Methylated DNA의 Immunoprecipitation

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

이 동영상은 methylated DNA의 immunoprecipitation (MeDIP)에 대한 프로토콜을 보여줍니다. MeDIP가 선택 (안티 - 5 MC) 5 methylcytosine에 대한 특이성과 항체를 사용하여 게놈 DNA 샘플에서 methylated DNA 조각을 추출 두 하루 절차입니다.

Cite this Article

Copy Citation | Download Citations

Thu, K. L., Vucic, E. A., Kennett, J. Y., Heryet, C., Brown, C. J., Lam, W. L., Wilson, I. M. Methylated DNA Immunoprecipitation. J. Vis. Exp. (23), e935, doi:10.3791/935 (2009).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

DNA의 methylation 패턴의 식별은 methylation은 유전자 발현에 큰 영향을 미칠 것으로 알려져으로 epigenetics의 연구에서 일반적인 절차이며, 정상적인 발달뿐만 아니라 질병에 관여

Protocol

DNA 추출 및 샘플 준비

다른 샘플의 다양한 (교양 세포, 신선한뿐만 아니라 포르말린 고정 파라핀 - 임베디드 조직 얼어붙은)에서 DNA가 MeDIP 사용할 수 있습니다. 같은 histones으로 관련된 단백질없이 높은 정화 DNA를 사용하는 것이 중요합니다. 그것의 DNA quantitation 및 항체 바인딩 모두를 방해할 수 있으므로, 샘플에서 가능한 한 많은 RNA를 제거하는 것도 중요합니다. MeDIP에 사용되는 DNA의 양은 200 NG에서 사용할 DNA의 양에 따라 1 μg 범위 수 있습니다. 이 프로토콜을 입증하기 위해, DNA 1 μg가 사용됩니다. 다음 프로토콜은 교양 세포에서 고품질의 이중 좌초 DNA를 제공합니다. 다른 프로토콜은 다른 샘플 형식에서 DNA의 추출을위한 고용해야합니다.

  1. 1.7 ML Eppendorf 튜브에 세포 펠렛을 소화 버퍼 400 μl를 추가합니다.
  2. 튜브에 proteinase K 100 μg을 추가하고 50 밤새 품어 ° C.
  3. 500 μl 페놀 산도 7 추가하고 반전에 의해 부드럽게하지만 철저히 섞는다.
  4. 실온에서 10 분 13 000g에 스핀.
  5. 새로운 튜브로 수성 (위) 분수를 제거합니다.
  6. 반복되면 3-5 단계를 반복합니다.
  7. 500 μl 1시 1분 페놀 / 클로로포름 산도 7 추가하고 반전에 의해 부드럽게하지만 철저히 섞는다.
  8. 실온에서 10 분 13 000g에 스핀.
  9. 새로운 튜브로 수성 (위) 분수를 제거합니다.
  10. RNase 40 μg을 추가하고 37 1 시간을 품어 ° C.
  11. 500 μl 페놀 산도 7 추가하고 반전에 의해 부드럽게하지만 철저히 섞는다.
  12. 실온에서 10 분 13 000g에 스핀.
  13. 새로운 튜브로 수성 (위) 분수를 제거합니다.
  14. 반복 일단 13을 통해 11 단계를 반복합니다.
  15. 500 μl 1시 1분 페놀 / 클로로포름 산도 7 추가하고 반전에 의해 부드럽게하지만 철저히 섞는다.
  16. 실온에서 10 분 13 000g에 스핀.
  17. 새로운 튜브로 수성 (위) 분수를 제거합니다.
  18. 1/10th 볼륨에게 3 M의 아세트산 나트륨 (40 μl)을 추가하고 잘 섞는다.
  19. 100 % 에탄올 2 권 (900 μl)를 추가, 20 분에 대해 -20 ° C에서 잘 믹스, 장소.
  20. 4 20 분 13 000g에 스핀 ° C.
  21. , 에탄올을 제거 펄스 스핀, 그리고 잔류 에탄올을 제거하십시오.
  22. 세척 500 μl 차가운 70 % 에탄올을 추가합니다. 4 20 분 13 000g에 스핀 ° C.
  23. , 70 % 에탄올을 제거 펄스 스핀, 그리고 pipetting하여 잔류 에탄올을 제거하십시오.
  24. 공기가 잔류 에탄올의 모든 흔적을 제거하는 실온에서 10 분 오픈 뚜껑과 펠릿 건조.
  25. 4 밤새 소독 dH2O의 50 μl에 Resuspend의 DNA ° C.
  26. NanoDrop 분광을 이용하여 DNA를 계량. 260 : 1.8 280 비율이 이상적입니다.
  27. 100 BP의 사다리와 아가로 오스 겔에 DNA의 품질과 크기 범위를 확인합니다. 게놈 DNA의 조금은 10 NG는 SYBR 골드 같은 DNA의 소량에 매우 민감합니다 염료를 사용하여 얼룩 다음 1.7 % 아가로 오스 겔에서 실행할 수 있습니다.
  28. 샘플 당 하나의 siliconized 튜브, 소독 DH 2 O.와 만들어진 볼륨의 나머지 부분과 함께 50 μl의 총 볼륨의 DNA 1 μg를 준비

