ميثليته الحمض النووي مناعي

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

هذا الفيديو يدل على بروتوكول للمناعي ميثليته الحمض النووي (MeDIP). MeDIP هو الإجراء الذي يستخرج يومين انتقائي شظايا من الحمض النووي ميثليته من عينة الحمض النووي الجيني باستخدام الأجسام المضادة مع خصوصية لmethylcytosine - 5 (MC - 5 المضادة).

Cite this Article

Copy Citation | Download Citations

Thu, K. L., Vucic, E. A., Kennett, J. Y., Heryet, C., Brown, C. J., Lam, W. L., Wilson, I. M. Methylated DNA Immunoprecipitation. J. Vis. Exp. (23), e935, doi:10.3791/935 (2009).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

تحديد أنماط الحامض النووي هو اجراء شائع في دراسة علم التخلق ، كما هو معروف مثيلة لها آثار كبيرة على التعبير الجيني ، وتشارك مع التطور الطبيعي فضلا عن الأمراض

Protocol

استخراج الحمض النووي وإعداد العينات

ويمكن استخدام الحمض النووي من مجموعة متنوعة من عينات مختلفة (الخلايا المستزرعة ، طازجة مجمدة وكذلك الأنسجة البارافين الفورمالين ثابت مضمن) لMeDIP. من المهم استخدام الحمض النووي عالي النقاء بدون البروتينات المرتبطة بها مثل histones. من المهم أيضا لإزالة RNA أكبر قدر ممكن من العينة ، كما يمكن أن تتداخل مع الكميات الحمض النووي على حد سواء وملزمة الأضداد. يمكن لكمية من الحمض النووي المستخدمة لMeDIP مجموعة من 200 نانوغرام إلى 1 ميكروغرام اعتمادا على كمية من الحمض النووي المتاحة. لإثبات هذا البروتوكول ، سيتم استخدام 1 ميكروغرام من الحمض النووي. وبروتوكول التالية توفر جودة عالية الحمض النووي المزدوج تقطعت بهم السبل من الخلايا المستنبتة. وينبغي استخدام بروتوكولات أخرى لاستخراج الحمض النووي من عينة أنواع أخرى.

  1. إضافة 400 ميكرولتر من العازلة الهضم لبيليه الخلية في أنبوب 1.7 مل إيبندورف.
  2. إضافة 100 ميكروغرام من بروتين كاف للأنبوب ، واحتضان بين عشية وضحاها في 50 درجة مئوية.
  3. إضافة 500 درجة الحموضة الفينول ميكرولتر (7) ومزيج دقيق من قبل ولكن بلطف قلب.
  4. تدور 000 ز 13 لمدة 10 دقيقة في درجة حرارة الغرفة.
  5. إزالة مائي (العلوي) لكسر أنبوب جديد.
  6. كرر الخطوات من 3 إلى 5 مرة واحدة.
  7. إضافة 500 ميكرولتر 01:01 الحموضة الفينول / 7 و كلوروفورم مزيج دقيق من قبل ولكن بلطف قلب.
  8. تدور 000 ز 13 لمدة 10 دقيقة في درجة حرارة الغرفة.
  9. إزالة مائي (العلوي) لكسر أنبوب جديد.
  10. إضافة 40 ألف ميكروغرام من ريبونوكلياز واحتضان 1 ساعة عند 37 درجة مئوية.
  11. إضافة 500 درجة الحموضة الفينول ميكرولتر (7) ومزيج دقيق من قبل ولكن بلطف قلب.
  12. تدور 000 ز 13 لمدة 10 دقيقة في درجة حرارة الغرفة.
  13. إزالة مائي (العلوي) لكسر أنبوب جديد.
  14. كرر الخطوات من 11 إلى 13 مرة.
  15. إضافة 500 ميكرولتر 01:01 الحموضة الفينول / 7 و كلوروفورم مزيج دقيق من قبل ولكن بلطف قلب.
  16. تدور 000 ز 13 لمدة 10 دقيقة في درجة حرارة الغرفة.
  17. إزالة مائي (العلوي) لكسر أنبوب جديد.
  18. إضافة حجم 1/10th 3 خلات الصوديوم M (40 ميكرولتر) وتخلط جيدا.
  19. إضافة 2 مجلدات (900 ميكرولتر) من الإيثانول بنسبة 100 ٪ ، ومزيج جيد ، ومكان عقد الاجتماع -20 درجة مئوية لمدة 20 دقيقة.
  20. تدور 000 ز 13 لمدة 20 دقيقة على 4 درجات مئوية.
  21. إزالة الإيثانول ، وتدور النبض ، وإزالة الايثانول المتبقية.
  22. إضافة 500 ميكرولتر الباردة الإيثانول 70 ٪ لغسل. تدور 000 ز 13 لمدة 20 دقيقة على 4 درجات مئوية.
  23. إزالة 70 ٪ من الإيثانول ، وتدور النبض ، وإزالة المتبقية عن طريق pipetting الايثانول.
  24. الهواء الجاف وبيليه مع سقف مفتوح لمدة 10 دقيقة في درجة حرارة الغرفة لإزالة كل أثر من الايثانول المتبقية.
  25. Resuspend الحمض النووي في 50 ميكرولتر من dH2O تعقيمها بين عشية وضحاها في 4 درجات مئوية.
  26. قياس الحمض النووي باستخدام الطيف NanoDrop. وهناك 260 : 280 ألف نسبة 1.8 مثالية.
  27. تحديد نوعية ومدى حجم الحمض النووي على agarose هلام سلم مع غليان 100. يمكن تشغيل ما لا يزيد عن 10 نانوغرام من الحمض النووي الجيني على agarose هلام 1.7 ٪ تليها التلوين باستخدام الصبغة التي تعتبر حساسة للغاية لكميات صغيرة من الحمض النووي مثل الذهب SYBR.
  28. في أنبوب واحد siliconized لكل عينة ، وإعداد 1 ميكروغرام من الحمض النووي في وحدة تخزين ما مجموعه 50 ميكرولتر مع ما تبقى من وحدة تخزين تتكون مع تعقيمها O. 2 درهم

الحمض النووي صوتنة

يجب إجراء الحمض النووي والبروتوكول صوتنة MeDIP في أنابيب siliconzied لمنع غير ملزم للبروتينات محددة على الجدران أنبوب. وتستند مرات صوتنة الأمثل لعينات من الحمض النووي على درجة من التشرذم عينة من الحمض النووي وتحديد من هلام إستشراد (الخطوة 27). على سبيل المثال ، ينبغي أن الحمض النووي المستخرج من الخلايا المستزرعة تكون ذات وزن جزيئي عال جدا ، وبعد ذلك سوف يتطلب المزيد من الحمض النووي المستخرج صوتنة عينات من المحفوظات التي غالبا ما تكون متدهورة جزئيا. إذا هي عينات من الوزن الجزيئي عالية بشكل موحد ، فمن المعقول في هذه المرحلة على المضي قدما في صوتنة على النحو المبين في هذا البروتوكول من دون التحقق من كل عينة على حدة. إذا كانت مجزأة العينات كما هو الحال مع عينات الأرشيفية ، وسوف يكون من الضروري التكيف مع هذا الإجراء المحتمل من خلال خفض صوتنة صوتنة مرات للحصول على 300 100bp شظايا. إذا كنت تتوقع لمعالجة العينات التي تدهورت جزئيا ، والتحسين من المعلمات صوتنة لا يمكن أن يؤديها على عينة تمثيلية من تلك المصالح. استنادا إلى درجة تجزئة الحمض النووي لوحظ من هلام إستشراد (الخطوة 27) ، ويمكن للمجرب مسبقا صوتنة الوقت الأمثل لعينة. نحن هنا وصف طريقة الحصول على شظايا من الحمض النووي 300-1000 الغليان التي صوتنة مع الجهاز الآلي sonicating (Bioruptor من Diagenode ، UCD - 200 TM) باستخدام الحمض النووي عالية الوزن الجزيئي.

  1. يجب أن تكون المياه في Biorupter في 4 درجات مئوية.
  2. يصوتن لمدة 7 دقائق على الإعدادات التلقائية (30 ثانية و 30 ثانية على الخروج على السلطة كحد أقصى).
  3. إزالة 800 نانوغرام (40 ميكرولتر) من الناتج sonicated ومكان في siliconized 1.7 مل أنبوب الطرد المركزي للمناعي (IP) رد فعل.
  4. جانبا المتبقية 200 نانوغرام (10 ميكرولتر) لتكون بمثابة مدخلات (IN) الحمض النووي المرجعية (مخزن في 4 درجات مئوية).

    IMMUNOPRECIPITATON من الحمض النووي ميثليته

    1. تفسد الحمض النووي الذي سيتم استخدامه للرد الملكية الفكرية (800 نانوغرام) في 95 درجة مئوية لمدة 10 دقيقة في حمام ماء.
    2. بارد فورا على الجليد. اسمحوا تبرد تماما الحمض النووي (حوالي 5 دقائق على الجليد) قبل الشروع في الخطوة التالية.
    3. إضافة 5 الأضداد وحيدة النسيلة ميكروغرام.
    4. إضافة العازلة للملكية الفكرية (التي تستخدم في درجة حرارة الغرفة طوال هذا البروتوكول) إلى الحجم النهائي من 500 ميكرولتر.
    5. احتضان لمدة 2 ساعة في 4 درجات مئوية في الدورية حامل الأنبوب.
    6. فقط قبل اكتمال الخطوة 5 ، وإعداد Dynabeads بواسطة الغسيل (خطوات 6-11). أولا ، resuspend حبات جيدا في القارورة التي vortexing.
    7. نقل 30 ميكرولتر (~ 2 × 10 7) من Dynabeads معلق في رد فعل زائد 1 ، في أنبوب siliconized جديد (على سبيل المثال ، إذا فعل 8 ردود الفعل ، وإزالة ما يكفي لمدة 9 الخرز ، أي 270 ميكرولتر).
    8. وضع أنبوب على الرف لمدة 2 دقيقة المغناطيسي في درجة حرارة الغرفة.
    9. ماصة قبالة طاف. عند إزالة طاف ، وتجنب لمس ضد الجدار داخل الخرز (حيث حبات جذب المغناطيس ل) مع الطرف ماصة.
    10. إزالة أنبوب من المغناطيس ، وresuspend حبات في حجم فائض العازلة للملكية الفكرية (750 ميكرولتر - 1000 ميكرولتر). وضع أنبوب مرة أخرى على الرف لمدة 2 دقيقة المغناطيسي في درجة حرارة الغرفة.
    11. تكرار غسل مرة أخرى ، ثم تغسل حبات resuspend العازلة في مجال الملكية الفكرية في حجم الأصلي إزالتها في الخطوة 7.
    12. إضافة 30 ميكرولتر Dynabeads غسلها من رد الفعل على كل IP
    13. احتضان في حامل أنبوب بالتناوب لمدة 2 ساعة في 4 درجات مئوية.
    14. بعد حضانة اكتمال وضع أنبوب على الرف لمدة 2 دقيقة المغناطيسي في درجة حرارة الغرفة.
    15. ماصة قبالة طاف. تجنب لمس الجدار الداخلي للأنبوب (حيث حبات جذب المغناطيس ل) مع الطرف ماصة. إضافة 500 ميكرولتر من العازلة للملكية الفكرية. خلط محتويات الأنابيب ووضعها على الرف لمدة 2 دقيقة المغناطيسي. تكرار غسل مع 500 العازلة IP المجاهدين وقت واحد.
    16. بعد إزالة طاف من غسل الماضي ، resuspend الخرز في 400 ميكرولتر من العازلة الهضم.
    17. علاج التفاعل مع 100 ميكروغرام من K بروتين واحتضان بين عشية وضحاها في 50 درجة مئوية.

    تنقية الحمض النووي IMMUNOPRECIPITATED

    1. إضافة 500 ميكرولتر 01:01 الحموضة الفينول / 7 و كلوروفورم دوامة بدقة.
    2. تدور 000 ز 13 لمدة 10 دقيقة في درجة حرارة الغرفة.
    3. إزالة مائي (العلوي) لكسر أنبوب جديد.
    4. كرر الخطوات من 1 إلى 3 إذا كان الطور البيني بين الطبقات المائية والعضوية ويبدو غائما.
    5. إضافة 1 / 10 عشر حجم م 3 خلات الصوديوم (40 ميكرولتر) ودوامة.
    6. إضافة 1 ميكرولتر من الجليكوجين (20 ميكروغرام / ميكرولتر) ودوامة.
    7. إضافة 2 مجلدات (1000 ميكرولتر) من الإيثانول بنسبة 100 ٪ ، الدوامة ، ومكان عقد الاجتماع -20 درجة مئوية لمدة 20 دقيقة.
    8. تدور 000 ز 13 لمدة 20 دقيقة على 4 درجات مئوية.
    9. إزالة الإيثانول ، وتدور النبض ، وإزالة الايثانول المتبقية.
    10. إضافة 500 ميكرولتر الباردة الإيثانول 70 ٪ لغسل. لفترة وجيزة الدوامة ، وتدور في 000 ز 13 لمدة 20 دقيقة على 4 درجات مئوية.
    11. إزالة 70 ٪ من الإيثانول ، وتدور النبض ، وإزالة المتبقية عن طريق pipetting الايثانول.
    12. الهواء الجاف وبيليه مع سقف مفتوح لمدة 10 دقيقة في درجة حرارة الغرفة لإزالة كل أثر من الايثانول المتبقية.
    13. Resuspend DNA بيليه في 10 ميكرولتر تعقيمها درهم 2 0.

    التحقق من الصحة PCR

    1. يمكنك اختبار للتأكد من أن الإجراء الخاص MeDIP يعمل بواسطة تنفيذ بروتوكول MeDIP باستخدام الحمض النووي البشري العادي (ذكر أو أنثى) ، ويعاير المنطقة في وقت لاحق من المعروف أن المخصب لمثيلة.
    2. إزالة 30 ٪ من الناتج MeDIP إلى أنبوب PCR ، وآخر 30 ٪ من الناتج MeDIP إلى آخر أنبوب PCR.
    3. طرح 10 نانوغرام في الحمض النووي من داخل أنبوب PCR ، و 10 نانوغرام في الحمض النووي من داخل أنبوب آخر PCR. يجب أن يكون الآن أربعة ردود فعل منفصلة PCR لاقامة.
    4. أداء PCR باستخدام بادئات CTRL H19 وكما هو مبين في الجدول رقم 1.
    5. إعداد two mastermixes (واحد لكل مجموعة التمهيدي) لتفاعلات PCR مع حجم إجمالي 12.5 ميكرولتر على النحو المبين في الجدول 2.
    6. وThermocycle PCR به الشروط المبينة في الجدول رقم 3.
    7. تشغيل 5 ميكرولتر من المنتجات PCR على agarose هلام 2 ٪ عن التصور.
    8. وتظهر النتائج المتوقعة لMeDIP ناجحة في الجدول رقم 4.

    الجداول

    الجدول رقم 1 : H19 و CTRL الاشعال من أجل التحقق من PCR.

    تعيين التمهيدي إلى الأمام التمهيدي عكس التمهيدي حجم المنتج المتوقع
    H19 H19_F 5' - cgagtgtgcgtgagtgtgag H19_R 5' - ggcgtaatggaatgcttgaa 174 سنة مضت
    CTRL (التحكم) CTRL_F5' - gagagcattagggcagacaaa CTRL_R 5' - gttcctcagacagccacattt 139 سنة مضت

    الجدول 2. Mastermixes لتفاعلات PCR.

    2 O
    H19 ميكس (لكل Rxn) CTRL ميكس (لكل Rxn)
    6،875 6،875
    10X العازلة 1.25 1.25
    dNTP مزيج (10 ملم لكل منهما) 0.25 0.25
    MgCl 2 (50 ملم) 0.25 0.25
    الاشعال (H19_F / R أو CTRL_F / R) (10 ميكرومتر لكل F / R) 0،625 0،625
    البلاتين طق 0.25 0.25

    الجدول 3. PCR thermocyling الظروف.

    95 درجة مئوية 05:00
    40X
    95 درجة مئوية 00:30
    56 ° C 00:30
    72 ° C 00:15

    الجدول 4. النتائج المتوقعة لPCR MeDIP ناجحة.

    قالب الحمض النووي
    تستخدم التمهيدي IN الملكية الفكرية
    H19 إيجابي إيجابي
    CTRL إيجابي سلبي

Subscription Required. Please recommend JoVE to your librarian.

Discussion

هناك وعي متزايد لتلعب دورا هاما في مرض الحامض النووي ، وبالتالي فإن تطوير فحوصات لقياس هذا التعديل أصبحت ذات أهمية متزايدة 3 ، 12 ، 13. تقنية MeDIP أداة قابلة للفحص في كل الجينوم ، ومكان محدد مستوى 6 و 7. هذا الأسلوب يوفر عرض سريع لمستويات الحامض النووي باستخدام كميات محدودة من بدء DNA ، ويسمح للمقارنات سهلة بين مصادر مختلفة. تطبيقات المصب استخدام المنتج MeDIP تشمل مجموعة متنوعة من ميكروأرس مثل الجينوم وCPG صفائف قليل النوكليوتيد الجزيرة مباشر المقايسات PCR لمواضع الاهتمام ، فضلا عن التسلسل.

MeDIP يقدم نهجا مختلفا لاكتشاف الحامض النووي الذي يعتمد على الأجسام المضادة للتمييز بين الحمض النووي ميثليته وunmethylated 6. بينما MeDIP أسرع من الأساليب التقليدية بيسلفيت التسلسل وليس يقتصر على تحليل متواليات محددة مثل تحليل انزيم التقييد ، سوف يكون مناعي يعتمد على تسلسل الحمض النووي بما في ذلك الكثافة CPG والمتكررة وجود العنصر وتكوينها. وهكذا ، والضوابط المناسبة ، كما هو الحال مع كل تجربة ، تعتبر هامة لتحليل وتفسير النتائج MeDIP.

هناك خطوات عدة في جميع أنحاء تقنية MeDIP حيث يجب اتخاذ المزيد من الحيطة. وهذه تشمل : استخدام أنابيب siliconized لمنع غير محددة وملزمة من الحمض النووي على الجدران أنبوب ، وضمان تجزئة كافية من الحمض النووي بعد صوتنة ، وضمان أن الحمض النووي هو التشويه والتحريف تماما. بالإضافة إلى ذلك ، لاحظ أن التحديد الكمي للمنتج واحد MeDIP الذين تقطعت بهم السبل قد تكون صعبة لأن هناك كمية محدودة من المواد والتقنيات مشتركة كثيرة لتقدير كمية الحمض النووي ، مثل القياس الطيفي ، والعمل بشكل أفضل مع الحمض النووي المزدوج تقطعت بهم السبل. بالإضافة إلى ذلك ، من المهم مراقبة سلامة المختبرات الممارسات السليمة في جميع الأوقات ، وخصوصا عندما يتم استخدام المواد الكاوية مثل الفينول.

ويمكن أيضا تقنية MeDIP تعديلها في عدة خطوات. ويمكن أن تقاس أهمية بروتوكول صعودا أو هبوطا للسماح للزيادة الغلة ، أو العمل مع أحجام عينة محدودة. نهج التشرذم البديلة ، مثل تقييد استخدام الإنزيمات (مثل الهضم ألو أنا) ، ويقلل من الاحتياجات من المعدات ، ولكن يمكن أيضا إدخال الحمض النووي يحتمل أن تحد من التحيزات المنسدلة في بعض المناطق. كما هو الحال مع أي نهج ، يتم التحقق من صحة أفضل النتائج باستخدام نهج بديل لاكتشاف الحامض النووي 1 ، 14.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgments

نود أن نشكر أعضاء براون ومختبرات لام لمشاركتهم في هذا الفيديو النقد والمقالة. وأيد هذا العمل من جانب صناديق من المعاهد الكندية لأبحاث الصحة ومؤسسة مايكل سميث للبحوث الصحية.

Materials

Name Type Company Catalog Number Comments
Biorupter sonicator Tool Diagenode UCD-200 TM
1.7ml SafeSeal Microcentrifuge Tubes Other Sorenson BioScience 11510
ND 3300 Spectrophotometer Tool NanoDrop
Primary Antibody: Anti-5’-methylcytosine mouse mAb Reagent Calbiochem 162 33 D3
Secondary Antibody: Dynabeads M-280 Sheep anti-mouse IgG Reagent Invitrogen 112-01D
Magnetic Tube Rack Tool Invitrogen CS15000
Mini LabRoller Tool Labnet International H5500
IP Buffer 10 mM NaPO4 pH 7.0, 140 mM NaCl, 0.05% Triton X-100. Stored at room temperature
Digestion Buffer 10 mM Tris pH8.0, 100 mM EDTA, 0.5% SDS, 50 mM NaCl

DOWNLOAD MATERIALS LIST

References

  1. Beck, S., Rakyan, V. K. The methylome: approaches for global DNA methylation profiling. Trends Genet. 24, 231-237 (2008).
  2. Lu, Q., et al. Epigenetics, disease, and therapeutic interventions. Ageing research reviews. 5, 449-467 (2006).
  3. Zilberman, D., Henikoff, S. Genome-wide analysis of DNA methylation patterns. Development. 134, 3959-3965 (2007).
  4. Feinberg, A. P., Tycko, B. The history of cancer epigenetics. Nature reviews. 4, 143-153 (2004).
  5. Weber, M., et al. Distribution, silencing potential and evolutionary impact of promoter DNA methylation in the human genome. Nat Genet. 39, 457-466 (2007).
  6. Weber, M., et al. Chromosome-wide and promoter-specific analyses identify sites of differential DNA methylation in normal and transformed human cells. Nat Genet. 37, 853-862 (2005).
  7. Wilson, I. M., et al. Epigenomics: mapping the methylome. Cell Cycle. 5, 155-158 (2006).
  8. Gazin, C., Wajapeyee, N., Gobeil, S., Virbasius, C. M., Green, M. R. An elaborate pathway required for Ras-mediated epigenetic silencing. Nature. 449, 1073-1077 (2007).
  9. Karpinski, P., Sasiadek, M. M., Blin, N. Aberrant epigenetic patterns in the etiology of gastrointestinal cancers. Journal of applied. 49, 1-10 (2008).
  10. Maekawa, M., Watanabe, Y. Epigenetics: relations to disease and laboratory findings. Current medicinal chemistry. 14, 2642-2653 (2007).
  11. Vucic, E. A., Brown, C. J., Lam, W. L. Epigenetics of cancer progression. Pharmacogenomics. 9, 215-234 (2008).
  12. Egger, G., Liang, G., Aparicio, A., Jones, P. A. Epigenetics in human disease and prospects for epigenetic therapy. Nature. 429, 457-463 (2004).
  13. Jones, P. A., Baylin, S. B. The fundamental role of epigenetic events in cancer. Nat Rev Genet. 3, 415-428 (2002).
  14. Fraga, M. F., Esteller, M. DNA methylation: a profile of methods and applications. Biotechniques. 33, 632-649 (2002).

Comments

7 Comments

  1. The instrument you are using is a NanoDrop 1000 Spectrophotometer, not a NanoDrop 3300 Fluorospectrometer.

    Reply
    Posted by: Anonymous
    January 26, 2009 - 3:40 PM
  2. Dear Madams and Sirs, in the protocol you say that you sonicate 1 µg of genomic DNA and that you therefrom use 800 ng for MeDIP but I can' t find an information about the enrichment in percent.
    I would be obliged if you could give me this information because I want to try MeDIP with low amounts of DNA and so I' m very interested in your protocol. Thank very much for your efforts!!! best regards
    Sabrina Pichler

    Reply
    Posted by: Anonymous
    March 6, 2009 - 10:11 AM
  3. Hi Sabrina,
    We do not quantitate the enrichment of methylated DNA recovered after MeDIP in terms of a percentage. We just check for the presence of known methylated sequences and the absence of non-methylated sequences in our MeDIP product. It is possible to roughly estimate MeDIP yield using agarose gel electrophoresis and a DNA stain that will visualize single stranded DNA, such as SYBR Gold.

    Thank you for your interest.

    Reply
    Posted by: Anonymous
    May 27, 2009 - 2:41 PM
  4. Thank you very much.

    Reply
    Posted by: Lyudmyla S.
    October 5, 2009 - 10:10 AM
  5. We noticed that DNA directly bound to magnetic bead_protein A even without 5 mc Ab and could be eluted by simply heating. I wonder if you have this problem in your experiment. Thanks.

    Reply
    Posted by: Anonymous
    November 17, 2010 - 5:31 PM
  6. Hello!
    I am trying watch the video on meDIP experiment but only sound is available from the title as DNA preparation and immunoprecipitation. Would you please let me know how I can watch the video perfectly?

    Thank you in advance for your cooperation.

    Best regards,
    Raj Bose

    Reply
    Posted by: Raj B.
    May 19, 2011 - 7:07 AM
  7. Hi Raj,

    For trouble viewing the video, the JoVE troubleshooting link says to install/uninstall Flash.

    http://www.jove.com/Page.php?name=Troubleshooting

    If that dŒsn't work, contact support@jove.com and they should be able to help you.

    Good luck!

    Emily

    Reply
    Posted by: Anonymous
    May 24, 2011 - 2:07 PM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics