JoVE Visualize What is visualize?
Stop Reading. Start Watching.
Advanced Search
Stop Reading. Start Watching.
Regular Search
Find video protocols related to scientific articles indexed in Pubmed.
A Unique Type of Pyrrole-based Cyanine Fluorophores with Turn-on and Ratiometric Fluorescence Signals at Different pH Regions for Sensing pH in Enzymes and Living Cells.
ACS Appl Mater Interfaces
PUBLISHED: 11-20-2014
Show Abstract
Hide Abstract
The development of new functional fluorescent dyes has attracted great attention. Herein, we have described a novel strategy to design a unique type of cyanine dyes by attaching two indolium moieties at the ?-positions of the pyrrole core. The new type of cyanine dyes are named as PyCy fluorophores. Importantly, PyCy dyes can exhibit an exceptional feature, fluorescence turn-on response at pH varying from acidic to near-neutral conditions, and a ratiometric fluorescence response at pH varying from near-neutral to basic conditions. By taking advantage of the fluorescence turn-on response of PyCy2 at pH varying from acidic to near-neutral conditions and near-infrared emission properties of the PyCy2, we have demonstrated that a small-molecule fluorescent probe can image pH variations in living cells. Furthermore, we have demonstrated that PyCy2 can sense real-time pH changes in alkaline conditions induced by enzymes based on the ratiometric fluorescence response of PyCy2 at pH varying from near-neutral to basic conditions. We expect that the new design strategy of PyCy fluorophores may prompt the development of a wide variety of cyanine derivatives with desirable properties.
Related JoVE Video
Epstein-barr virus positive inflammatory pseudotumor of the liver: report of a challenging case and review of the literature.
Ann. Clin. Lab. Sci.
PUBLISHED: 11-02-2014
Show Abstract
Hide Abstract
Inflammatory pseudotumor (IPT) is an uncommon, benign lesion of unclear etiology, which is sometimes associated with Epstein-Barr virus (EBV). In this study, we discuss a case of hepatic EBV positive IPT and discuss mimickers, prognosis, and treatment. The case we describe was located in the liver and composed of a mixture of spindle cells and polymorphic inflammatory cells with areas of necrosis. The spindle cells were negative for CAM5.2, ALK1, CD21, CD23, CD35, actin, S-100, and CD34. EBV-encoded small RNA in situ hybridization showed a large number of EBV positive cells. The diagnosis of hepatic EBV positive IPT with uncertain biological behavior was issued, presenting numerous difficulties with diagnostic and therapeutic challenges.
Related JoVE Video
Layer-by-Layer Films with Bioreducible and Nonbioreducible Polycations for Sequential DNA Release.
Biomacromolecules
PUBLISHED: 10-31-2014
Show Abstract
Hide Abstract
Layer-by-layer (LbL) films containing cationic polyelectrolytes and anionic bioactive molecules such as DNA are promising biomaterials for controlled and localized gene delivery for a number of biomedical applications including cancer DNA vaccine delivery. Bioreducible LbL films made of disulfide-containing poly(amido amine)s (PAAs) and plasmid DNA can be degraded by redox-active membrane proteins through the thiol-disulfide exchange reaction to release DNA exclusively into the extracellular microenvironment adjacent to the film. In order to better understand the film degradation mechanism and nature of the released species, the bioreducible film degradation is studied by atomic force microscopy, fluorescence, and dynamic light scattering in solutions containing a reducing agent. The PAA/DNA LbL film undergoes fast bulk degradation with micrometer-sized pieces breaking off from the substrate. This bulk degradation behavior is arrested by periodic insertions of a nonbioreducible poly(ethylenimine) (PEI) layer. The LbL films containing PAA/DNA and PEI/DNA bilayers display sequential film disassembly and are capable of continuously releasing DNA nanoparticles over a prolonged time. Insertion of the PEI layer enables the bioreducible LbL films to transfect human embryonic kidney 293 cells. The data conclude that the PEI layer is effective as a barrier layer against interlayer diffusion during LbL film assembly and more importantly during film disassembly. Without the barrier layer, the high mobility of cleaved PAA fragments is responsible for bulk degradation of bioreducible LbL films, which may prevent their ultimate gene-delivery applications. This work establishes a direct link among film internal structure, disassembly mechanism, and transfection efficiency. It provides a simple method to design bioreducible LbL films for sequential and long-time DNA release.
Related JoVE Video
Functional Data Analysis of Tree Data Objects.
J Comput Graph Stat
PUBLISHED: 10-28-2014
Show Abstract
Hide Abstract
Data analysis on non-Euclidean spaces, such as tree spaces, can be challenging. The main contribution of this paper is establishment of a connection between tree data spaces and the well developed area of Functional Data Analysis (FDA), where the data objects are curves. This connection comes through two tree representation approaches, the Dyck path representation and the branch length representation. These representations of trees in Euclidean spaces enable us to exploit the power of FDA to explore statistical properties of tree data objects. A major challenge in the analysis is the sparsity of tree branches in a sample of trees. We overcome this issue by using a tree pruning technique that focuses the analysis on important underlying population structures. This method parallels scale-space analysis in the sense that it reveals statistical properties of tree structured data over a range of scales. The effectiveness of these new approaches is demonstrated by some novel results obtained in the analysis of brain artery trees. The scale space analysis reveals a deeper relationship between structure and age. These methods are the first to find a statistically significant gender difference.
Related JoVE Video
MoonProt: a database for proteins that are known to moonlight.
Nucleic Acids Res.
PUBLISHED: 10-18-2014
Show Abstract
Hide Abstract
Moonlighting proteins comprise a class of multifunctional proteins in which a single polypeptide chain performs multiple biochemical functions that are not due to gene fusions, multiple RNA splice variants or pleiotropic effects. The known moonlighting proteins perform a variety of diverse functions in many different cell types and species, and information about their structures and functions is scattered in many publications. We have constructed the manually curated, searchable, internet-based MoonProt Database (http://www.moonlightingproteins.org) with information about the over 200 proteins that have been experimentally verified to be moonlighting proteins. The availability of this organized information provides a more complete picture of what is currently known about moonlighting proteins. The database will also aid researchers in other fields, including determining the functions of genes identified in genome sequencing projects, interpreting data from proteomics projects and annotating protein sequence and structural databases. In addition, information about the structures and functions of moonlighting proteins can be helpful in understanding how novel protein functional sites evolved on an ancient protein scaffold, which can also help in the design of proteins with novel functions.
Related JoVE Video
Dendritic cell and histiocytic neoplasms: biology, diagnosis, and treatment.
Cancer Control
PUBLISHED: 10-14-2014
Show Abstract
Hide Abstract
Dendritic and histiocytic cell neoplasms are rare malignancies that make up less than 1% of all neoplasms arising in lymph nodes or soft tissues. These disorders have distinctive disease biology, clinical presentations, pathology, and unique treatment options. Morphology and immunohistochemistry evaluation by a hematopathologist remains key for differentiating between these neoplasms. In this review, we describe tumor biology, clinical features, pathology, and treatment of follicular dendritic cell sarcoma, interdigitating dendritic cell sarcoma, indeterminate dendritic cell sarcoma, histiocytic sarcoma, fibroblastic reticular cell tumors, and disseminated juvenile xanthogranuloma.
Related JoVE Video
Identification and characterization of alphavirus M1 as a selective oncolytic virus targeting ZAP-defective human cancers.
Proc. Natl. Acad. Sci. U.S.A.
PUBLISHED: 10-06-2014
Show Abstract
Hide Abstract
Oncolytic virotherapy is a growing treatment modality that uses replicating viruses as selective antineoplastic agents. Safety and efficacy considerations dictate that an ideal oncolytic agent would discriminate between normal and cancer cells on the basis of common genetic abnormalities in human cancers. Here, we identify a naturally occurring alphavirus (M1) as a novel selective killer targeting zinc-finger antiviral protein (ZAP)-deficient cancer cells. In vitro, in vivo, and ex vivo studies showed potent oncolytic efficacy and high tumor tropism of M1. We showed that the selectivity depends on ZAP deficiency by systematic identification. A large-scale multicenter pathology study using tissue microarrays reveals that ZAP is commonly deficient in human cancers, suggesting extensive application prospects for M1. Additionally, M1 killed cancer cells by inducing endoplasmic reticulum stress-mediated apoptosis. Our report provides novel insights into potentially personalized cancer therapy using oncolytic viruses.
Related JoVE Video
Approaches to design non-covalent inhibitors for human granzyme B (hGrB).
Org. Biomol. Chem.
PUBLISHED: 10-04-2014
Show Abstract
Hide Abstract
A structure-based design campaign for non-covalent small molecule inhibitors of human granzyme B was carried out by means of a virtual screening strategy employing three constraints and probe site-mapping with FTMAP to identify ligand "hot spots". In addition, new scaffolds of diverse structures were subsequently explored with ROCS shape-based superposition methods, following by Glide SP docking, induced fit docking and analysis of QikProp molecular properties. Novel classes of moderately active small molecule blockers (?25 ?M IC50 values) from commercially available libraries were identified, and three novel scaffolds have been synthesized by multi-step procedures. Furthermore, we provide an example of a comprehensive structure-based drug discovery approach to non-covalent inhibitors that relies on the X-ray structure of a covalently bound ligand and suggest that the design path may be compromised by alternative and unknown binding poses.
Related JoVE Video
Tandem and triple-junction polymer:nanocrystal hybrid solar cells consisting of identical subcells.
ACS Appl Mater Interfaces
PUBLISHED: 10-01-2014
Show Abstract
Hide Abstract
Tandem and triple-junction polymer:nanocrystal hybrid solar cells with identical subcells based on P3HT:CdSe nanocrystal bulk heterojunctions (BHJs) are reported for the first time showing 2-fold and 3-fold increases of open-circuit voltage (VOC), respectively, relative to the single-junction cell. A combination of nanocrystalline ZnO and pH-neutral PEDOT:PSS is used as the interconnecting layer, and the thicknesses of subcells are optimized with the guidance of optical simulations. As a result, the average power conversion efficiency (PCE) exhibits a significant increase from 2.0% (VOC = 0.57 V) in single-junction devices to 2.7% (champion 3.1%, VOC = 1.28 V) in tandem devices and 2.3% (VOC = 1.98 V) in triple-junction devices.
Related JoVE Video
Cation Substitution Dependent Bimodal Photoluminescence in Whitlockite Structural Ca3-xSrx(PO4)2:Eu(2+) (0 ? x ? 2) Solid Solution Phosphors.
Inorg Chem
PUBLISHED: 09-30-2014
Show Abstract
Hide Abstract
Cation substitution dependent tunable bimodal photoluminescence behavior was observed in the Ca3-xSrx(PO4)2:Eu(2+) (0 ? x ? 2) solid solution phosphors. The Rietveld refinements verified the phase purity and whitlockite type crystal structure of the solid solutions. The tunable photoluminescence evolution was studied as a function of strontium content, over the composition range 0.1 ? x ? 2. In addition to the emission band peak at 416 nm in Ca3(PO4)2:Eu(2+), the substitution of Ca(2+) by Sr(2+) induced the emerging broad-band peak at 493-532 nm. A dramatic red shift of the emission peak located in the green-yellow region was observed on an increase of x in the samples with 0.75 ? x ? 2.00. The two emission bands could be related to the EuOn-Ca9 and EuOn-Ca9-xSrx emitting blocks, respectively. The values for the two kinds of emitting blocks in the solid solutions can be fitted well with the observed intensity evolution of the two emission peaks.
Related JoVE Video
[Efficacy and safety of low-dose high intensity focused ultrasound combined with S-1 and oxaliplatin in metastatic colorectal patients with pelvic masses].
Zhonghua Yi Xue Za Zhi
PUBLISHED: 09-26-2014
Show Abstract
Hide Abstract
To evaluate the efficacy and safety of the regimen of low-dose high intensity focused ultra-sound (HIFU) plus S-1 and oxaliplatin (SOX) in the treatment of metastatic colorectal cancer patients with pelvic masses.
Related JoVE Video
Transmembrane Protease Serine 4 Promotes Thyroid Cancer Proliferation via CREB Phosphorylation.
Thyroid
PUBLISHED: 09-23-2014
Show Abstract
Hide Abstract
Background: Transmembrane protease serine 4 (TMPRSS4), one of the type II transmembrane serine proteases (TTSPs), is elevated in various cancers and is associated with multiple malignant phenotypes. However, the expression pattern and biologic significance of TMPRSS4 in thyroid cancer are largely unknown. In this study, we investigated the expression of TMPRSS4 in thyroid cancer and assessed the pro-proliferative role of TMPRSS4 in thyroid cancer. Methods: Immunohistochemistry and real-time reverse transcription-polymerase chain reaction (RT-PCR) assays were performed to assess the expression of TMPRSS4 in thyroid cancer. We evaluated in vitro cell proliferation using MTT, colony formation, anchorage-independent growth, flow cytometry analysis, and 5-ethynyl-2'-deoxyuridine (EdU) incorporation assays. Western blot, real-time RT-PCR, and luciferase assays were conducted to reveal the underlying mechanisms. Results: TMPRSS4 is overexpressed in thyroid cancer and is associated with the grade of malignancy. Depletion of TMPRSS4 in thyroid cancer cells significantly suppressed proliferation. Moreover, the proliferation of thyroid cancer cells with TMPRSS4 overexpression was significantly enhanced. We also show that cyclic adenosine monophosphate response element-binding protein (CREB)-cyclin D1 signaling mediates, at least partially, the role of TMPRSS4 in thyroid cancer cell proliferation. Conclusions: TMPRSS4 is overexpressed in thyroid cancer and TMPRSS4-CREB signaling is needed to sustain thyroid cancer cell proliferation.
Related JoVE Video
Dynamic biometric identification from multiple views using the GLBP-TOP method.
Biomed Mater Eng
PUBLISHED: 09-18-2014
Show Abstract
Hide Abstract
To realize effective and rapid dynamic biometric identification with low computational complexity, a video-based facial texture program that extracts local binary patterns from three orthogonal planes in the frequency domain of the Gabor transform (GLBP-TOP) was proposed. Firstly, each normalized face was transformed by Gabor wavelet to get the enhanced Gabor magnitude map, and then the LBP-TOP operator was applied to the maps to extract video texture. Finally, weighted Chi square statistics based on the Fisher Criterion were used to realize the identification. The proposed algorithm was proved effective through the biometric experiments using the Honda/UCSD database, and was robust against changes of illumination and expressions.
Related JoVE Video
Low-frequency (1/f) noise in nanocrystal field-effect transistors.
ACS Nano
PUBLISHED: 09-11-2014
Show Abstract
Hide Abstract
We investigate the origins and magnitude of low-frequency noise in high-mobility nanocrystal field-effect transistors and show the noise is of 1/f-type. Sub-band gap states, in particular, those introduced by nanocrystal surfaces, have a significant influence on the 1/f noise. By engineering the device geometry and passivating nanocrystal surfaces, we show that in the linear and saturation regimes the 1/f noise obeys Hooge's model of mobility fluctuations, consistent with transport of a high density of accumulated carriers in extended electronic states of the NC thin films. In the subthreshold regime, the Fermi energy moves deeper into the mobility gap and sub-band gap trap states give rise to a transition to noise dominated by carrier number fluctuations as described in McWhorter's model. CdSe nanocrystal field-effect transistors have a Hooge parameter of 3 × 10(-2), comparable to other solution-deposited, thin-film devices, promising high-performance, low-cost, low-noise integrated circuitry.
Related JoVE Video
Efficacy and safety of vitamin D3 in patients with diabetic nephropathy: a meta-analysis of randomized controlled trials.
Chin. Med. J.
PUBLISHED: 08-23-2014
Show Abstract
Hide Abstract
Several studies found that vitamin D3 might alter glucose metabolism, protect kidney from injury and even proposed the mechanisms. But results from previous studies have been conflicting. The aim of this study was to evaluate the efficacy and safety of vitamin D3 in patients with diabetic nephropathy. The underlying mechanism of vitamin D3 decreasing proteinuria is also discussed.
Related JoVE Video
Risk score to predict hospital-acquired pneumonia after spontaneous intracerebral hemorrhage.
Stroke
PUBLISHED: 07-15-2014
Show Abstract
Hide Abstract
We aimed to develop a risk score (intracerebral hemorrhage-associated pneumonia score, ICH-APS) for predicting hospital-acquired stroke-associated pneumonia (SAP) after ICH.
Related JoVE Video
Robustness of interrelated traffic networks to cascading failures.
Sci Rep
PUBLISHED: 06-02-2014
Show Abstract
Hide Abstract
The vulnerability to real-life networks against small initial attacks has been one of outstanding challenges in the study of interrelated networks. We study cascading failures in two interrelated networks S and B composed from dependency chains and connectivity links respectively. This work proposes a realistic model for cascading failures based on the redistribution of traffic flow. We study the Barabási-Albert networks (BA) and Erd?s-Rényi graphs (ER) with such structure, and found that the efficiency sharply decreases with increasing percentages of the dependency nodes for removing a node randomly. Furthermore, we study the robustness of interrelated traffic networks, especially the subway and bus network in Beijing. By analyzing different attacking strategies, we uncover that the efficiency of the city traffic system has a non-equilibrium phase transition at low capacity of the networks. This explains why the pressure of the traffic overload is relaxed by singly increasing the number of small buses during rush hours. We also found that the increment of some buses may release traffic jam caused by removing a node of the bus network randomly if the damage is limited. However, the efficiencies to transfer people flow will sharper increase when the capacity of the subway network ?(S) > ?0.
Related JoVE Video
Development of near infrared reflectance spectroscopy to predict chemical composition with a wide range of variability in beef.
Meat Sci.
PUBLISHED: 05-27-2014
Show Abstract
Hide Abstract
A total of 182 beef samples were minced and divided into calibration set (n=140) and independent validation set (n=42). Calibration models of NIRS (1000-1800nm) were built using partial least squares regression (PLSR) on the calibration set of samples. Both the coefficient of determination in calibration (R(2)C) and the coefficient of determination in prediction (R(2)P) were over 0.98 for all chemical compositions. The ratio performance deviation (RPD) was 17.37, 5.12 and 10.43 for fat, protein and moisture, respectively. The results of the present study indicate the outstanding ability of NIRS to predict chemical composition in beef.
Related JoVE Video
Chaos-order transition in foraging behavior of ants.
Proc. Natl. Acad. Sci. U.S.A.
PUBLISHED: 05-27-2014
Show Abstract
Hide Abstract
The study of the foraging behavior of group animals (especially ants) is of practical ecological importance, but it also contributes to the development of widely applicable optimization problem-solving techniques. Biologists have discovered that single ants exhibit low-dimensional deterministic-chaotic activities. However, the influences of the nest, ants' physical abilities, and ants' knowledge (or experience) on foraging behavior have received relatively little attention in studies of the collective behavior of ants. This paper provides new insights into basic mechanisms of effective foraging for social insects or group animals that have a home. We propose that the whole foraging process of ants is controlled by three successive strategies: hunting, homing, and path building. A mathematical model is developed to study this complex scheme. We show that the transition from chaotic to periodic regimes observed in our model results from an optimization scheme for group animals with a home. According to our investigation, the behavior of such insects is not represented by random but rather deterministic walks (as generated by deterministic dynamical systems, e.g., by maps) in a random environment: the animals use their intelligence and experience to guide them. The more knowledge an ant has, the higher its foraging efficiency is. When young insects join the collective to forage with old and middle-aged ants, it benefits the whole colony in the long run. The resulting strategy can even be optimal.
Related JoVE Video
Risk score to predict gastrointestinal bleeding after acute ischemic stroke.
BMC Gastroenterol
PUBLISHED: 05-19-2014
Show Abstract
Hide Abstract
Gastrointestinal bleeding (GIB) is a common and often serious complication after stroke. Although several risk factors for post-stroke GIB have been identified, no reliable or validated scoring system is currently available to predict GIB after acute stroke in routine clinical practice or clinical trials. In the present study, we aimed to develop and validate a risk model (acute ischemic stroke associated gastrointestinal bleeding score, the AIS-GIB score) to predict in-hospital GIB after acute ischemic stroke.
Related JoVE Video
The use of Au@SiO2 shell-isolated nanoparticle-enhanced Raman spectroscopy for human breast cancer detection.
Anal Bioanal Chem
PUBLISHED: 05-04-2014
Show Abstract
Hide Abstract
This study uses the powerful fingerprint features of Raman spectroscopy to distinguish different types of breast tissues including normal breast tissues (NB), fibroadenoma (FD), atypical ductal hyperplasia (ADH), ductal carcinoma in situ (DCIS), and invasive ductal carcinoma (IDC). Thin frozen tissue sections of fresh breast tissues were measured by Raman spectroscopy. Due to the inherent low sensitivity of Raman spectra, Au@SiO2 shell-isolated nanoparticle-enhanced Raman spectroscopy (SHINERS) technique was utilized to provide supplementary and more informative spectral features. A total of 619 Raman spectra were acquired and compared to 654 SHINERS spectra. The maximum enhancement effect of distinct and specific bands was characterized for different tissue types. When applying the new criteria, excellent separation of FD, DCIS, and IDC was obtained for all tissue types. Most importantly, we were able to distinguish ADH from DCIS. Although only a preliminary distinction was characterized between ADH and NB, the results provided a good foundation of criteria to further discriminate ADH from NB and shed more light toward a better understanding of the mechanism of ADH formation. This is the first report to detect the premalignant (ADH and DCIS) breast tissue frozen sections and also the first report exploiting SHINERS to detect and distinguish breast tissues. The results presented in this study show that SHINERS can be applied to accurately and efficiently identify breast lesions. Further, the spectra can be acquired in a minimally invasive procedure and analyzed rapidly facilitating early and accurate diagnosis in vivo/in situ.
Related JoVE Video
On bandwidth characteristics of tuning fork micro-gyroscope with mechanically coupled sense mode.
Sensors (Basel)
PUBLISHED: 04-29-2014
Show Abstract
Hide Abstract
The bandwidth characteristics of a tuning fork micro-gyroscope with mechanically coupled sense mode were investigated in this paper to provide some references for mechanical bandwidth design. The concept of sense mode mechanical coupling is introduced first. Theoretical frequency response analyses were then carried out on the mechanical part of the gyroscope. Equations representing the relationships between the differential output signal and the frequency of the input angular rate were deduced in full frequency range and further simplified in low frequency range. Based on these equations, bandwidth characteristics under ideal and non-ideal conditions are discussed. Analytical results show that under ideal conditions, the bandwidth characteristics of a tuning fork micro-gyroscope are similar to those of a single mass micro-gyroscope, but under non-ideal conditions, especially when sense mass and/or stiffness are asymmetric, the bandwidth characteristics would be quite different because the in-phase mode would participate in the anti-phase vibration response. Experimental verifications were carried out on two micro-gyroscope prototypes designed in our laboratory. The deduced equations and analytical results can be used in guiding the mechanical bandwidth design of tuning fork micro-gyroscopes with mechanically coupled sense mode.
Related JoVE Video
Group A streptococcus inhibitors by high-throughput virtual screening.
Eur J Med Chem
PUBLISHED: 04-29-2014
Show Abstract
Hide Abstract
Group A streptococcus (GAS) is a Gram-positive bacterium, which can cause multiple types of disease from mild infections of skin and throat to invasive and life-threatening infections. Recently RNase J1 and J2 were found to be essential for the growth of GAS. In order to identify inhibitors against RNase J1/J2, homology models of both the ligand-free apo-form and the ligand-bound holo-form complexes were constructed as templates for high-throughput virtual screening (HTVS). A focused small molecule library and the commercially available Maybridge database were employed as sources for potential inhibitors. A cell-based biological assay identified two compounds with 10 ?M MIC activity.
Related JoVE Video
New yellow-emitting Whitlockite-type structure Sr(1.75)Ca(1.25)(PO4)2:Eu(2+) phosphor for near-UV pumped white light-emitting devices.
Inorg Chem
PUBLISHED: 04-29-2014
Show Abstract
Hide Abstract
New compound discovery is of interest in the field of inorganic solid-state chemistry. In this work, a whitlockite-type structure Sr1.75Ca1.25(PO4)2 newly found by composition design in the Sr3(PO4)2-Ca3(PO4)2 join was reported. Crystal structure and luminescence properties of Sr1.75Ca1.25(PO4)2:Eu(2+) were investigated, and the yellow-emitting phosphor was further employed in fabricating near-ultraviolet-pumped white light-emitting diodes (w-LEDs). The structure and crystallographic site occupancy of Eu(2+) in the host were identified via X-ray powder diffraction refinement using Rietveld method. The Sr1.75Ca1.25(PO4)2:Eu(2+) phosphors absorb in the UV-vis spectral region of 250-430 nm and exhibit an intense asymmetric broadband emission peaking at 518 nm under ?ex = 365 nm which is ascribed to the 5d-4f allowed transition of Eu(2+). The luminescence properties and mechanism are also investigated as a function of Eu(2+) concentration. A white LED device which is obtained by combining a 370 nm UV chip with commercial blue phosphor and the present yellow phosphor has been fabricated and exhibit good application properties.
Related JoVE Video
Nickel(II)-Catalyzed Asymmetric Propargyl and Allyl Claisen Rearrangements to Allenyl- and Allyl-Substituted ?-Ketoesters.
Angew. Chem. Int. Ed. Engl.
PUBLISHED: 04-24-2014
Show Abstract
Hide Abstract
Highly efficient catalytic asymmetric Claisen rearrangements of O-propargyl ?-ketoesters and O-allyl ?-ketoesters have been accomplished under mild reaction conditions. In the presence of the chiral N,N'-dioxide/Ni(II) complex, a wide range of allenyl/allyl-substituted all-carbon quaternary ?-ketoesters was obtained in generally good yield (up to 99?%) and high diastereoselectivity (up to 99:1 d.r.) with excellent enantioselectivity (up to 99?% ee).
Related JoVE Video
[Dynamic changes in expression of clara cell protein and surfactant protein-D expressions in lung tissues and bronchoalveolar lavage fluid of silica-treated rats].
Zhonghua Lao Dong Wei Sheng Zhi Ye Bing Za Zhi
PUBLISHED: 03-20-2014
Show Abstract
Hide Abstract
To investigate the dynamic changes in the expression of clara cell protein (CC16) and surfactant protein D (SP-D) in the lung tissues and bronchoalveolar lavage fluid (BALF) of silica-treated rats.
Related JoVE Video
USP33 mediates Slit-Robo signaling in inhibiting colorectal cancer cell migration.
Int. J. Cancer
PUBLISHED: 03-18-2014
Show Abstract
Hide Abstract
Originally discovered in neuronal guidance, the Slit-Robo pathway is emerging as an important player in human cancers. However, its involvement and mechanism in colorectal cancer (CRC) remains to be elucidated. Here, we report that Slit2 expression is reduced in CRC tissues compared with adjacent noncancerous tissues. Extensive promoter hypermethylation of the Slit2 gene has been observed in CRC cells, which provides a mechanistic explanation for the Slit2 downregulation in CRC. Functional studies showed that Slit2 inhibits CRC cell migration in a Robo-dependent manner. Robo-interacting ubiquitin-specific protease 33 (USP33) is required for the inhibitory function of Slit2 on CRC cell migration by deubiquitinating and stabilizing Robo1. USP33 expression is downregulated in CRC samples, and reduced USP33 mRNA levels are correlated with increased tumor grade, lymph node metastasis and poor patient survival. Taken together, our data reveal USP33 as a previously unknown tumor-suppressing gene for CRC by mediating the inhibitory function of Slit-Robo signaling on CRC cell migration. Our work suggests the potential value of USP33 as an independent prognostic marker of CRC.
Related JoVE Video
Cloning and identification of Group 1 mrp operon encoding a novel monovalent cation/proton antiporter system from the moderate halophile Halomonas zhaodongensis.
Extremophiles
PUBLISHED: 03-10-2014
Show Abstract
Hide Abstract
The novel species Halomonas zhaodongensis NEAU-ST10-25(T) recently identified by our group is a moderate halophile which can grow at the range of 0-2.5 M NaCl (optimum 0.5 M) and pH 6-12 (optimum pH 9). To explore its halo-alkaline tolerant mechanism, genomic DNA was screened from NEAU-ST10-25(T) in this study for Na(+)(Li(+))/H(+) antiporter genes by selection in Escherichia coli KNabc lacking three major Na(+)(Li(+))/H(+) antiporters. One mrp operon could confer tolerance of E. coli KNabc to 0.8 M NaCl and 100 mM LiCl, and an alkaline pH. This operon was previously mainly designated mrp (also mnh, pha or sha) due to its multiple resistance and pH-related activity. Here, we will also use mrp to designate the homolog from H. zhaodongensis (Hz_mrp). Sequence analysis and protein alignment showed that Hz_mrp should belong to Group 1 mrp operons. Further phylogenetic analysis reveals that Hz_Mrp system should represent a novel sub-class of Group 1 Mrp systems. This was confirmed by a significant difference in pH-dependent activity profile or the specificity and affinity for the transported monovalent cations between Hz_Mrp system and all the known Mrp systems. Therefore, we propose that Hz_Mrp should be categorized as a novel Group 1 Mrp system.
Related JoVE Video
Exploring type II microcalcifications in benign and premalignant breast lesions by shell-isolated nanoparticle-enhanced Raman spectroscopy (SHINERS).
Spectrochim Acta A Mol Biomol Spectrosc
PUBLISHED: 03-08-2014
Show Abstract
Hide Abstract
The characteristics of type II microcalcifications in fibroadenoma (FB), atypical ductal hyperplasia (ADH), and ductal carcinoma in situ (DCIS) breast tissues has been analyzed by the fingerprint features of Raman spectroscopy. Fresh breast tissues were first handled to frozen sections and then they were measured by normal Raman spectroscopy. Due to inherently low sensitivity of Raman scattering, Au@SiO2 shell-isolated nanoparticle-enhanced Raman spectroscopy (SHINERS) technique was utilized. A total number of 71 Raman spectra and 70 SHINERS spectra were obtained from the microcalcifications in benign and premalignant breast tissues. Principal component analysis (PCA) was used to distinguish the type II microcalcifications between these tissues. This is the first time to detect type II microcalcifications in premalignant (ADH and DCIS) breast tissue frozen sections, and also the first time SHINERS has been utilized for breast cancer detection. Conclusions demonstrated in this paper confirm that SHINERS has great potentials to be applied to the identification of breast lesions as an auxiliary method to mammography in the early diagnosis of breast cancer.
Related JoVE Video
A monoclonal antibody targeting neuropilin-1 inhibits adhesion of MCF7 breast cancer cells to fibronectin by suppressing the FAK/p130cas signaling pathway.
Anticancer Drugs
PUBLISHED: 03-04-2014
Show Abstract
Hide Abstract
Neuropilin-1 (NRP-1) is a nontyrosine kinase coreceptor for semaphorin 3A and the vascular endothelial growth factor involved in tumor angiogenesis, growth, and metastasis and is regarded as a promising target for cancer therapy. In the present study, we investigated the effects of an anti-NRP-1 monoclonal antibody (mAb) that we generated for MCF7 breast cancer cellular adhesion studies. MTT, colony formation, and adhesion assays showed that our anti-NRP-1 mAb dose-dependently inhibited MCF7 proliferation and fibronectin adhesion, leading to a rounded cellular morphology. Further, rhodamine phalloidin stain revealed that fibronectin-dependent formation of actin stress fibers was inhibited by anti-NRP-1 mAb. Immunoprecipitation and western blot showed that anti-NRP-1 mAb treatment inhibited the formation of NRP-1-?5?1 integrin complexes and suppressed the phosphorylation of focal adhesion kinase and p130cas in MCF7 cells. These findings contribute to further understanding the NRP-1 function in cell adhesion and tumor metastasis. Moreover, our anti-NRP-1 mAb is a prospective drug candidate for tumor treatment.
Related JoVE Video
Transcriptome analysis of the Bombyx mori fat body after constant high temperature treatment shows differences between the sexes.
Mol. Biol. Rep.
PUBLISHED: 02-25-2014
Show Abstract
Hide Abstract
Ambient temperature plays a large role in insect growth, development and even their distribution. The elucidation of the associated molecular mechanism that underlies the effect of constant high temperature will enables us to further understand the stress responses. We constructed four digital gene expression libraries from the fat body of female and male Bombyx mori. Differential gene expression was analyzed after constant high temperature treatment. The results showed that there were significant changes to the gene expression in the fat body after heat treatment, especially in binding, catalytic, cellular and metabolic processes. Constant high temperature may induce more traditional cryoprotectants, such as glycerol, glycogen, sorbitol and lipids, to protect cells from damage, and induce heat oxidative stress in conjunction with the heat shock proteins. The data also indicated a difference between males and females. The heat shock protein-related genes were up-regulated in both sexes but the expression of Hsp25.4 and DnaJ5 were down-regulated in the male fat body of B. mori. This is the first report of such a result. Constant high temperature also affected the expression of other functional genes and differences were observed between male and female fat bodies in the expression of RPS2, RPL37A and MREL. These findings provide abundant data on the effect of high temperature on insects at the molecular level. The data will also be beneficial to the study of differences between the sexes, manifested in variations in gene expression under high temperature.
Related JoVE Video
Clinical prognostic value of CD4+CD25+FOXP3+regulatory T cells in peripheral blood of Barcelona Clinic Liver Cancer (BCLC) stage B hepatocellular carcinoma patients.
Clin. Chem. Lab. Med.
PUBLISHED: 02-24-2014
Show Abstract
Hide Abstract
CD4+CD25+ forkhead box P3 (FOXP3)+ regulatory T cells (Tregs) accumulate in malignant tumors and negatively regulate antitumor immunity. However, the clinical significance of Tregs in HCC remains unclear. To determine the prognostic value of Tregs, we conducted a retrospective study on 264 patients with Barcelona Clinic Liver Cancer (BCLC) stage B hepatocellular carcinoma (HCC) who underwent transcatheter arterial chemoembolization (TACE).
Related JoVE Video
The effects of CES1A2 A(-816)C and CYP2C19 loss-of-function polymorphisms on clopidogrel response variability among Chinese patients with coronary heart disease.
Pharmacogenet. Genomics
PUBLISHED: 02-19-2014
Show Abstract
Hide Abstract
Carboxylesterase 1 hydrolyzes the majority of clopidogrel to the inactive metabolite. The aim of this study was to assess the effects of the CES1A2 A(-816)C polymorphism and other genetic and clinical factors on clopidogrel response variability. An additional aim was to investigate the relationship between genetic variations and development of stent thrombosis (ST).
Related JoVE Video
Structure-based programming of lymph-node targeting in molecular vaccines.
Nature
PUBLISHED: 02-16-2014
Show Abstract
Hide Abstract
In cancer patients, visual identification of sentinel lymph nodes (LNs) is achieved by the injection of dyes that bind avidly to endogenous albumin, targeting these compounds to LNs, where they are efficiently filtered by resident phagocytes. Here we translate this 'albumin hitchhiking' approach to molecular vaccines, through the synthesis of amphiphiles (amph-vaccines) comprising an antigen or adjuvant cargo linked to a lipophilic albumin-binding tail by a solubility-promoting polar polymer chain. Administration of structurally optimized CpG-DNA/peptide amph-vaccines in mice resulted in marked increases in LN accumulation and decreased systemic dissemination relative to their parent compounds, leading to 30-fold increases in T-cell priming and enhanced anti-tumour efficacy while greatly reducing systemic toxicity. Amph-vaccines provide a simple, broadly applicable strategy to simultaneously increase the potency and safety of subunit vaccines.
Related JoVE Video
Pregnenolone, a cholesterol metabolite, induces glioma cell apoptosis via activating extrinsic and intrinsic apoptotic pathways.
Oncol Lett
PUBLISHED: 02-07-2014
Show Abstract
Hide Abstract
Gliomas are one of the most common types of malignant tumors worldwide, however, an effective therapeutic strategy not yet been fully determined. The present study aimed to investigate the anti-glioma activity and underlying mechanisms of pregnenolone, which originates from cholesterol and is metabolized into important steroid hormones in the body. The results demonstrated that 100 ?M pregnenolone induced a significant loss of cell viability in various malignant glioma cell lines. In the U-87 MG, LN-18 and C6 cell lines, the loss of cell viability resulted from cell apoptosis, which was evidenced by apoptotic nuclear morphology changes and caspase 3 activation. Moreover, the increased activities of caspase 8 and 9 strongly indicated that pregnenolone activated the extrinsic and intrinsic pathways of apoptosis. Additionally, glioma cell apoptosis was prevented by the general caspase inhibitor, Z-VAD-FMK. In the C6 cells, upregulation of Fas and Fas ligand triggered the activation of the extrinsic pathway, whereas knockdown of Fas significantly abrogated the cell apoptosis that was induced by pregnenolone. Furthermore, downregulation of the anti-apoptotic protein, B-cell lymphoma 2 and upregulation of pro-apoptotic proteins, such as Bax and Bak, activated the intrinsic pathway. In conclusion, pregnenolone induced glioma cell apoptosis in a caspase-dependent manner, which was mediated by activation of the extrinsic and intrinsic apoptotic pathways.
Related JoVE Video
Prognostic significance of soft tissue extension, international prognostic index, and multifocality in primary bone lymphoma: a single institutional experience.
Br. J. Haematol.
PUBLISHED: 02-05-2014
Show Abstract
Hide Abstract
Primary bone lymphoma (PBL) is a rare disease. The literature is inconsistent in regard to definition, stage and prognostic factors. We examined the PBL cases seen at the Moffitt Cancer Center between 1998 and 2013 using the 2013 World Health Organization criteria for bone/soft tissue tumours. Seventy PBL patients were included, of whom 53 (75.7%) patients were histologically classified as primary bone diffuse large B-cell lymphoma (PB-DLBCL). Femur was the most commonly involved site in PBLs with unifocal bone lesions, whereas PBLs with multifocal bone lesions most frequently presented with spine disease. Further analysis of the PB-DLBCL subgroup showed that these patients had 3- and 5-year progression-free survival (PFS) of 61.2% and 46.9%, respectively and 5- and 10-year overall survival (OS) of 81.1% and 74.7%, respectively. Multivariate analysis identified soft tissue extension and International Prognostic Index (IPI) score as the most important unfavourable prognostic factors for both PFS and OS. Multifocality was also highly significantly associated with a worse PFS (P = 0.002) and OS (P < 0.001), although it was not identified in multivariate analysis due to its incorporation into the IPI. The results warrant further investigation regarding whether PBL with multifocal bone lesions could be considered as a systemic and more aggressive disease rather than a conventional PBL.
Related JoVE Video
Hypoxia enhances protective effect of placental-derived mesenchymal stem cells on damaged intestinal epithelial cells by promoting secretion of insulin-like growth factor-1.
Int J Mol Sci
PUBLISHED: 01-20-2014
Show Abstract
Hide Abstract
Apoptosis and necrosis of intestinal epithelial cells (IECs), induced by ischemia-reperfusion (I/R) injury, can lead to dysfunction of the intestinal barrier, which could cause multiple organ dysfunction syndromes. Mesenchymal stem cells (MSCs) have the potential of providing protective effects on damaged IECs via paracrine action. This study investigated whether hypoxia can enhance the protective effect of placental-derived MSCs (pMSCs) on H2O2-treated-caco2 cells, and explored the possible mechanism. The pMSCs isolated by tissue culture were fibroblast-like, positive for CD73, CD90 and CD105 and can differentiate into chondrocytes and endothelial cells. Five days after treatment with H2O2, the numbers of living caco2 cells significantly decreased. More live H2O2-treated-caco2 cells were observed in pMSCs hypoxia culture medium (pMSCs-HCM) than pMSCs normoxia culture medium (pMSCs-NCM), and the application of a specific antibody that blocked insulin-like growth factor-1 (IGF-1) leads to a significant decrease of the protective effect of pMSCs-HCM. Hypoxia can promote IGF-1 expression of pMSCs at mRNA and protein levels, and caco2 stably expressed IGF-1 receptor. Knocking down IGF-1 expression in pMSCs by siRNA resulted in a significant attenuation of the increase in apoptosis of H2O2-treated-caco2 cultured in pMSCs-HCM. In conclusion, hypoxia can increase the protective effect of pMSCs on H2O2-treated-caco2 cells via a promotion of their paracrine actions, and the key cytokine involved is IGF-1.
Related JoVE Video
TLR3 regulates mycobacterial RNA-induced IL-10 production through the PI3K/AKT signaling pathway.
Cell. Signal.
PUBLISHED: 01-16-2014
Show Abstract
Hide Abstract
Cytokine induction in response to Mycobacterium tuberculosis (Mtb) infection is critical for pathogen control, by (i) mediating innate immune effector functions and (ii) instructing specific adaptive immunity. IL-10 is an important anti-inflammatory cytokine involved in pathogenesis of tuberculosis (TB). Here, we show that TLR3, a sensor of extracellular viral or host RNA with stable stem structures derived from infected or damaged cells, is essential for Mtb-induced IL-10 production. Upon Mycobacterium bovis Bacillus Calmette-Guérin (BCG) infection, TLR3(-/-) macrophages expressed lower IL-10 but higher IL-12p40 production, accompanied by reduced phosphorylation of AKT at Ser473. BCG-infected TLR3(-/-) mice exhibited reduced IL-10 but elevated IL-12 expression compared to controls. Moreover, higher numbers of splenic Th1 cells and reduced pulmonary bacterial burden and tissue damage were observed in BCG-infected TLR3(-/-) mice. Finally, BCG RNA induced IL-10 in macrophages via TLR3-mediated activation of PI3K/AKT. Our findings demonstrate a critical role of TLR3-mediated regulation in the pathogenesis of mycobacterial infection involving mycobacterial RNA, which induces IL-10 through the PI3K/AKT signaling pathway.
Related JoVE Video
Cutaneous gamma-delta T-cell lymphoma with central nervous system involvement: report of a rarity with review of literature.
J. Cutan. Pathol.
PUBLISHED: 01-15-2014
Show Abstract
Hide Abstract
Primary cutaneous gamma-delta (??) T-cell lymphoma is an extremely rare and aggressive variant of cutaneous lymphoma. Central nervous system (CNS) involvement, a rare finding, and hemophagocytic syndrome are two complications that are commonly fatal. We describe a 58-year-old patient presenting with skin plaque who subsequently developed subcutaneous nodules diagnosed as cutaneous T-cell lymphoma (CTCL), clinically resembling 'mycosis fungoides'. The patient was treated with repeat topical radiation therapies but had frequent relapsed disease. Approximately 4.5 years after, the patient presented with third and sixth cranial nerve palsies and was found to have CNS involvement by lymphoma per positron emission tomography-computed tomography (PET/CT) and a biopsy of foramen magnum. Phenotypically, the tumor cells were CD3(+)/CD4(-)/CD8(-)/CD7(+)/CD5(-)/CD30(-)/TCR??(-)/TCR??(+). Despite aggressive strategies taken, the patient expired 3 months after the diagnosis of the CNS lesion. A retrospective investigation proved the original CTCL to be ?? T-cell in origin, confirming an indolent cutaneous ?? T-cell lymphoma with eventual CNS manifestation. We present this case to draw attention to the entity, which can occasionally present with misleading histopathologic and clinical features. In addition, we provide a review of the literature to summarize clinical and pathologic features of the reported similar cases.
Related JoVE Video
Comparative study of aerogels obtained from differently prepared nanocellulose fibers.
ChemSusChem
PUBLISHED: 01-13-2014
Show Abstract
Hide Abstract
This article describes the fabrication of nanocellulose fibers (NCFs) with different morphologies and surface properties from biomass resources as well as their self-aggregation into lightweight aerogels. By carefully modulating the nanofibrillation process, four types of NCFs could be readily fabricated, including long aggregated nanofiber bundles, long individualized nanofibers with surface C6 -carboxylate groups, short aggregated nanofibers, and short individualized nanofibers with surface sulfate groups. Free-standing lightweight aerogels were obtained from the corresponding aqueous NCF suspensions through freeze-drying. The structure of the aerogels could be controlled by manipulating the type of NCFs and the concentration of their suspensions. A possible mechanism for the self-aggregation of NCFs into two- or three-dimensional aerogel nanostructures was further proposed. Owing to web-like structure, high porosity, and high surface reactivity, the NCF aerogels exhibited high mechanical flexibility and ductility, and excellent properties for water uptake, removal of dye pollutants, and the use as thermal insulation materials. The aerogels also displayed sound-adsorption capability at high frequencies.
Related JoVE Video
Synchronization control of memristor-based recurrent neural networks with perturbations.
Neural Netw
PUBLISHED: 01-12-2014
Show Abstract
Hide Abstract
In this paper, the synchronization control of memristor-based recurrent neural networks with impulsive perturbations or boundary perturbations is studied. We find that the memristive connection weights have a certain relationship with the stability of the system. Some criteria are obtained to guarantee that memristive neural networks have strong noise tolerance capability. Two kinds of controllers are designed so that the memristive neural networks with perturbations can converge to the equilibrium points, which evoke human's memory patterns. The analysis in this paper employs the differential inclusions theory and the Lyapunov functional method. Numerical examples are given to show the effectiveness of our results.
Related JoVE Video
Surgical correction of blepharoptosis using a modified levator aponeurosis-Müller muscle complex reinsertion technique.
J Craniofac Surg
PUBLISHED: 01-11-2014
Show Abstract
Hide Abstract
The purpose of this study was to evaluate the outcomes after ptosis correction surgery using a modified levator aponeurosis-Müller muscle complex reinsertion technique. In this clinical study, 75 eyelids of 49 patients with congenital blepharoptosis were treated with the modified technique. The results, including complications, were followed up and evaluated. Operation was performed via anterior transcutaneous incision. After separating the preseptal orbicularis oculi muscle, the levator complex, including Müller muscle and the levator aponeurosis, was visualized. The levator complex was cut into 2 parts at the top of the conjunctival fornix to create an upper portion and a lower portion. The detached lower portion of the complex flap combined with the tarsal plate was advanced superiorly and reinserted into the posterior aspect of the upper portion of the complex flap by using 3 horizontal mattress sutures. Preoperative ptosis severity was compared with the degree of ptosis correction using the Cochran-Mantel-Haenszel test. Preoperative levator function was compared with the degree of ptosis correction and the postoperative levator function using Fisher exact test for paired data. Sufficient postoperative correction of ptosis was achieved in 78.7% of eyelids. Postoperative levator function of more than 4 mm was achieved in 82.7% of all eyelids that underwent surgery. We conclude that the modified levator aponeurosis-Müller muscle complex reinsertion technique is effective for correcting congenital blepharoptosis, especially in patients with fair to good (>4 mm) preoperative levator function.
Related JoVE Video
Depression-like behaviors in mice subjected to co-treatment of high-fat diet and corticosterone are ameliorated by AICAR and exercise.
J Affect Disord
PUBLISHED: 01-07-2014
Show Abstract
Hide Abstract
Major depressive disorder (MDD) and type II diabetes mellitus (T2DM) are highly co-morbid, and there may be a bi-directional connection between the two. Herein, we have described a mouse model of a depression-like and insulin-resistant (DIR) state induced by the co-treatment of high-fat diet (HFD) and corticosterone (CORT). 5-Aminoimidazole-4-carboxamide-1-?-d- ribofuranoside (AICAR), a pharmacological activator of AMP-activated protein kinase (AMPK), was originally used to improve insulin resistance (IR). Interestingly, our results show a clear potential for AICAR as a putative antidepressant with a chronic action on the DIR mice. In contrast to the traditional antidepressants, AICAR as a promising antidepressant avoids reducing insulin actions of skeletal muscle in the context of long-term HFD. Exercise also produced antidepressant effects. Our data suggest that the effects of AICAR and exercise on DIR may further increase our understanding on the link between depression and diabetes.
Related JoVE Video
Identification of a Bombyx mori gene encoding small heat shock protein BmHsp27.4 expressed in response to high-temperature stress.
Gene
PUBLISHED: 01-06-2014
Show Abstract
Hide Abstract
Elucidating the mechanisms underlying the response and resistance to high-temperature stress in the Lepidoptera is essential for understanding the effect of high-temperature on the regulation of gene expression. A tag (CATGAACGTGAAGAGATTCAG) matching the predicted gene BGIBMGA005823-TA in SilkDB identified the most significant response to high-temperature stress in a screen of the heat-treated digital gene expression library of Bombyx mori (B. mori) (Unpublished data). BLAST and RACE showed that the gene is located on chromosome 5 and has an open reading frame (ORF) of 741bp. Phylogenetic analysis found that B. mori small heat shock protein 27.4 (BmHSP27.4) is in an evolutionary branch separate from other small heat shock proteins. Expression analysis showed that BmHsp27.4 is highly expressed in brain, eyes and fat bodies in B. mori. Its mRNA level was elevated at high-temperature and this increase was greater in females. The ORF without the signal peptide sequence was cloned into vector pET-28a(+), transformed and over-expressed in Escherichia coli Rosetta (DE3). Western blotting and immunofluorescence analysis with a polyclonal antibody, confirmed that the level of protein BmHSP27.4 increased at a high-temperature, in accordance with its increased mRNA level. In this study, BmHsp27.4 was identified as a novel B. mori gene with an important role in response to high-temperature stress.
Related JoVE Video
Antioxidant activity in vitro and hepatoprotective effect of phlomis maximowiczii in vivo.
Afr J Tradit Complement Altern Med
PUBLISHED: 01-01-2014
Show Abstract
Hide Abstract
A number of medicinal plants and there compounds played a major role in the treatment of hepatic disorders. They were widely used for the treatment of these disorders, and oxidant stress injury was one of the liver injury mechanisms. The present study evaluated the antioxidant activity and the hepatoprotective effect of each extracts of Phlomis maximowiczii.
Related JoVE Video
Clock Gene Modulates Roles of OXTR and AVPR1b Genes in Prosociality.
PLoS ONE
PUBLISHED: 01-01-2014
Show Abstract
Hide Abstract
The arginine vasopressin receptor (AVPR) and oxytocin receptor (OXTR) genes have been demonstrated to contribute to prosocial behavior. Recent research has focused on the manner by which these simple receptor genes influence prosociality, particularly with regard to the AVP system, which is modulated by the clock gene. The clock gene is responsible for regulating the human biological clock, affecting sleep, emotion and behavior. The current study examined in detail whether the influences of the OXTR and AVPR1b genes on prosociality are dependent on the clock gene.
Related JoVE Video
iDrug: a web-accessible and interactive drug discovery and design platform.
J Cheminform
PUBLISHED: 01-01-2014
Show Abstract
Hide Abstract
The progress in computer-aided drug design (CADD) approaches over the past decades accelerated the early-stage pharmaceutical research. Many powerful standalone tools for CADD have been developed in academia. As programs are developed by various research groups, a consistent user-friendly online graphical working environment, combining computational techniques such as pharmacophore mapping, similarity calculation, scoring, and target identification is needed.
Related JoVE Video
Human urine-derived stem cells alone or genetically-modified with FGF2 Improve type 2 diabetic erectile dysfunction in a rat model.
PLoS ONE
PUBLISHED: 01-01-2014
Show Abstract
Hide Abstract
The aim of this study was to determine the possibility of improving erectile dysfunction using cell therapy with either human urine-derived stem cells (USCs) or USCs genetically-modified with FGF2 in a type 2 diabetic rat model.
Related JoVE Video
A study on isolation of chemical constituents from Sophora flavescens Ait. and their anti-glioma effects.
Afr J Tradit Complement Altern Med
PUBLISHED: 01-01-2014
Show Abstract
Hide Abstract
Sophora flavescens Ait. is a traditional Chinese medicine with a long history in China. It is mainly used in the treatment of heat dysentery and similar ailments in the clinical. The objective of this paper was to isolate, purify and identify alkaloids from Sophora flavescens Ait. and to explore their inhibitory effects on C6 glioma cells.
Related JoVE Video
Prostate stem cell antigen and cancer risk, mechanisms and therapeutic implications.
Expert Rev Anticancer Ther
PUBLISHED: 11-26-2013
Show Abstract
Hide Abstract
Prostate stem cell antigen (PSCA) was originally identified as a tumor antigen in prostate cancer. Recent studies indicated that PSCA was correlated with many cancer types. In this review, we will consider the origin of PSCA, discuss the expression of PSCA in normal and cancer tissue, describe PSCA polymorphisms and cancer risk, summarize potential mechanisms for PSCA involvement in cancer; and look into the therapeutic implications of PSCA. PSCA is upregulated in prostate cancer, pancreatic cancer and bladder cancer, as well as a number of others, making it an ideal clinical target for both diagnosis and therapy. Future studies will be required to explore its mechanisms on various cancer types, and to confirm its clinical utility for diagnosis and immunotherapy strategies. The study of PSCA regulation and expression may also provide information on normal prostate development and prostate carcinogenesis.
Related JoVE Video
?-Sialon nanowires, nanobelts and hierarchical nanostructures: morphology control, growth mechanism and cathodoluminescence properties.
Nanoscale
PUBLISHED: 11-11-2013
Show Abstract
Hide Abstract
Morphology control of one dimension (1D) nanomaterials is a pivotal issue in the field of nanoscience research to exploit their novel properties. Herein, we report the morphology controlled synthesis of 1D ?-Sialon nanowires, nanobelts and hierarchical nanostructures via a thermal-chemical vapour deposition process using an appropriately selected catalyst and optimized temperature schedule. Vapour-solid (VS), a combination of vapour-liquid-solid (VLS)-based and VS-tip, and a combination of VS for one-generation nanowires with nucleation, growth and coalescence of two-generation nanobranches (NGCB) are used to explain the growth of ?-Sialon nanowires, nanobelts and hierarchical nanostructures, respectively. Cathodoluminescence measurements show that the individual ?-Sialon 1D nanostructures with different morphologies have different luminescent properties. All nanostructures exhibit two distinct emission peaks, the violet/blue emission centered at ?390 nm (3.18 eV), attributable to the near band edge (NBE) emission, and the red emission centered at ?728 nm (1.70 eV), assigned to the deep level (DL) emission. However, the DL emission is the ruling emission in the case of an individual ?-Sialon nanowire, whereas the NBE emission becomes dominant in the case of an individual nanobelt as well as a hierarchical nanostructure due to the size and surface effects. The as-synthesized ?-Sialon with controlled nanostructures and various morphologies can find potential applications in future nanodevices with tailorable or tunable photoelectric properties.
Related JoVE Video
Modality-based organization of ascending somatosensory axons in the direct dorsal column pathway.
J. Neurosci.
PUBLISHED: 11-08-2013
Show Abstract
Hide Abstract
The long-standing doctrine regarding the functional organization of the direct dorsal column (DDC) pathway is the "somatotopic map" model, which suggests that somatosensory afferents are primarily organized by receptive field instead of modality. Using modality-specific genetic tracing, here we show that ascending mechanosensory and proprioceptive axons, two main types of the DDC afferents, are largely segregated into a medial-lateral pattern in the mouse dorsal column and medulla. In addition, we found that this modality-based organization is likely to be conserved in other mammalian species, including human. Furthermore, we identified key morphological differences between these two types of afferents, which explains how modality segregation is formed and why a rough "somatotopic map" was previously detected. Collectively, our results establish a new functional organization model for the mammalian direct dorsal column pathway and provide insight into how somatotopic and modality-based organization coexist in the central somatosensory pathway.
Related JoVE Video
Interrelationship among common medical complications after acute stroke: pneumonia plays an important role.
Stroke
PUBLISHED: 10-31-2013
Show Abstract
Hide Abstract
Medical complications are common among patients with stroke. However, little is known about the potential interrelationship among them. In the present study, we aimed to investigate the association between common in-hospital medical complications after acute ischemic stroke (AIS) and spontaneous intracerebral hemorrhage (ICH).
Related JoVE Video
Tools for characterizing bacterial protein synthesis inhibitors.
Antimicrob. Agents Chemother.
PUBLISHED: 09-16-2013
Show Abstract
Hide Abstract
Many antibiotics inhibit the growth of sensitive bacteria by interfering with ribosome function. However, discovery of new protein synthesis inhibitors is curbed by the lack of facile techniques capable of readily identifying antibiotic target sites and modes of action. Furthermore, the frequent rediscovery of known antibiotic scaffolds, especially in natural product extracts, is time-consuming and expensive and diverts resources that could be used toward the isolation of novel lead molecules. In order to avoid these pitfalls and improve the process of dereplication of chemically complex extracts, we designed a two-pronged approach for the characterization of inhibitors of protein synthesis (ChIPS) that is suitable for the rapid identification of the site and mode of action on the bacterial ribosome. First, we engineered antibiotic-hypersensitive Escherichia coli strains that contain only one rRNA operon. These strains are used for the rapid isolation of resistance mutants in which rRNA mutations identify the site of the antibiotic action. Second, we show that patterns of drug-induced ribosome stalling on mRNA, monitored by primer extension, can be used to elucidate the mode of antibiotic action. These analyses can be performed within a few days and provide a rapid and efficient approach for identifying the site and mode of action of translation inhibitors targeting the bacterial ribosome. Both techniques were validated using a bacterial strain whose culture extract, composed of unknown metabolites, exhibited protein synthesis inhibitory activity; we were able to rapidly detect the presence of the antibiotic chloramphenicol.
Related JoVE Video
Expression and immune characterization of a novel enzyme, protein arginine methyltransferase 1, from Schistosoma japonicum.
Parasitol. Res.
PUBLISHED: 09-15-2013
Show Abstract
Hide Abstract
Protein arginine methyltransferase 1 (PRMT1) is an arginine-specific protein methyltransferase that methylates a number of proteins involved in transcription and RNA metabolism in all parasitic helminths, including the human blood fluke, Schistosoma japonicum. To characterize the role of PRMT1 in the development of S. japonicum and to investigate its influence on parasite-host interactions, we cloned and expressed the protein from an existing cDNA library. We report that the clone encoded a polypeptide comprising 360 amino acids with a predictive Mr of 42 kDa. Bioinformatic analyses predicted that there were many potential B cell epitopes and T cell epitopes associated with SjcPRMT1, suggesting it is a potential candidate molecule for vaccine development. The purified recombinant protein of S. japonicum (Chinese strain) (rSjcPRMT1) was found to be immunogenic, eliciting a high antibody titer in mice. Moreover, Western blot analysis revealed that the protein could be recognized by the sera of infected mice. Using flow cytometry, we showed that rSjcPRMT1 slightly upregulated the expression of CD40, CD80, CD86, and MHC-II molecules of mouse bone marrow-derived dendritic cell (BMDC), indicating that rSjcPRMT1 could induce mouse BMDC to mature and, therefore, activate their immune response. Overall, our findings provide evidence that rSjcPRMT1 could serve as an effective candidate molecule for the development of a vaccine against infection with S. japonicum.
Related JoVE Video
Fangjihuangqi tang improved lower urinary tract dysfunction in benign prostatic hyperplasia rats model.
J Tradit Chin Med
PUBLISHED: 09-13-2013
Show Abstract
Hide Abstract
To investigated the effect and mechanism of Fangjihuangqi Tang (FHT) on lower urinary tract dysfunction induced by benign prostatic hyperplasia (BPH) in rats.
Related JoVE Video
[Building and application of hospitals electronic film system].
Zhongguo Yi Liao Qi Xie Za Zhi
PUBLISHED: 09-11-2013
Show Abstract
Hide Abstract
This paper describes the design process and implementation process of electronic film system. The establishment of electronic film system allowed us to aggressively reduce film use and costs and to demonstrate a positive return.
Related JoVE Video
Deconvolution estimation of mixture distributions with boundaries.
Electron J Stat
PUBLISHED: 09-07-2013
Show Abstract
Hide Abstract
In this paper, motivated by an important problem in evolutionary biology, we develop two sieve type estimators for distributions that are mixtures of a finite number of discrete atoms and continuous distributions under the framework of measurement error models. While there is a large literature on deconvolution problems, only two articles have previously addressed the problem taken up in our article, and they use relatively standard Fourier deconvolution. As a result the estimators suggested in those two articles are degraded seriously by boundary effects and negativity. A major contribution of our article is correct handling of boundary effects; our method is asymptotically unbiased at the boundaries, and also is guaranteed to be nonnegative. We use roughness penalization to improve the smoothness of the resulting estimator and reduce the estimation variance. We illustrate the performance of the proposed estimators via our real driving application in evolutionary biology and two simulation studies. Furthermore, we establish asymptotic properties of the proposed estimators.
Related JoVE Video
HIV-1 protease cleavage site prediction based on two-stage feature selection method.
Protein Pept. Lett.
PUBLISHED: 09-05-2013
Show Abstract
Hide Abstract
Knowledge of the mechanism of HIV protease cleavage specificity is critical to the design of specific and effective HIV inhibitors. Searching for an accurate, robust, and rapid method to correctly predict the cleavage sites in proteins is crucial when searching for possible HIV inhibitors. In this article, HIV-1 protease specificity was studied using the correlation-based feature subset (CfsSubset) selection method combined with Genetic Algorithms method. Thirty important biochemical features were found based on a jackknife test from the original data set containing 4,248 features. By using the AdaBoost method with the thirty selected features the prediction model yields an accuracy of 96.7% for the jackknife test and 92.1% for an independent set test, with increased accuracy over the original dataset by 6.7% and 77.4%, respectively. Our feature selection scheme could be a useful technique for finding effective competitive inhibitors of HIV protease.
Related JoVE Video
Inter- and intra-chain disulfide bond prediction based on optimal feature selection.
Protein Pept. Lett.
PUBLISHED: 09-05-2013
Show Abstract
Hide Abstract
Protein disulfide bond is formed during post-translational modifications, and has been implicated in various physiological and pathological processes. Proper localization of disulfide bonds also facilitates the prediction of protein three-dimensional (3D) structure. However, it is both time-consuming and labor-intensive using conventional experimental approaches to determine disulfide bonds, especially for large-scale data sets. Since there are also some limitations for disulfide bond prediction based on 3D structure features, developing sequence-based, convenient and fast-speed computational methods for both inter- and intra-chain disulfide bond prediction is necessary. In this study, we developed a computational method for both types of disulfide bond prediction based on maximum relevance and minimum redundancy (mRMR) method followed by incremental feature selection (IFS), with nearest neighbor algorithm as its prediction model. Features of sequence conservation, residual disorder, and amino acid factor are used for inter-chain disulfide bond prediction. And in addition to these features, sequential distance between a pair of cysteines is also used for intra-chain disulfide bond prediction. Our approach achieves a prediction accuracy of 0.8702 for inter-chain disulfide bond prediction using 128 features and 0.9219 for intra-chain disulfide bond prediction using 261 features. Analysis of optimal feature set indicated key features and key sites for the disulfide bond formation. Interestingly, comparison of top features between interand intra-chain disulfide bonds revealed the similarities and differences of the mechanisms of forming these two types of disulfide bonds, which might help understand more of the mechanisms and provide clues to further experimental studies in this research field.
Related JoVE Video
One-stage correction of blepharophimosis-ptosis-epicanthus inversus syndrome using a frontalis muscle transfer technique.
J Plast Surg Hand Surg
PUBLISHED: 08-23-2013
Show Abstract
Hide Abstract
Abstract Blepharophimosis-ptosis-epicanthus inversus (BPES) is a rare genetic disease involving a complex eyelid malformation. The surgical treatment approach for BPES is highly complex and a subject of controversy. This study reports the results of a one-stage frontalis muscle transfer technique to correct BPES. This retrospective, interventional study included 21 patients with BPES who had been followed-up for a minimum of 1 year. The one-stage intervention was a combination of three surgical techniques: Mustardé medial canthoplasty, Fox lateral canthoplasty, and the frontalis muscle transfer technique. Preoperative and postoperative measurements of the horizontal lid fissure length (HLFL), vertical lid ?ssure width (VLFW), inner intercanthal distance (IICD), and the IICD/HLFL ratio were analyzed by Wilcoxons signed rank test. The mean preoperative measurements were 4.73 ± 0.32 mm for VLFW, 19.98 ± 3.74 mm for HLFL, 40.85 ± 4.46 mm for IICD, and 2.11 ± 0.45 mm for the IICD/HLFL ratio. The mean postoperative measurements were 7.86 ± 0.41 mm for VLFW, 24.47 ± 3.35 mm for HLFL, 32.52 ± 4.16 mm for IICD, and 1.35 ± 0.22 mm for the IICD/HLFL ratio (p < 0.0001 for all preoperative vs postoperative values). Postoperative complications included eyelid fold deformities, lagophthalmos, and conspicuous scars. Most of these complications gradually resolved. One-stage correction of BPES is safe and efficient with the surgical techniques described.
Related JoVE Video
Femtosecond laser-induced micropattern and Ca/P deposition on Ti implant surface and its acceleration on early osseointegration.
ACS Appl Mater Interfaces
PUBLISHED: 08-08-2013
Show Abstract
Hide Abstract
Surface microstructure and chemical composition of the implant are very important for its osseointegration in vivo. In this paper, a hierarchical micropattern covered with calcium phosphate (Ca/P phase) was obtained on titanium (Ti) implant surface by femtosecond lasers (FSL) irradiation in hydroxyapatite suspension. The hierachical micropattern as well as Ca/P phase increased osteoblastic cell adhesion. Higher expression of osteogenic markers (osteocalcin, osteopontin, and runt related transcription factor-2) on the surface treated by FSL of 2.55 J/cm(2) indicated the favorable effect of laser treatment on cell differentiation. In vivo studies were carried out to evaluate the effect of laser treatment and Ca/P deposition on the osseointegration. It showed that the binding capacity between bone and FSL-treated Ti implants was obviously stronger than that between bone and polished or sand blasting and acid etching (SLA) Ti implants. Bone trabecula surrounded the FSL-treated implants without fibrous tissue after 8-week implantation. Also, higher bone mineral density was seen surrounding the FSL-treated implants. Our in vitro and in vivo studies demonstrated that the FSL induced micropattern and Ca/P phase had positive effects on the acceleration of early osseointegration of Ti implants with bone tissue.
Related JoVE Video
A monoclonal antibody produced against Naked2.
Monoclon Antib Immunodiagn Immunother
PUBLISHED: 08-06-2013
Show Abstract
Hide Abstract
Naked2 (NKD2) is a member of the Naked family and negatively regulates canonical Wnt signaling. NKD2 may play a role in embryo development and tumor formation by affecting Wnt signaling. In the present study, we describe the establishment of a monoclonal antibody against NKD2 (anti-NKD2 MAb) through the hybridoma method. The purified anti-NKD2 MAb measured a titer of 2.56 × 10(5) against NKD2 by indirect ELISA. Western blot analysis, immunoprecipitation, and confocal microscope showed that the anti-NKD2 MAb can specifically combine NKD2 protein in SW480 and LOVO cells. Competitive inhibition assays of Western blot and indirect ELISA showed that the anti-NKD2 MAb can be blocked with NKD2(1-217) protein. The anti-NKD2 MAb would be helpful for further studies on the structure activity relationship, protein detecting, and cell-signaling pathway of NKD2.
Related JoVE Video
EEG/MEG source reconstruction with spatial-temporal two-way regularized regression.
Neuroinformatics
PUBLISHED: 07-12-2013
Show Abstract
Hide Abstract
In this work, we propose a spatial-temporal two-way regularized regression method for reconstructing neural source signals from EEG/MEG time course measurements. The proposed method estimates the dipole locations and amplitudes simultaneously through minimizing a single penalized least squares criterion. The novelty of our methodology is the simultaneous consideration of three desirable properties of the reconstructed source signals, that is, spatial focality, spatial smoothness, and temporal smoothness. The desirable properties are achieved by using three separate penalty functions in the penalized regression framework. Specifically, we impose a roughness penalty in the temporal domain for temporal smoothness, and a sparsity-inducing penalty and a graph Laplacian penalty in the spatial domain for spatial focality and smoothness. We develop a computational efficient multilevel block coordinate descent algorithm to implement the method. Using a simulation study with several settings of different spatial complexity and two real MEG examples, we show that the proposed method outperforms existing methods that use only a subset of the three penalty functions.
Related JoVE Video
Acute tryptophan depletion reduces nitric oxide synthase in the rat hippocampus.
Neurochem. Res.
PUBLISHED: 06-28-2013
Show Abstract
Hide Abstract
Acute tryptophan depletion (ATD) is extensively used to investigate the role of central serotonin (5-HT). However, several studies reported that ATD had no significant effect on central 5-HT concentration and some ATD-induced changes was independent of 5-HT in the rodent brain. Therefore, the potential mechanism of ATD might not be ascribed solely to changes in the central 5-HT system. In recent studies, evidence suggests that nitric oxide synthase (NOS) is closely associated with ATD-induced changes in modulation of cerebral blood flow and metabolism, cognitive, and locomotor activity. Thus, NOS is implicated to be an underlying factor contributing to ATD-induced changes. In the present study, the effect of ATD upon central NOS levels in the rat was evaluated. Male Sprague-Dawley (SD) rats were orally administered a tryptophan-free protein-carbohydrate mixture. Then, ATD effects upon affective behavior and spatial memory were assessed by the forced swimming test (FST) and Morris water maze test, respectively. Further, NOS activity and neuronal NOS (nNOS) protein levels in the hippocampus were measured after ATD. Our experimental results showed that ATD had no influence on affective behavior in the FST or spatial memory in SD rats. Interestingly, a significant reduction of both constitutive NOS activity and nNOS protein levels after ATD was found in the hippocampus. These findings demonstrate ATD does not influence affective behavior and spatial memory despite a direct effect on hippocampal NOS. Our study might provide a valuable clue for exploring earlier reported ATD-induced behavioral and neurochemical changes in rodents.
Related JoVE Video
Chinese primary care providers and motivating factors on performance.
Fam Pract
PUBLISHED: 06-20-2013
Show Abstract
Hide Abstract
China launched its new health care reform in 2009. One of its goals is to improve primary care system and strengthen primary care workforce. Although it has been studied internationally, motivating factors for primary care workforce have not been examined in China.
Related JoVE Video
Structure of the JmjC-domain-containing protein JMJD5.
Acta Crystallogr. D Biol. Crystallogr.
PUBLISHED: 06-14-2013
Show Abstract
Hide Abstract
The post-translational modification of histone tails is the principal process controlling epigenetic regulation in eukaryotes. The lysine methylation of histones is dynamically regulated by two distinct classes of enzymes: methyltransferases and demethylases. JMJD5, which plays an important role in cell-cycle progression, circadian rhythms and embryonic cell proliferation, has been shown to be a JmjC-domain-containing histone demethylase with enzymatic activity towards H3K36me2. Here, the crystal structure of human JMJD5 lacking the N-terminal 175 amino-acid residues is reported. The structure showed that the Gln275, Trp310 and Trp414 side chains might block the insertion of methylated lysine into the active centre of JMJD5, suppressing the histone demethylase activity of the truncated JMJD5 construct. A comparison of the structure of JMJD5 with that of FIH, a well characterized protein hydroxylase, revealed that human JMJD5 might function as a protein hydroxylase. The interaction between JMJD5 and the core histone octamer proteins indicated that the histone proteins could be potential substrates for JMJD5.
Related JoVE Video
Influence of nanostructures on the biological properties of Ti implants after anodic oxidation.
J Mater Sci Mater Med
PUBLISHED: 06-13-2013
Show Abstract
Hide Abstract
Anodic oxidation was applied to produce nanostructures on the surface of titanium (Ti) implants. The bioactivity of the Ti implants was evaluated by simulated body fluid soaking test. The biocompatibility was investigated by in vitro cell culture test. The results showed that bone-like apatite was formed on the anodized Ti surface, but not on the as-polished Ti surface after immersion in simulated body fluid for 2 weeks. Cells cultured on the anodized Ti surface showed enhanced cell adhesion and proliferation, compared to those cultured on the as-polished Ti surface. Based on these results, it can be concluded that anodic oxidation improved the bioactivity and biocompatibility of Ti surface, which was attributed to the formation of nanostructures as well as the nanostructure induced high surface roughness and hydrophilicity.
Related JoVE Video
A novel risk score to predict 1-year functional outcome after intracerebral hemorrhage and comparison with existing scores.
Crit Care
PUBLISHED: 06-01-2013
Show Abstract
Hide Abstract
Spontaneous intracerebral hemorrhage (ICH) is one of leading causes of mortality and morbidity worldwide. Several predictive models have been developed for ICH; however, none of them have been consistently used in routine clinical practice or clinical research. In the study, we aimed to develop and validate a risk score for predicting 1-year functional outcome after ICH (ICH Functional Outcome Score, ICH-FOS). Furthermore, we compared discrimination of the ICH-FOS and 8 existing ICH scores with regard to 30-day, 3-month, 6-month, and 1-year functional outcome and mortality after ICH.
Related JoVE Video

What is Visualize?

JoVE Visualize is a tool created to match the last 5 years of PubMed publications to methods in JoVE's video library.

How does it work?

We use abstracts found on PubMed and match them to JoVE videos to create a list of 10 to 30 related methods videos.

Video X seems to be unrelated to Abstract Y...

In developing our video relationships, we compare around 5 million PubMed articles to our library of over 4,500 methods videos. In some cases the language used in the PubMed abstracts makes matching that content to a JoVE video difficult. In other cases, there happens not to be any content in our video library that is relevant to the topic of a given abstract. In these cases, our algorithms are trying their best to display videos with relevant content, which can sometimes result in matched videos with only a slight relation.