DNA SONICATION

DNA의 sonication과 MeDIP 프로토콜은 튜브 벽에 단백질이 아닌 특정 바인딩을 방지하기 위해 siliconzied 튜브에 수행되어야합니다. DNA 샘플을위한 최적의 sonication 시간은 겔 전기 영동 (단계 27)에서 결정된 DNA 샘플 조각의 정도를 기준으로합니다. 예를 들어, 교양 세포에서 추출한 DNA는 매우 높은 분자량의해야하고, 이후 종종 부분적으로 저하 아르 보존 시료에서 추출한 DNA보다 더 많은 sonication 필요합니다. 샘플이 균일하게 높은 분자량의 경우,는 각각 샘플을 확인하지 않고이 프로토콜에 설명되어있는 sonication과 함께 진행하는이 시점에서 합리적이다. 샘플 아카이브 샘플로 조각난있다면, 그것은 300 - 100bp 조각을 얻기 위해 sonication 시간을 줄임으로써 가능성 sonication 절차를 적응하기 위해 필요한 것입니다. 당신은 부분적으로 저하, sonication 매개 변수의 최적화 관심이 그 대표 샘플을 수행할 수 아르 샘플을 처리할 것으로 예상하십시오. 겔 전기 영동 (단계 27)에서 관찰의 DNA 조각의 정도에 따라, 실험자의 샘플에 대한 최적의 sonication 시간을 미리하실 수 있습니다. 여기 우리는 높은 분자량의 DNA를 사용하여 자동 sonicating 장치 (Diagenode에서 Bioruptor, UCD - 200 TM)와 sonication하여 300-1000 BP의 DNA 조각을 얻을 수있는 방법을 설명합니다.

  1. Biorupter에 물이 4 있어야 ° C.
  2. 자동 설정 7 분 (30 초 최대 전력에서 30 초 해제)에 대한 Sonicate.
  3. immunoprecipitation (IP) 반응에 대한 siliconized 1.7 ML의 원심 분리기 튜브의 sonicated 제품과 장소 800 NG를 (40 μl)를 제거합니다.
  4. 입력으로 봉사하는 나머지 200 NG (10 μl) (IN) (4 스토어 ° C)을 참조 DNA를 별도로 설정합니다.

    METHYLATED DNA의 IMMUNOPRECIPITATON

    1. 물 목욕 10 분 95 ° C에서 IP 반응 (800 NG)에 사용되는 DNA를 변성.
    2. 얼음 즉시 쿨. 다음 단계로 진행하기 전에 (얼음 약 5 분)을 완전히 DNA은 식지.
    3. 5 μg 단클론 항체를 추가합니다.
    4. 500 μl의 최종 볼륨 IP 버퍼 (이 프로토콜을 통해 상온에서 사용) 추가합니다.
    5. 튜브 홀더를 회전 4에서 2 시간 ° C에 대해 숙고하다.
    6. 5 단계가 완료되기 전에 (6-11 단계) 세탁하여 Dynabeads를 준비합니다. 첫째, vortexing하여 유리병에 철저하게 구슬을 resuspend.
    7. 새로운 siliconized 튜브 (예를 들어, 8 개의 반응을하는 경우, 9, 즉 270 μl 정도 구슬을 제거)로, 반응 더하기 하나 당 resuspended Dynabeads 30 μl를 (~ 2 × 10 7) 전송합니다.
    8. 상온에서 2 분에 대한 자성 랙에 튜브를 삽입합니다.
    9. 뜨는을 피펫. 뜨는 제거하면, 피펫 팁과 내부 벽 (구슬은 자석을 유치 어디)에 대한 구슬을 감동하지 마십시오.
    10. 자석에서 튜브를 제거하고 IP 버퍼의 초과 량 (750 μl - 1000 μl)의 구슬을 resuspend. 다시 실온에서 2 분을위한 자기 랙에 튜브를 삽입합니다.
    11. 한 번 더 씻어을 반복하고 7 단계에서 제거 원래 볼륨의 IP 버퍼에 씻은 구슬을 resuspend.
    12. 각 IP 반응을 씻어 Dynabeads 30 μl 추가
    13. 4 2 시간에 회전 튜브 홀더에 품어 ° C.
    14. 배양이 완료되면, 상온에서 2 분을위한 자기 랙에 튜브를 놓으십시오.
    15. 뜨는을 피펫. 피펫 팁로 튜브의 내부 벽 (비즈는 자석을 유치 어디에) 감동하지 마십시오. IP 버퍼 500 μl를 추가합니다. 튜브의 내용을 믹스 2 분을위한 자기 선반에 놓으세요. 500 UL IP 버퍼 한 번에 함께 씻어 반복합니다.
    16. 마지막 세척에서 뜨는을 제거한 후 소화 버퍼 400 μl의 구슬을 resuspend.
    17. Proteinase K 100 μg과 반응을 치료하고 50 밤새 품어 ° C.

    IMMUNOPRECIPITATED DNA의 정제

    1. 500 μl 1시 1분 페놀 / 클로로포름 산도 7 철저히 와동을 추가합니다.
    2. 실온에서 10 분 13 000g에 스핀.
    3. 새로운 튜브로 수성 (위) 분수를 제거합니다.
    4. 수성 및 유기 층 사이의 계면이 흐린 나타나면 반복 1-3 단계를 반복합니다.
    5. 10분의 1 일 볼륨 3 M의 아세트산 나트륨 (40 μl)와 와동을 추가합니다.
    6. 1 글리코겐의 μl (20 μg / μl)와 와동을 추가합니다.
    7. 100 % 에탄올, 소용돌이, 그리고 20 분에 대해 -20 ° C에서 장소 2 권 (1000 μl)를 추가합니다.
    8. 4 20 분 13 000g에 스핀 ° C.
    9. , 에탄올을 제거 펄스 스핀, 그리고 잔류 에탄올을 제거하십시오.
    10. 세척 500 μl 차가운 70 % 에탄올을 추가합니다. 4 20 분 13 000g에 소용돌이 간략하게, 그리고 스핀 ° C.
    11. , 70 % 에탄올을 제거 펄스 스핀, 그리고 pipetting하여 잔류 에탄올을 제거하십시오.
    12. 공기가 잔류 에탄올의 모든 흔적을 제거하는 실온에서 10 분 오픈 뚜껑과 펠릿 건조.
    13. 10 μl의 Resuspend DNA 펠렛은 DH 2 0을 살균.

    PCR에 의해 검증

    1. 당신은 MeDIP 절차는 보통 인간의 DNA를 (남녀)를 사용하여 MeDIP 프로토콜을 수행하여 작업하고, 이후 methylation에 대한 풍부한 것으로 알려져 영역을 시금 있는지 확인하기 위해 검사 수도 있습니다.
    2. PCR 튜브에 MeDIP 제품의 30 %, 다른 PCR 튜브에 MeDIP 제품의 또 다른 30 ​​%를 제거합니다.
    3. PCR 튜브에 DNA에 10 NG, 다른 PCR 튜브에 DNA에 10 NG 놔. 이제 네 별도의 PCR 반응은 설정해야합니다.
    4. PCR은 H19와 CTRL primers를 사용하여 수행은 표 1에서 지적했다.
    5. 으로 표 2에 명시된 12.5 μl 총 볼륨 PCR 반응을위한 두 mastermixes (각 프라이머 세트)로 준비하세요.
    6. Thermocycle PCR은 표 3에 제시된 조건을 사용합니다.
    7. 시각화를위한 2 % 아가로 오스 겔에 PCR 제품의 5 μl를 실행합니다.
    8. 성공 MeDIP에 대한 예상 결과는 표 4에 표시됩니다.

    테이블

    표 1 : H19 및 PCR 검증을 위해 CTRL primers.

    프라이머 세트 앞으로 프리머 역방향 프리머 예상 제품 크기
    H19 H19_F 5' - cgagtgtgcgtgagtgtgag H19_R 5' - ggcgtaatggaatgcttgaa 174 BP
    CTRL (제어) CTRL_F5' - gagagcattagggcagacaaa CTRL_R 5' - gttcctcagacagccacattt 139 BP

    표 2. PCR 반응을위한 Mastermixes.

    2 O
    H19 믹스 (사람마다 Rxn) CTRL 믹스 (사람마다 Rxn)
    6.875 6.875
    10X 버퍼 1.25 1.25
    dNTP 혼합 (10 MM 각) 0.25 0.25
    MgCl 2 (50 ㎜) 0.25 0.25
    Primers (H19_F / R 또는 CTRL_F / R) (10 μm의 각 F / R) 0.625 0.625
    플래티넘 DNA 형성 촉매 0.25 0.25

    표 3. PCR thermocyling 조건.

    95 ° C 5시
    40X
    95 ° C 0시 반
    56 ° C 0시 반
    72 ° C 0시 15분

    표 4. 성공 MeDIP에 대한 PCR 결과를 예상.

    템플릿 DNA
    프리머 사용되는 IN IP
    H19 긍정적인 긍정적인
    CTRL 긍정적인 부정

Subscription Required. Please recommend JoVE to your librarian.

Discussion

질병에있는 중요한 역할의 DNA methylation의 재생의 성장 의식이있다,이 수정을 측정 assays의 따라서 개발은 13 초, 12 초, 3 점차 중요 해지고 있습니다. MeDIP 기술은 전체 게놈과 로커스 - 특정 레벨 6, 7 모두에서 검사를받을 수있는 도구입니다. 이 기술은 DNA를 시작하는 제한된 양의를 사용하여 DNA의 methylation 수준의 빠른 볼을 제공하며 서로 다른 소스 사이에서 쉽게 비교를 위해 수 있습니다. MeDIP 제품을 사용하는 다운 스트림 응용 프로그램은 전체 게놈 및 CPG 섬 oligonucleotide 배열, 관심 loci에 대한 직접적인 PCR의 assays뿐만 아니라, 시퀀싱 등 microarrays 다양한 있습니다.

MeDIP는 methylated DNA와 6 unmethylated 구분하는 항체에 의존 DNA의 methylation 검출에 대한 독특한 접근 방식을 제공합니다. MeDIP 전통 bisulfite 시퀀싱 방식보다되며 그것이 제한 효소 분석과 같은 특정 시퀀스의 분석에 한정되지 않지만, immunoprecipitation는 CPG 밀도, 반복적인 요소 존재 및 구성을 포함한 DNA 순서에 의존한다. 따라서, 적절한 컨트롤은 모든 실험과 마찬가지로, MeDIP 결과의 분석 및 해석에 중요합니다.

추가주의를 이동해야합니다 MeDIP 기술 전반에 걸쳐 몇 가지 단계가 있습니다. 이들은 다음과 같습니다 튜브 벽에 DNA가 아닌 특정 바인딩을 방지하기 위해 siliconized 튜브의 사용; sonication 후 DNA가 충분히 조각을 확보, 그 DNA를 보장하는 것은 완전히 변성입니다. 또한, 재료 및 분광 광도법과 같은 DNA 수량을 계산하는 많은 일반적인 기술의 한계가 있기 때문에 단일 좌초 MeDIP 제품의 부량이 어려울 수 있습니다 두 번 좌초 DNA와 함께 최고의 작품. 또한, 같은 페놀과 같은 부식성 물질을 사용하는 특히, 항상 적절한 실험실 안전 관행을 준수하는 것이 중요합니다.

MeDIP 기술은 또한 여러 단계에서 수정할 수 있습니다. 중요한 프로토콜은 제한된 샘플 크기 증가 수율, 또는 작업을 허용하거나 아래로 확장할 수 있습니다. 이러한 제한 효소의 사용 (예 : Alu I의 소화)로 대체 조각화 접근, 장비 요구 사항을 줄일뿐만 아니라, 잠재적으로 DNA 일부 지역에서 풀다운 제한 편견을 소개하실 수 있습니다. 어떤 접근 방식과 마찬가지로 결과는 최상의 DNA methylation 검출 1, 14 대체 접근법을 사용 확인하고 있습니다.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgments

우리는이 비디오 및 문서를 비평에 참여를 위해 갈색과 램 실험실의 구성원을 감사하고 싶습니다. 이 작품은 건강 연구와 건강 연구에 대한 마이클 스미스 재단에 대한 캐나다 연구소에서 자금을 지원했다.

Materials

Name Type Company Catalog Number Comments
Biorupter sonicator Tool Diagenode UCD-200 TM
1.7ml SafeSeal Microcentrifuge Tubes Other Sorenson BioScience 11510
ND 3300 Spectrophotometer Tool NanoDrop
Primary Antibody: Anti-5’-methylcytosine mouse mAb Reagent Calbiochem 162 33 D3
Secondary Antibody: Dynabeads M-280 Sheep anti-mouse IgG Reagent Invitrogen 112-01D
Magnetic Tube Rack Tool Invitrogen CS15000
Mini LabRoller Tool Labnet International H5500
IP Buffer 10 mM NaPO4 pH 7.0, 140 mM NaCl, 0.05% Triton X-100. Stored at room temperature
Digestion Buffer 10 mM Tris pH8.0, 100 mM EDTA, 0.5% SDS, 50 mM NaCl

DOWNLOAD MATERIALS LIST

References

  1. Beck, S., Rakyan, V. K. The methylome: approaches for global DNA methylation profiling. Trends Genet. 24, 231-237 (2008).
  2. Lu, Q., et al. Epigenetics, disease, and therapeutic interventions. Ageing research reviews. 5, 449-467 (2006).
  3. Zilberman, D., Henikoff, S. Genome-wide analysis of DNA methylation patterns. Development. 134, 3959-3965 (2007).
  4. Feinberg, A. P., Tycko, B. The history of cancer epigenetics. Nature reviews. 4, 143-153 (2004).
  5. Weber, M., et al. Distribution, silencing potential and evolutionary impact of promoter DNA methylation in the human genome. Nat Genet. 39, 457-466 (2007).
  6. Weber, M., et al. Chromosome-wide and promoter-specific analyses identify sites of differential DNA methylation in normal and transformed human cells. Nat Genet. 37, 853-862 (2005).
  7. Wilson, I. M., et al. Epigenomics: mapping the methylome. Cell Cycle. 5, 155-158 (2006).
  8. Gazin, C., Wajapeyee, N., Gobeil, S., Virbasius, C. M., Green, M. R. An elaborate pathway required for Ras-mediated epigenetic silencing. Nature. 449, 1073-1077 (2007).
  9. Karpinski, P., Sasiadek, M. M., Blin, N. Aberrant epigenetic patterns in the etiology of gastrointestinal cancers. Journal of applied. 49, 1-10 (2008).
  10. Maekawa, M., Watanabe, Y. Epigenetics: relations to disease and laboratory findings. Current medicinal chemistry. 14, 2642-2653 (2007).
  11. Vucic, E. A., Brown, C. J., Lam, W. L. Epigenetics of cancer progression. Pharmacogenomics. 9, 215-234 (2008).
  12. Egger, G., Liang, G., Aparicio, A., Jones, P. A. Epigenetics in human disease and prospects for epigenetic therapy. Nature. 429, 457-463 (2004).
  13. Jones, P. A., Baylin, S. B. The fundamental role of epigenetic events in cancer. Nat Rev Genet. 3, 415-428 (2002).
  14. Fraga, M. F., Esteller, M. DNA methylation: a profile of methods and applications. Biotechniques. 33, 632-649 (2002).

Comments

7 Comments

  1. The instrument you are using is a NanoDrop 1000 Spectrophotometer, not a NanoDrop 3300 Fluorospectrometer.

    Reply
    Posted by: Anonymous
    January 26, 2009 - 3:40 PM
  2. Dear Madams and Sirs, in the protocol you say that you sonicate 1 µg of genomic DNA and that you therefrom use 800 ng for MeDIP but I can' t find an information about the enrichment in percent.
    I would be obliged if you could give me this information because I want to try MeDIP with low amounts of DNA and so I' m very interested in your protocol. Thank very much for your efforts!!! best regards
    Sabrina Pichler

    Reply
    Posted by: Anonymous
    March 6, 2009 - 10:11 AM
  3. Hi Sabrina,
    We do not quantitate the enrichment of methylated DNA recovered after MeDIP in terms of a percentage. We just check for the presence of known methylated sequences and the absence of non-methylated sequences in our MeDIP product. It is possible to roughly estimate MeDIP yield using agarose gel electrophoresis and a DNA stain that will visualize single stranded DNA, such as SYBR Gold.

    Thank you for your interest.

    Reply
    Posted by: Anonymous
    May 27, 2009 - 2:41 PM
  4. Thank you very much.

    Reply
    Posted by: Lyudmyla S.
    October 5, 2009 - 10:10 AM
  5. We noticed that DNA directly bound to magnetic bead_protein A even without 5 mc Ab and could be eluted by simply heating. I wonder if you have this problem in your experiment. Thanks.

    Reply
    Posted by: Anonymous
    November 17, 2010 - 5:31 PM
  6. Hello!
    I am trying watch the video on meDIP experiment but only sound is available from the title as DNA preparation and immunoprecipitation. Would you please let me know how I can watch the video perfectly?

    Thank you in advance for your cooperation.

    Best regards,
    Raj Bose

    Reply
    Posted by: Raj B.
    May 19, 2011 - 7:07 AM
  7. Hi Raj,

    For trouble viewing the video, the JoVE troubleshooting link says to install/uninstall Flash.

    http://www.jove.com/Page.php?name=Troubleshooting

    If that dŒsn't work, contact support@jove.com and they should be able to help you.

    Good luck!

    Emily

    Reply
    Posted by: Anonymous
    May 24, 2011 - 2:07 PM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics