form av stress (t.ex. svält, långvarig exponering för ljus, exponering för förhöjd temperatur, etc.) bör återvinnas i flera generationer före experiment. Korrekt synkronisering kan uppnås med hjälp av de metoder som beskrivs i avsnitt 2, vilket är viktigt eftersom flera stressreaktioner har olika aktiveringsnivåer under åldrandeprocessen. Slutligen är bildhanteringsprotokoll viktiga för att standardisera, eftersom det finns olika saker som kan påverka bild- och datakvaliteten. Till exempel bör varaktigheten av djur i natriumazid minimeras, eftersom detta orsakar stress för djur och kan påverka reportersignalen. Dessutom bör specifikationerna för mikroskop och biosorter ställas in på rätt sätt för att maximera signal-brusförhållandet och det dynamiska omfånget, utan att orsaka mättnad. Mättade pixlar kan orsaka stora problem vid kvantitativ analys av prover, eftersom maximal fluorescerande signal kan underskattas kraftigt.

Medan de transkriptionella reportrar som beskrivs här ger ett robust och effektivt sätt att mäta aktivering av stressreaktioner, är det viktigt att förstå att det är ett enda genmål för en känd transkriptionsfaktor. Därför, medan det fungerar som en tillförlitlig metod för storskaliga skärmar eller första passage tester av stammar av intresse, bör korrekt valideringar utföras. Vi rekommenderar att du utför qPCR för att mäta flera kanoniska målgener som aktiveras vid induktion av varje stressrespons som analyseras. En förteckning över föreslagna genmål finns i tabell 6. Dessutom är transkriptomprofilering genom RNA-seq ett annat alternativ för en bredare titt på effekter på flera transkriptionella mål på en gång. Av särskilt notera, bildbehandling av fluorescerande reportrar ger rumslig information om vävnader som påverkas av störningar. Sådan information kan inte erhållas från qRT-PCR eller RNA-seq, eftersom den använder hela maskextrakt, utom genom scRNA-seq, FISH och vävnadsspecifika RNAseq-protokoll47. Slutligen, dessa stress reportrar kännetecknas i allmänhet som specifika för deras stressrespons maskiner. Det är dock viktigt att komma ihåg att inte allastred svar paradigm är unika och distinkta. Till exempel kan ER stress aktivera OxSR och vice versa48, och överlappningar mellan värme-chock svar och ER stressreaktioner har varit vanligtförekommande 49. Detta är bara några av de många exempel i litteraturen om korskommunikation och överlappning mellan stressreaktioner, och därför är det viktigt att förstå att alla analyser också bör testas för specificitet att härleda slutliga slutsatser.

En annan begränsning av de beskrivna metoderna är att avbildning och kvantifiering genom ett biosorter har begränsad genomströmning. Medan biosorter kvantifiering kan utföras i 96-brunnsplattor för högre genomströmning, är det fortfarande begränsat av behovet av att överföra maskar till lösning, medan bildbehandling begränsas av prövarens förmåga att förbereda maskar och utföra mikroskopi. Därför kommer storskaliga skärmar sannolikt innebär endast en visuell screening av fluorescerande reporter signal, med endast träffar som avbildas och kvantifieras.

En viktig varning med att använda dessa fluorescerande reportrar är att aktivering eller undertryckande av stressreaktioner inte alltid bidrar till fysiologiskt meningsfulla fenotyper, eller kan återspegla andra globala effekter (t.ex. minskning av proteinsyntesen). Därför är varje transkriptionsreporter ihopkopplad med en metod för att analysera stressöverlevnad. Det rekommenderas att utföra tunicamycin överlevnadsanalyser för UPRER,parakvat överlevnadsanalyser för UPRMT och OxSR, och överlevnad i förhöjda temperaturer för värmechocksresponsen. Medan dessa är i allmänhet robusta, snabba och enkla analyser, de kräver intensiv manuellt arbete, och därmed är kraftigt begränsade i skalbarhet. Dessutom har nästan alla termotolerance-analyser som hittills publicerats stora variationer, vilket gör ett stort antal replikat nästan nödvändiga21. Medan tunicamycin och parakvat överlevnad analyser inte lider av denna brist på reproducerbarhet, de har sina egna utmaningar, inklusive omfattande praktisk arbetskraft och varaktighet av protokollet. Eftersom ny teknik föds i att automatisera livslängd och överlevnad analyser, är det troligt att dessa stress överlevnad analyser kan också bli hög genomströmning50. Men tills dessa automatiserade analyser blir standard, överlevnad analyser är för närvarande begränsade till validering av fysiologiska konsekvenser i att förändra dynamiken i stressrespons aktivitet.

Utöver de stressöverlevnadsanalyser som beskrivs här finns det ett antal andra metoder för att mäta fysiologi hos djur. Till exempel kan en kommersiellt tillgänglig Seahorse XFp Analyzer tillåta övervakning av cellulär andning, vilket ger ytterligare mekanistisk insikt51. Ett annat alternativ till transkriptionsreportrar är användningen av kärnlokalisering av fluorescerande märkta transkriptionsfaktorer. Det finns många varianter av denna teknik, men av särskilt intresse för de metoder som beskrivs här inkluderar: HSF-1::GFP för värme-chock svar52, DVE-1::GFP för UPRMT53, och DAF-16::GFP och SKN-1::GFP för OxSR54,55. Slutligen kan direkt förhör av morfologi av specifika organeller av intresse utföras. Till exempel kan mitokondriell morfologi visualiseras genom att använda en fluorofore som är inriktad på mitokondriell matris med hjälp av en mitokondriell lokalisering sekvens56. ER morfologi kan visualiseras genom att använda en fluorofore riktade till ER genom en signal-sekvens smält till N-ändstation och HDEL smält till C-ändstation57 eller GFP smält till en ER membran protein58. Slutligen, actin cytoskeletal integritet kan användas som en proxy för termisk stress känslighet nedströms HSF-1. Den aktin cytoskelettet regleras av transkriptionella mål för HSF-1, särskilt under åldrande och värme-stress, och därmed actin organisation kan visualiseras för att bestämma funktionell avläsning av HSF-1 och värme-relaterad stress59,60.

Alla de metoder som beskrivs här kan användas självständigt eller i kombination med varandra för en omfattande analys av gener eller läkemedel av intresse och deras inverkan på stressrespons. Storskaliga skärmar kan utföras med hög genomströmning transkriptionella reporter analyser, och sekundära skärmar kan utföras med kvantitativa analyser av dessa reportrar. När mer hanterbara kandidat gen / läkemedelslistor identifieras, fysiologiska analyser kan utföras för att identifiera de kandidater som har direkt inverkan på hela djurfysiologi. De andra metoder som föreslås ovan kan också användas som validering eller vidare undersökning.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna har inget att avslöja.

Acknowledgments

R.BZ. stöds av EMBO:s långsiktiga stipendium och Larry L. Hillbloms stiftelse. R.H.S stöds av bidrag 5F32AG032023-02 genom National Institute of Aging (NIA) och Glenn Foundation for Medical Research Postdoc Fellowship. A.F. stöds genom bidrag F32AG0513555 genom NIA. H.K.G. stöds av grant DGE1752814 genom National Science Foundation Graduate Research Fellowship Program. M.G.M. stöds av 1F31AG060660-01 genom NIA. AD stöds av Thomas och Stacey Siebel Foundation, Howard Hughes Medical Institute, och 4R01AG042679-04 och 5R01AG055891-02 från NIA, och 5R01ES021667-09 från NIEHS. Vi tackar Larry Joe, Melissa Sanchez, Naame Kelet och Anel Esquivel för betydande tekniskt stöd. Vi tackar Morimoto labbet och CGC (finansieras av NIH Office of Research Infrastructure Program P40 OD010440) för stammar.

Materials

Name Company Catalog Number Comments
Antimycin A Sigma-Aldrich A8674 for mitochondrial stress
Bacto Peptone Fisher Scientific DF0118072 for NGM plates
BD Difco granulated agar VWR 90000-782 for NGM plates
Calcium chloride dihydrate VWR 97061-904 for NGM plates
Carbenicillin BioPioneer C0051-25 for RNAi
Cholesterol Sigma-Aldrich 57-88-5 for NGM plates
COPAS Biosorter Union Biometrica 350-5000-000 equipped with a 488 nm light source.
COPAS Cleaning Solution Union Biometrica 300-5072-000 to use with COPAS
COPAS Sheath Solution Union Biometrica 300-5070-100 to use with COPAS
DMSO Sigma-Aldrich 472301 solvent for drugs
IPTG dioxane free Denville Scientific CI8280-4 for RNAi
LB Broth Miller Fisher Scientific BP1426500 for LB
M205FA stereoscope Leica 10450040 equipped with a Leica DFC3000G monochromatic CCD camera, standard Leica GFP filter (ex 395-455, EM 480 LP), and LAS X software
Magnesium sulfate heptahydrate VWR EM-MX0070-3 for NGM plates, M9
Paraquat Sigma-Aldrich 36541 for oxidative/mitochondrial stress
Potassium Chloride Fisher P217-500 for bleach soluton
Potassium phosphate dibasic VWR EM-PX1570-2 for NGM plates
Potassium phosphate monobasic VWR EM-PX1565-5 for M9
Revolve ECHO 75990-514 equipped with an Olympus 4x Plan Fluorite NA 0.13 objective lens, standard Olympus FITC filter (ex 470/40; em 525/50; DM 560), and an iPad Pro for camera and to drive ECHO software
Sodium Azide Sigma-Aldrich 71289-50G for imaging
Sodium Chloride EMD Millipore SX0420-5 for NGM plates, M9
Sodium phosphate dibasic VWR 71003-472 for M9
Tert-butyl hydroperoxide Sigma-Aldrich 458139 for oxidative stress
Tetracycline hydrochloride Sigma-Aldrich T7660-5G for RNAi
Tunicamycin Sigma-Aldrich T7765-50MG for ER stress

DOWNLOAD MATERIALS LIST

References

  1. Higuchi-Sanabria, R., Frankino, P. A., Paul, J. W., Tronnes, S. U., Dillin, A. A Futile Battle? Protein Quality Control and the Stress of Aging. Developmental Cell. 44, (2), 139-163 (2018).
  2. Brenner, S. The genetics of Caenorhabditis elegans. Genetics. 77, (1), 71-94 (1974).
  3. Rual, J. F., et al. Toward improving Caenorhabditis elegans phenome mapping with an ORFeome-based RNAi library. Genome Research. 14, (10B), 2162-2168 (2004).
  4. Timmons, L., Court, D. L., Fire, A. Ingestion of bacterially expressed dsRNAs can produce specific and potent genetic interference in Caenorhabditis elegans. Gene. 263, (1-2), 103-112 (2001).
  5. Reinke, S. N., Hu, X., Sykes, B. D., Lemire, B. D. Caenorhabditis elegans diet significantly affects metabolic profile, mitochondrial DNA levels, lifespan and brood size. Molecular Genetics and Metabolism. 100, (3), 274-282 (2010).
  6. Revtovich, A. V., Lee, R., Kirienko, N. V. Interplay between mitochondria and diet mediates pathogen and stress resistance in Caenorhabditis elegans. PLOS Genetics. 15, (3), e1008011 (2019).
  7. Calfon, M., et al. IRE1 couples endoplasmic reticulum load to secretory capacity by processing the XBP-1 mRNA. Nature. 415, (6867), 92-96 (2002).
  8. Yoneda, T., Benedetti, C., Urano, F., Clark, S. G., Harding, H. P., Ron, D. Compartment-specific perturbation of protein handling activates genes encoding mitochondrial chaperones. Journal of Cell Science. 117, (Pt 18), 4055-4066 (2004).
  9. Link, C. D., Cypser, J. R., Johnson, C. J., Johnson, T. E. Direct observation of stress response in Caenorhabditis elegans using a reporter transgene. Cell Stress & Chaperones. 4, (4), 235-242 (1999).
  10. Heifetz, A., Keenan, R. W., Elbein, A. D. Mechanism of action of tunicamycin on the UDP-GlcNAc:dolichyl-phosphate Glc-NAc-1-phosphate transferase. Biochemistry. 18, (11), 2186-2192 (1979).
  11. Struwe, W. B., Hughes, B. L., Osborn, D. W., Boudreau, E. D., Shaw, K. M. D., Warren, C. E. Modeling a congenital disorder of glycosylation type I in C. elegans: a genome-wide RNAi screen for N-glycosylation-dependent loci. Glycobiology. 19, (12), 1554-1562 (2009).
  12. Taylor, R. C., Dillin, A. XBP-1 is a cell-nonautonomous regulator of stress resistance and longevity. Cell. 153, (7), 1435-1447 (2013).
  13. Castello, P. R., Drechsel, D. A., Patel, M. Mitochondria are a major source of paraquat-induced reactive oxygen species production in the brain. The Journal of Biological Chemistry. 282, (19), 14186-14193 (2007).
  14. Oberley, L. W., Buettner, G. R. Role of Superoxide Dismutase in Cancer: A Review. Cancer Research. 39, (4), 1141-1149 (1979).
  15. Senchuk, M. M., Dues, D. J., Van Raamsdonk, J. M. Measuring Oxidative Stress in Caenorhabditis elegans: Paraquat and Juglone Sensitivity Assays. Bio-protocol. 7, (1), (2017).
  16. Lithgow, G. J., White, T. M., Hinerfeld, D. A., Johnson, T. E. Thermotolerance of a long-lived mutant of Caenorhabditis elegans. Journal of Gerontology. 49, (6), B270-B276 (1994).
  17. Labbadia, J., Morimoto, R. I. The Biology of Proteostasis in Aging and Disease. Annual Review of Biochemistry. 84, (1), 435-464 (2015).
  18. Park, H. E. H., Jung, Y., Lee, S. J. V. Survival assays using Caenorhabditis elegans. Molecules and Cells. 40, (2), 90-99 (2017).
  19. Waggoner, L. E., Hardaker, L. A., Golik, S., Schafer, W. R. Effect of a Neuropeptide Gene on Behavioral States in Caenorhabditis elegans Egg-Laying. Genetics. 154, (3), 1181-1192 (2000).
  20. Durieux, J., Wolff, S., Dillin, A. The cell-non-autonomous nature of electron transport chain-mediated longevity. Cell. 144, (1), 79-91 (2011).
  21. Zevian, S. C., Yanowitz, J. L. Methodological Considerations for Heat Shock of the Nematode Caenorhabditis elegans. Methods (San Diego, Calif). 68, (3), 450-457 (2014).
  22. Shen, X., Ellis, R. E., Sakaki, K., Kaufman, R. J. Genetic interactions due to constitutive and inducible gene regulation mediated by the unfolded protein response in C. elegans. PLoS genetics. 1, (3), e37 (2005).
  23. Frakes, A. E., Dillin, A. The UPR(ER): Sensor and Coordinator of Organismal Homeostasis. Molecular Cell. 66, (6), 761-771 (2017).
  24. Martinus, R. D., et al. Selective induction of mitochondrial chaperones in response to loss of the mitochondrial genome. European Journal of Biochemistry. 240, (1), 98-103 (1996).
  25. Nargund, A. M., Pellegrino, M. W., Fiorese, C. J., Baker, B. M., Haynes, C. M. Mitochondrial import efficiency of ATFS-1 regulates mitochondrial UPR activation. Science (New York, N.Y). 337, (6094), 587-590 (2012).
  26. Baker, B. M., Haynes, C. M. Mitochondrial protein quality control during biogenesis and aging. Trends in Biochemical Sciences. 36, (5), 254-261 (2011).
  27. Shore, D. E., Carr, C. E., Ruvkun, G. Induction of Cytoprotective Pathways Is Central to the Extension of Lifespan Conferred by Multiple Longevity Pathways. PLOS Genetics. 8, (7), e1002792 (2012).
  28. Houtkooper, R. H., et al. Mitonuclear protein imbalance as a conserved longevity mechanism. Nature. 497, (7450), 451-457 (2013).
  29. Chiang, S. M., Schellhorn, H. E. Regulators of oxidative stress response genes in Escherichia coli and their functional conservation in bacteria. Archives of Biochemistry and Biophysics. 525, (2), 161-169 (2012).
  30. Blackwell, T. K., Steinbaugh, M. J., Hourihan, J. M., Ewald, C. Y., Isik, M. SKN-1/Nrf, stress responses, and aging in Caenorhabditis elegans. Free Radical Biology & Medicine. 88, (Pt B), 290-301 (2015).
  31. Nguyen, T., Nioi, P., Pickett, C. B. The Nrf2-antioxidant response element signaling pathway and its activation by oxidative stress. The Journal of Biological Chemistry. 284, (20), 13291-13295 (2009).
  32. Lo, J. Y., Spatola, B. N., Curran, S. P. WDR23 regulates NRF2 independently of KEAP1. PLOS Genetics. 13, (4), e1006762 (2017).
  33. Link, C., Johnson, C. Reporter Transgenes for Study of Oxidant Stress in Caenorhabditis elegans. Methods in enzymology. 353, 497-505 (2002).
  34. Choe, K. P., Przybysz, A. J., Strange, K. The WD40 Repeat Protein WDR-23 Functions with the CUL4/DDB1 Ubiquitin Ligase To Regulate Nuclear Abundance and Activity of SKN-1 in Caenorhabditis elegans. Molecular and Cellular Biology. 29, (10), 2704-2715 (2009).
  35. Velazquez, J. M., Lindquist, S. hsp70: nuclear concentration during environmental stress and cytoplasmic storage during recovery. Cell. 36, (3), 655-662 (1984).
  36. Tissières, A., Mitchell, H. K., Tracy, U. M. Protein synthesis in salivary glands of Drosophila melanogaster: relation to chromosome puffs. Journal of Molecular Biology. 84, (3), 389-398 (1974).
  37. Gomez-Pastor, R., Burchfiel, E. T., Thiele, D. J. Regulation of heat shock transcription factors and their roles in physiology and disease. Nature Reviews Molecular Cell Biology. (2017).
  38. Guisbert, E., Czyz, D. M., Richter, K., McMullen, P. D., Morimoto, R. I. Identification of a tissue-selective heat shock response regulatory network. PLoS genetics. 9, (4), e1003466 (2013).
  39. Hentze, N., Le Breton, L., Wiesner, J., Kempf, G., Mayer, M. P. Molecular mechanism of thermosensory function of human heat shock transcription factor Hsf1. eLife. 5, (2016).
  40. Li, J., Labbadia, J., Morimoto, R. I. Rethinking HSF1 in Stress, Development, and Organismal Health. Trends in Cell Biology. (2017).
  41. Morley, J. F., Morimoto, R. I. Regulation of longevity in Caenorhabditis elegans by heat shock factor and molecular chaperones. Molecular Biology of the Cell. 15, (2), 657-664 (2004).
  42. Senchuk, M. M., et al. Activation of DAF-16/FOXO by reactive oxygen species contributes to longevity in long-lived mitochondrial mutants in Caenorhabditis elegans. PLoS Genetics. 14, (3), (2018).
  43. Henderson, S. T., Bonafè, M., Johnson, T. E. daf-16 protects the nematode Caenorhabditis elegans during food deprivation. The Journals of Gerontology. Series A, Biological Sciences and Medical Sciences. 61, (5), 444-460 (2006).
  44. Prahlad, V., Cornelius, T., Morimoto, R. I. Regulation of the Cellular Heat Shock Response in Caenorhabditis elegans by Thermosensory Neurons. Science. 320, (5877), 811-814 (2008).
  45. Libina, N., Berman, J. R., Kenyon, C. Tissue-specific activities of C. elegans DAF-16 in the regulation of lifespan. Cell. 115, (4), 489-502 (2003).
  46. Shivers, R. P., Kooistra, T., Chu, S. W., Pagano, D. J., Kim, D. H. Tissue-specific activities of an immune signaling module regulate physiological responses to pathogenic and nutritional bacteria in C. elegans. Cell Host & Microbe. 6, (4), 321-330 (2009).
  47. Kaletsky, R., et al. Transcriptome analysis of adult Caenorhabditis elegans cells reveals tissue-specific gene and isoform expression. PLoS Genetics. 14, (8), (2018).
  48. Glover-Cutter, K. M., Lin, S., Blackwell, T. K. Integration of the Unfolded Protein and Oxidative Stress Responses through SKN-1/Nrf. PLOS Genetics. 9, (9), e1003701 (2013).
  49. Liu, Y., Chang, A. Heat shock response relieves ER stress. The EMBO journal. 27, (7), 1049-1059 (2008).
  50. Stroustrup, N., Ulmschneider, B. E., Nash, Z. M., López-Moyado, I. F., Apfeld, J., Fontana, W. The Caenorhabditis elegans Lifespan Machine. Nature Methods. 10, (7), 665-670 (2013).
  51. Leung, D. T. H., Chu, S. Measurement of Oxidative Stress: Mitochondrial Function Using the Seahorse System. Methods in molecular biology (Clifton, N.J). 1710, 285-293 (2018).
  52. Morton, E. A., Lamitina, T. Caenorhabditis elegans HSF-1 is an essential nuclear protein that forms stress granule-like structures following heat shock. Aging Cell. 12, (1), 112-120 (2013).
  53. Haynes, C. M., Petrova, K., Benedetti, C., Yang, Y., Ron, D. ClpP mediates activation of a mitochondrial unfolded protein response in C. elegans. Developmental Cell. 13, (4), 467-480 (2007).
  54. Kwon, E. S., Narasimhan, S. D., Yen, K., Tissenbaum, H. A. A new DAF-16 isoform regulates longevity. Nature. 466, (7305), 498-502 (2010).
  55. An, J. H., et al. Regulation of the Caenorhabditis elegans oxidative stress defense protein SKN-1 by glycogen synthase kinase-3. Proceedings of the National Academy of Sciences of the United States of America. 102, (45), 16275-16280 (2005).
  56. Daniele, J. R., Esping, D. J., Garcia, G., Parsons, L. S., Arriaga, E. A., Dillin, A. High-Throughput Characterization of Region-Specific Mitochondrial Function and Morphology. Scientific Reports. 7, (1), 6749 (2017).
  57. Daniele, J. R., et al. A non-canonical arm of UPRER mediates longevity through ER remodeling and lipophagy. bioRxiv. 471177 (2018).
  58. Xu, N., et al. The FATP1-DGAT2 complex facilitates lipid droplet expansion at the ER-lipid droplet interface. The Journal of Cell Biology. 198, (5), 895-911 (2012).
  59. Baird, N. A., et al. HSF-1-mediated cytoskeletal integrity determines thermotolerance and life span. Science (New York, N.Y.). 346, (6207), 360-363 (2014).
  60. Higuchi-Sanabria, R., et al. Spatial regulation of the actin cytoskeleton by HSF-1 during aging. Molecular Biology of the Cell. 29, (21), 2522-2527 (2018).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics