JoVE Visualize What is visualize?
Stop Reading. Start Watching.
Advanced Search
Stop Reading. Start Watching.
Regular Search
Find video protocols related to scientific articles indexed in Pubmed.
[Imaging study of paravertebral muscle degeneration in degenerative lumbar instability].
Zhonghua Wai Ke Za Zhi
PUBLISHED: 11-06-2014
Show Abstract
Hide Abstract
To compare the paravertebral muscle (such as multifidus, erector spinae, psoas muscle) changes between the patients with degenerative lumbar instability and normal person by MRI and to observe the degeneration of paravertebral muscles. To analyze the relationship between paravertebral muscle degeneration and lumbar curvature of degenerative lumbar instability.
Related JoVE Video
Involvement of FoxQ1 in NSCLC through regulating EMT and increasing chemosensitivity.
Oncotarget
PUBLISHED: 10-31-2014
Show Abstract
Hide Abstract
Forkhead box Q1 (FoxQ1) is a member of the forkhead transcription factor family. High expression of FoxQ1 has been associated with several cancers including non-small cell lung cancer (NSCLC), but its role in the development of NSCLC is not clear. In this study, we investigated the effect of FoxQ1 up-regulated and down-regulated in vitro and in vivo, and the role of FoxQ1 in regulating epithelial-mesenchymal transition (EMT) in NSCLC, providing evidence that FoxQ1 could be a potential therapeutic target in NSCLC. NSCLC cells with silenced FoxQ1 had decreased cell proliferation, migration and invasion in cell culture and delayed growth of xenograft tumors in mice compared with corresponding control cells. The NSCLC cells downregulated for FoxQ1 induced the expression of apoptosis-associated proteins and reduction of anti-apoptotic protein expression. Downregulation of FoxQ1 promoted the expression of epithelial markers and decreased several mesenchymal markers in vitro and in vivo. In addition, FoxQ1 was associated with resistance to conventional chemotherapeutic agents. In contrast, FoxQ1 overexpressed elicited converse effects on these phenotypes in vitro and in vivo. Our findings define a key role for FoxQ1 in regulating EMT and increasing chemosensitivity in NSCLC.
Related JoVE Video
Recombinant Clostridium difficile toxin B induces endoplasmic reticulum stress in mouse colonal carcinoma cells.
Acta Biochim. Biophys. Sin. (Shanghai)
PUBLISHED: 09-30-2014
Show Abstract
Hide Abstract
Clostridium difficile is the main cause of antibiotic-associated diarrhea and pseudomembranous colitis in humans and animals. Its pathogenicity is primarily linked to the secretion of two exotoxins (TcdA and TcdB). Although great progress in the toxic mechanism of TcdA and TcdB has been achieved, there are many conflicting reports about the apoptotic mechanism. More importantly, apoptotic endoplasmic reticulum (ER) stress has been reported in cells treated with Shiga toxins-another kind of cytotoxins that can cause diarrhea and colitis. Herein we checked whether TcdB can induce ER stress. The results showed that recombinant TcdB (rTcdB) activated molecular markers of unfolded protein response, suggesting that rTcdB induced ER stress in CT26 cells. However, rTcdB did not induce the up-regulation of C/EBP homologous protein (CHOP), a classic mediator of apoptotic ER stress, but it activated the precursor of cysteine aspartic acid-specific protease 12 (caspase-12), a controversial mediator of apoptotic ER stress. Besides, glucosyltransferase activity-deficient mutant recombinant TcdB induced ER stress, though it has no cytotoxic or cytopathic effect on CT26 cells. Altogether, these data demonstrated that ER stress induced by rTcdB is glucosyltransferase-independent, indicating that ER stress induced by rTcdB is non-apoptotic. This work also offers us a new insight into the molecular mechanism of CHOP protein expression regulation and the role of CHOP expression in ER stress.
Related JoVE Video
[Investigation of noise hazards and hearing status of workers in outdoor quarries].
Zhonghua Lao Dong Wei Sheng Zhi Ye Bing Za Zhi
PUBLISHED: 09-04-2014
Show Abstract
Hide Abstract
To investigate the noise hazards in open quarries and to provide a basis for further control of noise hazards.
Related JoVE Video
Different concentrations of 17?-estradiol modulates apoptosis induced by interleukin-1? in rat annulus fibrosus cells.
Mol Med Rep
PUBLISHED: 08-22-2014
Show Abstract
Hide Abstract
Interleukin?1? (IL?1?) is a pleiotropic cytokine that mediates inflammatory and cell death activities. IL?1? has been previously reported to induce apoptosis of intervertebral disc (IVD) cells in IVD degeneration. Accumulating data have suggested that post?menopausal women have a high incidence of IVD degeneration. It has therefore been proposed that estrogen may have a close association with IVD degeneration. Whether estrogen is able to protect IVD cells from apoptosis remains unclear. The present study aimed to examine whether 17??estradiol (17??E2) inhibited IL?1??induced apoptosis of rat annulus fibrosus (AF) cells. Additionally, the dose?response effect of 17??E2 on cell apoptosis was investigated. AF cells were isolated from male Sprague Dawley rats and cultured in complete medium. Following approximately two weeks, the AF cells were treated with IL?1? (75 ng/ml) for 24 h, with a pretreatment of 17??E2 for 1 h. Apoptosis of AF cells was analyzed by annexin V/propidium iodide binding assay and morphological changes, together with an assessment of caspase?3 activity. Cell viability of the AF cells was determined by MTT assay. The level of apoptosis and caspase?3 activity in the AF cells was increased whereas the cell viability was decreased following treatment with IL?1? (75 ng/ml), as compared with the control group. This effect was reversed by pretreatment with 17??E2, in a dose?dependent manner. The protective effect of 17??E2 was abolished by estrogen receptor antagonist ICI182, 780. These results indicate that 17??E2 protects rat AF cells from apoptosis induced by IL?1?, in a dose?dependent manner.
Related JoVE Video
[Association of human chorionic gonadotropin level in embryo culture media with early embryo development].
Nan Fang Yi Ke Da Xue Xue Bao
PUBLISHED: 07-25-2014
Show Abstract
Hide Abstract
To investigate the association of human chorionic gonadotropin (HCG) level on day 3 of embryo culture with embryo development.
Related JoVE Video
Application of ozonated piggery wastewater for cultivation of oil-rich Chlorella pyrenoidosa.
Bioresour. Technol.
PUBLISHED: 07-23-2014
Show Abstract
Hide Abstract
Ozonated and autoclaved piggery wastewaters were compared for cultivation of oil-rich Chlorella pyrenoidosa by measuring nutrient removal from the medium and growth rate and lipid production of the microalgae. The removal rates of chemical oxygen demand, NH4(+)-N, total nitrogen and total phosphorus by C. pyrenoidosa were not influenced by both sterilisation methods. The specific growth rate and biomass of C. pyrenoidosa were determined by analysing the chlorophyll concentration for eliminating the disturbance of bacteria growth in culture system. Bacteria raised from the residue in the ozonated medium achieved 30% of the total microorganisms at the end of cultivation. They reduced the growth of C. pyrenoidosa by 10.4%, but contributed to a faster decline of the nutrient content on the first day. Lipid production and fatty acid profile did not change markedly in both sterilisation methods. The results suggest that ozonation is acceptable for piggery wastewater treatment for C. pyrenoidosa cultivation.
Related JoVE Video
Tumor suppressor p53 cooperates with SIRT6 to regulate gluconeogenesis by promoting FoxO1 nuclear exclusion.
Proc. Natl. Acad. Sci. U.S.A.
PUBLISHED: 07-09-2014
Show Abstract
Hide Abstract
In mammalian cells, tumor suppressor p53 plays critical roles in the regulation of glucose metabolism, including glycolysis and oxidative phosphorylation, but whether and how p53 also regulates gluconeogenesis is less clear. Here, we report that p53 efficiently down-regulates the expression of phosphoenolpyruvate carboxykinase (PCK1) and glucose-6-phosphatase (G6PC), which encode rate-limiting enzymes in gluconeogenesis. Cell-based assays demonstrate the p53-dependent nuclear exclusion of forkhead box protein O1 (FoxO1), a key transcription factor that mediates activation of PCK1 and G6PC, with consequent alleviation of FoxO1-dependent gluconeogenesis. Further mechanistic studies show that p53 directly activates expression of the NAD(+)-dependent histone deacetylase sirtuin 6 (SIRT6), whose interaction with FoxO1 leads to FoxO1 deacetylation and export to the cytoplasm. In support of these observations, p53-mediated FoxO1 nuclear exclusion, down-regulation of PCK1 and G6PC expression, and regulation of glucose levels were confirmed in C57BL/J6 mice and in liver-specific Sirt6 conditional knockout mice. Our results provide insights into mechanisms of metabolism-related p53 functions that may be relevant to tumor suppression.
Related JoVE Video
Linking biochemical pathways and networks to adverse drug reactions.
IEEE Trans Nanobioscience
PUBLISHED: 06-04-2014
Show Abstract
Hide Abstract
There is growing interest in investigating the biochemical pathways involved in cellular responses to drugs. Here we propose new methods to explore the relationships between drugs, biochemical pathways and adverse drug reactions (ADRs) at a large scale. Using sparse canonical correlation analysis of 832 drugs characterized by 173 pathways and 1385 ADRs profiles, we identified 30 highly correlated sets of drugs, pathways and ADRs. This included known and potentially novel associations. To evaluate the predictive performance of our method, the extracted correlated components were used to predict known ADR profiles from drug pathway profiles. A relatively high prediction performance (AUC: 0.894) was achieved. To further investigate their association, we developed a network-based approach to extracting potentially significant modules of pathway-ADR associations. Five statistically significant modules were extracted. We found that most of the nodes contained in the modules are either pathways linked to a very limited number of drugs or rare ADRs. The work provides a foundation for future investigations of ADRs in the context of biochemical pathways under different clinical conditions. Our method and resulting datasets will aid in: a) the systematic prediction of ADRs, and b) the characterization of novel mechanisms of action for existing drugs. This merits additional research to further assess its potential in improving personalized drug safety monitoring, as well as for the repositioning of drugs in the longer term.
Related JoVE Video
An information theoretic approach to assessing Gene-Ontology-driven similarity and its application.
Int J Data Min Bioinform
PUBLISHED: 05-29-2014
Show Abstract
Hide Abstract
Using information-theoretic approaches, this paper presents a cross-platform system to support the integration of Gene Ontology (GO)-driven similarity knowledge into functional genomics. Three GO-driven similarity measures (Resnik's, Lin's and Jiang's metrics) have been implemented to measure between-term similarity within each of the GO hierarchies. Two approaches (simple and highest average similarity) which are based on the aggregation of between-term similarities, are used to estimate the similarity between gene products. The system has been successfully applied to a number of applications including assessing gene expression correlation patterns and the relationships between GO-driven similarity and other functional properties.
Related JoVE Video
Metabolites from Aspergillus versicolor, an endolichenic fungus from the lichen Lobaria retigera.
Drug Discov Ther
PUBLISHED: 05-13-2014
Show Abstract
Hide Abstract
Three new anthraquinone derivatives (1-3) and one new artifact (4) were isolated, along with six known anthraquinone derivatives (5-10) and three xanthones (11-13), from a culture of an endolichenic fungus, Aspergillus versicolor, that was isolated from the lichen Lobaria retigera. The structures of these substances were determined on the basis of 1D and 2D (COSY, HMQC, and HMBC) NMR and MS analyses. The substances 1-4 were also tested for their cytotoxic activity.
Related JoVE Video
Transcriptome profiling to identify genes involved in pathogenicity of Valsa mali on apple tree.
Fungal Genet. Biol.
PUBLISHED: 04-02-2014
Show Abstract
Hide Abstract
Apple Valsa canker, caused by the fungus Valsa mali (Vm), is one of the most destructive diseases of apple in China. A better understanding of this host-pathogen interaction is urgently needed to improve management strategies. In the current study we sequenced the transcriptomes of Vm during infection of apple bark and mycelium grown in axenic culture using Illumina RNA-Seq technology. We identified 437 genes that were differentially expressed during fungal infection compared to fungal mycelium grown in axenic culture. One hundred and thirty nine of these 437 genes showed more than two fold higher transcript abundance during infection. GO and KEGG enrichment analyses of the up-regulated genes suggest prevalence of genes associated with pectin catabolic, hydrolase activity and secondary metabolite biosynthesis during fungal infection. Some of the up-regulated genes associated with loss of pathogenicity and reduced virulence annotated by host-pathogen interaction databases may also be involved in cell wall hydrolysis and secondary metabolite transport, including a glycoside hydrolase family 28 protein, a peptidase and two major facilitator superfamily proteins. This highlights the importance of secondary metabolites and cell wall hydrolases during establishment of apple Valsa canker. Functional verification of the genes involved in pathogenicity of Vm will allow us to better understand how the fungus interferes with the host machinery and assists in apple canker establishment.
Related JoVE Video
Prediction of XDR/pre-XDR tuberculosis by genetic mutations among MDR cases from a hospital in Shandong, China.
Tuberculosis (Edinb)
PUBLISHED: 03-10-2014
Show Abstract
Hide Abstract
The prevalence of extensively drug-resistant (XDR) and pre-extensively drug-resistant (pre-XDR) tuberculosis in China highlights the need for rapid diagnosis. Molecular methods based on the detection of resistance-conferring mutations provide promising solution for rapid diagnosis. Here, we evaluated the accuracy of using mutations in gyrA, rrs and tlyA to predict resistance to levofloxacin (LEV), amikacin (AMK) and capreomycin (CAP), among 208 clinical multidrug-resistant (MDR) Mycobacterium tuberculosis strains collected in a local hospital in Shandong province, China. A total of 131 (63.0%, 131/208) strains were detected resistance to at least one of the 3-s line drugs by drug susceptible tests (DSTs). By comparing the mutation data with the phenotypic results, we found all mutations in three genes could specifically (with specificities from 93.9% to 100%) predict resistances with sensitivities of 77.8% for gyrA (LEV), 71.4% for rrs (AMK), 53.6% for rrs (CAP), 14.3% for tlyA (CAP), 64.3% for rrs and tlyA (CAP). The combination of these mutations could predict 68.9% and 63.4% pre-XDR and XDR TB, respectively. However, the positive predictive value of rrs for CAP resistance (57.7%) and the negative predictive values of gyrA for LEV resistance (74.5%) were not satisfying. Our results supported the use of genetic mutations to predict resistance to AMK and fluoroquinolones. An algorithm that combines molecular methods and traditional DST would be valuable for detecting resistance to second-line drugs in our hospital.
Related JoVE Video
[Correlation of follicular fluid human chorionic gonadotrophin level with oocyte maturity and early embryonic development].
Nan Fang Yi Ke Da Xue Xue Bao
PUBLISHED: 03-05-2014
Show Abstract
Hide Abstract
To explore the correlation of human chorionic gonadotrophin (hCG) level in the follicular fluid on oocyte retrieval day with the number of oocytes retrieved, maturation rate, embryonic development, and pregnancy outcome in controlled ovarian stimulation cycles.
Related JoVE Video
Transcriptome analysis of the Bombyx mori fat body after constant high temperature treatment shows differences between the sexes.
Mol. Biol. Rep.
PUBLISHED: 02-25-2014
Show Abstract
Hide Abstract
Ambient temperature plays a large role in insect growth, development and even their distribution. The elucidation of the associated molecular mechanism that underlies the effect of constant high temperature will enables us to further understand the stress responses. We constructed four digital gene expression libraries from the fat body of female and male Bombyx mori. Differential gene expression was analyzed after constant high temperature treatment. The results showed that there were significant changes to the gene expression in the fat body after heat treatment, especially in binding, catalytic, cellular and metabolic processes. Constant high temperature may induce more traditional cryoprotectants, such as glycerol, glycogen, sorbitol and lipids, to protect cells from damage, and induce heat oxidative stress in conjunction with the heat shock proteins. The data also indicated a difference between males and females. The heat shock protein-related genes were up-regulated in both sexes but the expression of Hsp25.4 and DnaJ5 were down-regulated in the male fat body of B. mori. This is the first report of such a result. Constant high temperature also affected the expression of other functional genes and differences were observed between male and female fat bodies in the expression of RPS2, RPL37A and MREL. These findings provide abundant data on the effect of high temperature on insects at the molecular level. The data will also be beneficial to the study of differences between the sexes, manifested in variations in gene expression under high temperature.
Related JoVE Video
Preparation and characterization of double crosslinked hydrogel films from carboxymethylchitosan and carboxymethylcellulose.
Carbohydr Polym
PUBLISHED: 01-26-2014
Show Abstract
Hide Abstract
A novel crosslinked hydrogel film was prepared from carboxymethylchitosan (CMCS) and carboxymethylcellulose (CMC) by ionical and covalent crosslinking with CaSO4 and genipin, respectively. The swelling ratio of the crosslinked CMCS/CMC hydrogel films was investigated at different pH solutions (1-9), and the results indicated that the crosslinked hydrogels had the swelling-deswelling properties with two primary peaks of swelling ratio at pH 3 and 7. The surface morphologies of the crosslinked hydrogels at different pH values provided evidences of the swelling-deswelling properties. The mechanical properties of the hydrogel films were also examined. The ionical and covalent crosslinking were found to have the primary impact on the toughness and max load, respectively, of the crosslinked hydrogels. The cells comparatively cultured on the crosslinked hydrogels and the negative and positive controls suggested the biocompatibility of the crosslinked CMCS/CMC films. This kind of hydrogel films have potential application in drug delivery vehicles and skin tissue engineering.
Related JoVE Video
Vanishing lung syndrome in one family: Five cases with a 20-year follow-up.
Mol Med Rep
PUBLISHED: 01-19-2014
Show Abstract
Hide Abstract
Vanishing lung syndrome, also known as idiopathic giant bullous emphysema, is a rare disease characterized by giant emphysematous bullae. The disease is diagnosed by radiological findings of giant bullae in one, or both, of the upper lobes of the lung, occupying at least one?third of the hemithorax. There have been several reports of vanishing lung syndrome, however it remains to be determined whether genetic inheritance is associated with the disease. In the present study, five patients within one family, with vanishing lung syndrome, were reported during a follow?up period of ~20 years. All of the patients were diagnosed by radiological findings, which showed diffuse bullae in the lungs, which were of varying size and asymmetrical distribution, and the occurrence of pneumothorax or emphysema. The Medical Ethics Committee of the People's Hospital of Zhangye Municipality (Zhangye, China) approved this study, and all subjects gave their informed consent During the follow?up period of 20 years, bullae in these patients were shown to progressively increase, and no other pulmonary diseases, including lung cancer, tuberculosis, pneumoconiosis and chronic bronchitis were observed. Autosomal dominant inheritance was observed in five cases, and autosomal recessive inheritance was observed in one case. The present study suggests that vanishing lung syndrome may be associated with autosomal dominant and recessive genetic inheritance.
Related JoVE Video
Compound Formula Rehmannia alleviates levodopa-induced dyskinesia in Parkinson's disease.
Neural Regen Res
PUBLISHED: 01-18-2014
Show Abstract
Hide Abstract
Compound Formula Rehmannia has been shown to be clinically effective in treating Parkinson's disease and levodopa-induced dyskinesia; however, the mechanisms remain unclear. In this study, we established a model of Parkinson's disease dyskinesia in rats, and treated these animals with Compound Formula Rehmannia. Compound Formula Rehmannia inhibited the increase in mRNA expression of N-methyl-D-aspartate receptor subunits 1 and 2 and excitatory amino acid neurotransmitter genes, and it inhibited the reduction in expression of ?-aminobutyric acid receptor B1, an inhibitory amino acid neurotransmitter gene, in the corpus striatum. In addition, Compound Formula Rehmannia alleviated dyskinesia symptoms in the Parkinson's disease rats. These experimental findings indicate that Compound Formula Rehmannia alleviates levodopa-induced dyskinesia in Parkinson's disease by modulating neurotransmitter signaling in the corpus striatum.
Related JoVE Video
Identification of a Bombyx mori gene encoding small heat shock protein BmHsp27.4 expressed in response to high-temperature stress.
Gene
PUBLISHED: 01-06-2014
Show Abstract
Hide Abstract
Elucidating the mechanisms underlying the response and resistance to high-temperature stress in the Lepidoptera is essential for understanding the effect of high-temperature on the regulation of gene expression. A tag (CATGAACGTGAAGAGATTCAG) matching the predicted gene BGIBMGA005823-TA in SilkDB identified the most significant response to high-temperature stress in a screen of the heat-treated digital gene expression library of Bombyx mori (B. mori) (Unpublished data). BLAST and RACE showed that the gene is located on chromosome 5 and has an open reading frame (ORF) of 741bp. Phylogenetic analysis found that B. mori small heat shock protein 27.4 (BmHSP27.4) is in an evolutionary branch separate from other small heat shock proteins. Expression analysis showed that BmHsp27.4 is highly expressed in brain, eyes and fat bodies in B. mori. Its mRNA level was elevated at high-temperature and this increase was greater in females. The ORF without the signal peptide sequence was cloned into vector pET-28a(+), transformed and over-expressed in Escherichia coli Rosetta (DE3). Western blotting and immunofluorescence analysis with a polyclonal antibody, confirmed that the level of protein BmHSP27.4 increased at a high-temperature, in accordance with its increased mRNA level. In this study, BmHsp27.4 was identified as a novel B. mori gene with an important role in response to high-temperature stress.
Related JoVE Video
Utility of Clostridium difficile Toxin B for Inducing Anti-Tumor Immunity.
PLoS ONE
PUBLISHED: 01-01-2014
Show Abstract
Hide Abstract
Clostridium difficile toxin B (TcdB) is a key virulence factor of bacterium and induces intestinal inflammatory disease. Because of its potent cytotoxic and proinflammatory activities, we investigated the utility of TcdB in developing anti-tumor immunity. TcdB induced cell death in mouse colorectal cancer CT26 cells, and the intoxicated cells stimulated the activation of mouse bone marrow-derived dendritic cells and subsequent T cell activation in vitro. Immunization of BALB/c mice with toxin-treated CT26 cells elicited potent anti-tumor immunity that protected mice from a lethal challenge of the same tumor cells and rejected pre-injected tumors. The anti-tumor immunity generated was cell-mediated, long-term, and tumor-specific. Further experiments demonstrated that the intact cell bodies were important for the immunogenicity since lysing the toxin-treated tumor cells reduced their ability to induce antitumor immunity. Finally, we showed that TcdB is able to induce potent anti-tumor immunity in B16-F10 melanoma model. Taken together, these data demonstrate the utility of C. difficile toxin B for developing anti-tumor immunity.
Related JoVE Video
Development of VHH antibodies against dengue virus type 2 NS1 and comparison with monoclonal antibodies for use in immunological diagnosis.
PLoS ONE
PUBLISHED: 01-01-2014
Show Abstract
Hide Abstract
The possibility of using variable domain heavy-chain antibodies (VHH antibodies) as diagnostic tools for dengue virus (DENV) type 2 NS1 protein was investigated and compared with the use of conventional monoclonal antibodies. After successful expression of DENV type 2 NS1 protein, the genes of VHH antibodies against NS1 protein were biopanned from a non-immune llama library by phage display. VHH antibodies were then expressed and purified from Escherichia coli. Simultaneously, monoclonal antibodies were obtained by the conventional route. Sequence analysis of the VHH antibodies revealed novel and long complementarity determining regions 3 (CDR3). Epitope mapping was performed via a phage display peptide library using purified VHH and monoclonal antibodies as targets. Interestingly, the same region of NS1, which comprises amino acids 224HWPKPHTLW232, was conserved for both kinds of antibodies displaying the consensus motif histidine-tryptophan-tryptophan or tryptophan-proline-tryptophan. The two types of antibodies were used to prepare rapid diagnostic kits based on immunochromatographic assay. The VHH antibody immobilized rapid diagnostic kit showed better sensitivity and specificity than the monoclonal antibody immobilized rapid diagnostic kit, which might be due to the long CDR3 regions of the VHH antibodies and their ability to bind to the pocket and cleft of the targeted antigen. This demonstrates that VHH antibodies are likely to be an option for developing point-of-care tests against DENV infection.
Related JoVE Video
Controllable Synthesis of Hierarchical Porous Fe3O4 Particles Mediated by Poly(diallyldimethylammonium chloride) and Their Application in Arsenic Removal.
ACS Appl Mater Interfaces
PUBLISHED: 11-22-2013
Show Abstract
Hide Abstract
Hierarchical porous Fe3O4 particles with tunable grain size were synthesized based on a facile poly (diallyldimethylammonium chloride) (PDDA)-modulated solvothermal method. The products were characterized with scanning electron microscopy (SEM) and transmission electron microscopy (TEM), X-ray photoelectron spectroscopy (XPS), Fourier transform infrared spectroscopy (FT-IR), X-ray diffraction (XRD), N2 adsorption-desorption technique, vibrating sample magnetometer (VSM), and dynamic light scattering (DLS). The results show that increasing the PDDA dosage decrease the grain size and particle size, which increased the particle porosity and enhanced the surface area from 7.05 to 32.75 m(2) g(-1). Possible mechanism can be ascribed to the PDDA function on capping the crystal surface and promoting the viscosity of reaction medium to mediate the growth and assembly of grain. Furthermore, the arsenic adsorption application of the as-obtained Fe3O4 samples was investigated and the adsorption mechanism was proposed. High magnetic Fe3O4 particles with increased surface area display improved arsenic adsorption performance, superior efficiency in low-level arsenic removal, high desorption efficiency, and satisfactory magnetic recyclability, which are very promising compared with commercial Fe3O4 particles.
Related JoVE Video
Graphene@poly(m-phenylenediamine) hydrogel fabricated by a facile post-synthesis assembly strategy.
Chem. Commun. (Camb.)
PUBLISHED: 09-16-2013
Show Abstract
Hide Abstract
The mixing of graphene oxide and protonated poly(m-phenylenediamine) (PmPD) nanoparticles generates floccus that can be readily transformed into graphene@PmPD hybrid hydrogel through redox reaction. This macroscopic material can be directly applied as a monolith column adsorbent for water purification.
Related JoVE Video
Participatory Research to Design a Novel Telehealth System to Support the Night-Time Needs of People with Dementia: NOCTURNAL.
Int J Environ Res Public Health
PUBLISHED: 09-11-2013
Show Abstract
Hide Abstract
Strategies to support people living with dementia are broad in scope, proposing both pharmacological and non-pharmacological interventions as part of the care pathway. Assistive technologies form part of this offering as both stand-alone devices to support particular tasks and the more complex offering of the "smart home" to underpin ambient assisted living. This paper presents a technology-based system, which expands on the smart home architecture, orientated to support people with daily living. The system, NOCTURNAL, was developed by working directly with people who had dementia, and their carers using qualitative research methods. The research focused primarily on the nighttime needs of people living with dementia in real home settings. Eight people with dementia had the final prototype system installed for a three month evaluation at home. Disturbed sleep patterns, night-time wandering were a focus of this research not only in terms of detection by commercially available technology but also exploring if automated music, light and visual personalized photographs would be soothing to participants during the hours of darkness. The NOCTURNAL platform and associated services was informed by strong user engagement of people with dementia and the service providers who care for them. NOCTURNAL emerged as a holistic service offering a personalised therapeutic aspect with interactive capabilities.
Related JoVE Video
Improved lithium storage properties of electrospun TiO2 with tunable morphology: from porous anatase to necklace rutile.
Nanoscale
PUBLISHED: 09-06-2013
Show Abstract
Hide Abstract
Three-dimensional TiO2 with tunable morphology and crystalline phase was successfully prepared by the electrospinning technique and subsequent annealing. Porous-shaped anatase TiO2, cluster-shaped anatase TiO2, hierarchical-shaped rutile (minor) TiO2 and nano-necklace rutile (major) TiO2 were achieved at 500, 600, 700 and 800 °C, respectively. The mechanism of the formation of these tailored morphologies and crystallinity was investigated. Lithium insertion properties were evaluated by galvanostatic and potentiostatic modes in half-cell configurations. By combining the large surface area, open mesoporosity and stable crystalline phase, the porous-shaped anatase TiO2 exhibited the highest capacity, best rate and cycling performance among the four samples. The present results demonstrated the usefulness of three-dimensional TiO2 as an anode for lithium storage with improved electrode performance.
Related JoVE Video
Lentivirus vector-mediated Rho guanine nucleotide dissociation inhibitor 2 overexpression induces beta-2 adrenergic receptor desensitization in airway smooth muscle cells.
J Thorac Dis
PUBLISHED: 09-02-2013
Show Abstract
Hide Abstract
Beta-2 adrenergic receptor (?2AR) downregulation is critical to asthma rescue therapy; however, tolerance, also known as ?2AR or bronchodilator desensitization, mechanisms potentially resulting in life-threatening rescue treatment failure remain poorly understood.
Related JoVE Video
Bilateral stereotactic radiofrequency amygdalohippocampectomy for a patient with bilateral temporal lobe epilepsy.
Epilepsia
PUBLISHED: 08-20-2013
Show Abstract
Hide Abstract
To search for a method for treatment of bilateral temporal lobe epilepsy (BTLE), we report one patient with BTLE experienced bilateral stereotactic radiofrequency amygdalohippocampectomy (SAHE). Neuropsychological examinations were performed before and 5 days, and 6, 18, and 48 months after operation. No seizure occurred in the follow-up time, and no long-term memory and intelligence deficits were found except for a transient decline of the scores immediately after operation. Because severe damage of memory could be caused by bilateral resection surgery, bilateral SAHE should be considered as a possible approach for the treatment of BTLE. However, further studies with accumulation of cases are needed, especially in the detailed assessment of neuropsychological function.
Related JoVE Video
Drug-domain interaction networks in myocardial infarction.
IEEE Trans Nanobioscience
PUBLISHED: 08-19-2013
Show Abstract
Hide Abstract
It has been well recognized that the pace of the development of new drugs and therapeutic interventions lags far behind biological knowledge discovery. Network-based approaches have emerged as a promising alternative to accelerate the discovery of new safe and effective drugs. Based on the integration of several biological resources including two recently published datasets i.e., Drug-target interactions in myocardial infarction (My-DTome) and drug-domain interaction network, this paper reports the association between drugs and protein domains in the context of myocardial infarction (MI). A MI drug-domain interaction network, My-DDome, was firstly constructed, followed by topological analysis and functional characterization of the network. The results show that My-DDome has a very clear modular structure, where drugs interacting with the same domain(s) within each module tend to have similar therapeutic effects. Moreover it has been found that drugs acting on blood and blood forming organs (ATC code B) and sensory organs (ATC code S) are significantly enriched in My-DDome (p < 0.000001), indicating that by incorporating protein domain information into My-DTome, more detailed insights into the interplay between drugs, their known targets, and seemingly unrelated proteins can be revealed.
Related JoVE Video
Characterization of the glutamate-specific endopeptidase from Bacillus licheniformis expressed in Escherichia coli.
J. Biotechnol.
PUBLISHED: 08-02-2013
Show Abstract
Hide Abstract
Glutamate-specific endopeptidase from Bacillus licheniformis (GSE-BL) is widely used in peptide recovery and synthesis because of its unique substrate specificity. However, the mechanism underlying its specificity is still not thoroughly understood. In this study, the roles of the prosegment and key amino acids involved in the proteolytic activity of GSE-BL were investigated. Loss of the GSE-BL prosegment severely restricted enzymatic activity toward Z-Phe-Leu-Glu-pNA. A homologous model of GSE-BL revealed that it contains the catalytic triad "His47, Asp96 and Ser 167", which was further confirmed by site-directed mutagenesis. In vitro mutagenesis further indicated that Val2, Arg89 and His190 are essential for enzymatic activity toward Z-Phe-Leu-Glu-pNA. Moreover, the catalytic efficiency of Phe57Ala GSE-BL toward Z-Phe-Leu-Glu-pNA was 50% higher than that of the native mature GSE-BL. This is the first study to fully elucidate the key amino acids for proteolytic activity of GSE-BL. Mature GSE-BL could be obtained through self-cleavage alone when Lys at -1 position was replaced by Glu, providing a new strategy for the preparation of mature GSE-BL. This study yielded some valuable insights into the substrate specificity of glutamate-specific endopeptidase, establishing a foundation for broadening the applications of GSE-BL.
Related JoVE Video
Adsorption of Cr(VI) using synthetic poly(m-phenylenediamine).
J. Hazard. Mater.
PUBLISHED: 05-23-2013
Show Abstract
Hide Abstract
Poly(m-phenylenediamine) (PmPD) with different oxidation state was successfully synthesized by the improved chemically oxidative polymerization. The function of oxidation state on Cr(VI) adsorption was systematically examined through adsorption experiments. Results showed that the Cr(VI) adsorptivity of all PmPD increased with decreasing the initial pH. When the oxidation state of PmPD was dropped, the equilibrium time for Cr(VI) adsorption was obviously shortened and its Cr(VI) removal and adsorption selectivity were profoundly obviously increased. Typically, PmPD with the lowest oxidation state in this research possesses the highest Cr(VI) removal of 500 mg g(-1). Moreover, PmPD with lower oxidation state displays a potentially superior prospect in Cr(VI) treatment through preliminary experiments on 5 cycles of adsorption, column adsorption and practical wastewater treatment. The possible adsorption mechanism was discussed mainly according to characterizations (FTIR, XPS) and experiments, which together suggests that the Cr(VI) adsorption most possibly involve redox reaction, chelation and doping adsorption.
Related JoVE Video
A new strategy for recovery of two peptides without Glu employing glutamate-specific endopeptidase from Bacillus licheniformis.
Enzyme Microb. Technol.
PUBLISHED: 05-08-2013
Show Abstract
Hide Abstract
The difficulty in the purification of bioactive peptide limited its application in food, drug and cosmetic industry. Here we report a new strategy for the recovery of two peptides employing glutamate-specific endopeptidase from Bacillus licheniformis (GSE-BL), which shows strong specificity for Glu residue. Human glucagon and human beta-defensin-2 (HBD-2) were peptides without Glu residue, and Glu residue was introduced between affinity tag and target peptide as recognition site of GSE-BL. Tagless human glucagon with the same HPLC retention time as native human glucagon and mature HBD-2 with antibacterial activity and cytotoxicity were obtained after GSE-BL treatment. This strategy has great potential in the recovery of bioactive peptide without Glu residue, thus facilitating large scale preparation of peptide and widening the application of bioactive peptide.
Related JoVE Video
Methylation of SUV39H1 by SET7/9 results in heterochromatin relaxation and genome instability.
Proc. Natl. Acad. Sci. U.S.A.
PUBLISHED: 03-18-2013
Show Abstract
Hide Abstract
Suppressor of variegation 3-9 homolog 1 (SUV39H1), a histone methyltransferase, catalyzes histone 3 lysine 9 trimethylation and is involved in heterochromatin organization and genome stability. However, the mechanism for regulation of the enzymatic activity of SUV39H1 in cancer cells is not yet well known. In this study, we identified SET domain-containing protein 7 (SET7/9), a protein methyltransferase, as a unique regulator of SUV39H1 activity. In response to treatment with adriamycin, a DNA damage inducer, SET7/9 interacted with SUV39H1 in vivo, and a GST pull-down assay confirmed that the chromodomain-containing region of SUV39H1 bound to SET7/9. Western blot using antibodies specific for antimethylated SUV39H1 and mass spectrometry demonstrated that SUV39H1 was specifically methylated at lysines 105 and 123 by SET7/9. Although the half-life and localization of methylated SUV39H1 were not noticeably changed, the methyltransferase activity of SUV39H1 was dramatically down-regulated when SUV39H1 was methylated by SET7/9. Consequently, H3K9 trimethylation in the heterochromatin decreased significantly, which, in turn, led to a significant increase in the expression of satellite 2 (Sat2) and ?-satellite (?-Sat), indicators of heterochromatin relaxation. Furthermore, a micrococcal nuclease sensitivity assay and an immunofluorescence assay demonstrated that methylation of SUV39H1 facilitated genome instability and ultimately inhibited cell proliferation. Together, our data reveal a unique interplay between SET7/9 and SUV39H1--two histone methyltransferases--that results in heterochromatin relaxation and genome instability in response to DNA damage in cancer cells.
Related JoVE Video
Drug-induced hypothermia in stroke models: does it always protect?
CNS Neurol Disord Drug Targets
PUBLISHED: 03-09-2013
Show Abstract
Hide Abstract
Ischemic stroke is a common neurological disorder lacking a cure. Recent studies show that therapeutic hypothermia is a promising neuroprotective strategy against ischemic brain injury. Several methods to induce therapeutic hypothermia have been established; however, most of them are not clinically feasible for stroke patients. Therefore, pharmacological cooling is drawing increasing attention as a neuroprotective alternative worthy of further clinical development. We begin this review with a brief introduction to the commonly used methods for inducing hypothermia; we then focus on the hypothermic effects of eight classes of hypothermia-inducing drugs: the cannabinoids, opioid receptor activators, transient receptor potential vanilloid, neurotensins, thyroxine derivatives, dopamine receptor activators, hypothermia-inducing gases, adenosine, and adenine nucleotides. Their neuroprotective effects as well as the complications associated with their use are both considered. This article provides guidance for future clinical trials and animal studies on pharmacological cooling in the setting of acute stroke.
Related JoVE Video
Effects of a Rho kinase inhibitor on the sequential expression of ICAM-1, HIF-1?, Bcl-2 and caspase-3 in the retina of rats with oxygen-induced retinopathy.
Int. J. Mol. Med.
PUBLISHED: 02-28-2013
Show Abstract
Hide Abstract
The aim of the present study was to evaluate the effects of blocking the Rho kinase pathway on non-perfused regions and angiogenesis in the retina of rats using a rat model of oxygen-induced retinopathy (OIR) by observing the sequential expression of intercellular adhesion molecule-1 (ICAM-1), hypoxia-inducible factor-1 (HIF-1), B-cell lymphoma/leukemia-2 gene (Bcl-2) and caspase-3 mRNA following the administration of the Rho kinase inhibitor, fasudil (FSD). A total of 240 newborn rats were randomly divided into a normoxia control (N) group, a hyperoxia (H) group and a H + FSD (HF) group. The rats were sacrificed, and the eyes were enucleated from postnatal day (P)12 to P21. Samples were prepared for retinal flat mounts, mRNA and protein quantification. On P14, a higher number of circuitous retinal veins was observed in the H group compared with the HF group. In the HF group, the avascular area was significantly reduced compared with the H group on P18 (P<0.01). In the HF group, the mRNA expression of Bcl-2 was significantly increased on P15 compared with the N and H group (P<0.01). On P15 and P17 in the H group and on P13 in the HF group, the mRNA expression of ICAM?1 was significantly increased compared with the other groups (P<0.05). In the H and HF group, the expression of HIF-1? was significantly increased on P12 compared with the N group (P<0.05). On P19 and P21, HIF-1? expression was significantly increased to a maximum level in the HF group compared with the H and N group (P<0.01). In conclusion, these results suggest that FSD inhibits the expression of ICAM-1, assisting in the release of Bcl-2, suppressing caspase-3. In the HF group, the retinal flat mounts revealed that FSD had a vasorelaxant effect. On P18, a double-layered retinal vascular network was formed, and the number of non-perfused regions was significantly reduced. However, the late-phase peak expression of HIF-1? resulted in an inevitable increase in vascular endothelial growth factor expression and further accelerated neovascularization and vascular reconstruction in the immature retinal model.
Related JoVE Video
KRAS and BRAF mutation status in circulating colorectal tumor cells and their correlation with primary and metastatic tumor tissue.
Int. J. Cancer
PUBLISHED: 02-09-2013
Show Abstract
Hide Abstract
Although anti-EGFR therapy has established efficacy in metastatic colorectal cancer, only 10-20% of unselected patients respond. This is partly due to KRAS and BRAF mutations, which are currently assessed in the primary tumor. To improve patient selection, assessing mutation status in circulating tumor cells (CTCs), which possibly better represent metastases than the primary tumor, could be advantageous. We investigated the feasibility of KRAS and BRAF mutation detection in colorectal CTCs by comparing three sensitive methods and compared mutation status in matching primary tumor, liver metastasis and CTCs. CTCs were isolated from blood drawn from 49 patients before liver resection using CellSearch™. DNA and RNA was isolated from primary tumors, metastases and CTCs. Mutations were assessed by co-amplification at lower denaturation temperature-PCR (Transgenomic™), real-time PCR (EntroGen™) and nested Allele-Specific Blocker (ASB-)PCR and confirmed by Sanger sequencing. In 43 of the 49 patients, tissue RNA and DNA was of sufficient quantity and quality. In these 43 patients, discordance between primary and metastatic tumor was 23% for KRAS and 7% for BRAF mutations. RNA and DNA from CTCs was available from 42 of the 43 patients, in which ASB-PCR was able to detect the most mutations. Inconclusive results in patients with low CTC counts limited the interpretation of discrepancies between tissue and CTCs. Determination of KRAS and BRAF mutations in CTCs is challenging but feasible. Of the tested methods, nested ASB-PCR, enabling detection of KRAS and BRAF mutations in patients with as little as two CTCs, seems to be superior.
Related JoVE Video
Long-lasting distortion of GABA signaling in MS/DB neurons after binge-like ethanol exposure during initial synaptogenesis.
Brain Res.
PUBLISHED: 01-18-2013
Show Abstract
Hide Abstract
Using a well-established model of binge-like ethanol treatment of rat pups on postnatal days (PD) 4-9, we found that maturation of GABAA receptor (GABAAR) miniature postsynaptic currents (mPSCs) was substantially blunted for medial septum/diagonal band (MS/DB) neurons in brain slices on PD 11-16. Ethanol reduced mPSC amplitude, frequency, and decay kinetics, while attenuating or exaggerating allosteric actions of zolpidem and allopregnanolone, respectively. The impact of ethanol in vivo was long lasting as most changes in MS/DB GABAAR mPSCs were still observed as late as PD 60-85. Maturing MS/DB neurons in naïve brain slices PD 4-16 showed increasing mPSC frequency, decay kinetics, and zolpidem sensitivity that were nearly identical to our earlier findings in cultured septal neurons (DuBois et al., 2004, 2006). These rapidly developing mPSC parameters continued to mature through the first month of life then stabilized throughout the remainder of the lifespan. Finally, equivalent ethanol-induced alterations in GABAAR mPSC signaling were present in MS/DB neurons from both male and female animals. Previously, we showed ethanol treatment of cultured embryonic day 20 septal neurons distorts the maturation of GABAAR mPSCs predicting that early stages of GABAergic transmission in MS/DB neurons are vulnerable to intoxication injury (DuBois et al., 2004, 2006). Since the overall character, timing, and magnitude of GABAergic mPSC developmental- and ethanol-induced changes in the in vivo model so closely mirror chronologically equivalent adaptations in cultured septal neurons, this suggests that such parallel models of ethanol impairment of GABAergic synaptic development in vivo and in vitro should be useful for translational studies exploring the efficacy and mechanism of action of potential therapeutic interventions from the cellular to whole animal level.
Related JoVE Video
Acute ethanol administration inhibits Toll-like receptor 4 signaling pathway in rat intestinal epithelia.
Alcohol
PUBLISHED: 01-17-2013
Show Abstract
Hide Abstract
Excess alcohol intake, as in binge drinking, increases susceptibility to microbial pathogens. Alcohol impairs macrophage function by suppression of the Toll-like receptor 4 (TLR4) pathway. This study investigated the effects of acute ethanol intake on the TLR4 pathway in rat intestinal epithelia, which usually encounters luminal antigens at first and participates in the development of intestinal immunity. Twenty Wistar rats were randomly assigned to an ethanol group given ethanol as a 25% (v/v) solution in water at 7.5 g/kg, or a control group given saline, by oral gavage daily for 3 days. The epithelial histology and ultrastructure, the intestinal microflora, peripheral and portal venous plasma lipopolysaccharide (LPS) levels, and somatostatin (SST) levels in the peripheral plasma and small intestine were evaluated. Somatostatin receptor 2 (SSTR2), TLR4, TANK binding kinase-1 (TBK1), activated nuclear factor-?B (NF-?B), interferon-? (IFN-?) and tumor necrosis factor-? (TNF-?) in the intestinal mucosa were assayed. LPS responsiveness with or without SST pretreatment was assayed in vitro by quantification of TLR4, TBK1, activated NF-?B, IFN-? and TNF-? in isolated intestinal epithelia. Mucosal damage was observed in the ethanol group by light and electron microscopy. Escherichia coli cultures were unchanged in rat intestine of the ethanol group compared with controls, but lactobacilli cultures were reduced (p < 0.05). LPS levels increased in peripheral and portal venous plasma (p < 0.05), but mucosal TLR4, TBK1, nuclear NF-?B, IFN-? and TNF-? were unchanged in the ethanol group. LPS treatment in vitro up-regulated the level of TLR4, TBK1 and nuclear NF-?B as well as the production of IFN-? and TNF-? in isolated intestinal epithelia in the control (p < 0.05), but not the ethanol group. The stimulatory effects of LPS on intestinal epithelia isolated from the control group were significantly inhibited by SST pretreatment (p < 0.05). The peripheral plasma and intestinal levels of SST and the mucosal expression of SSTR2 in the ethanol group were significantly higher than in the control group (p < 0.05). These findings suggest the hyposensitivity of intestinal epithelial TLR4 to LPS induced by acute alcohol abuse probably through ethanol per se and ethanol-enhanced intestinal mucosal SST pathway may be a novel mechanism for increased susceptibility to intestinal pathogens.
Related JoVE Video
Systemic dissemination of Clostridium difficile toxins A and B is associated with severe, fatal disease in animal models.
J. Infect. Dis.
PUBLISHED: 12-05-2011
Show Abstract
Hide Abstract
Clostridium difficile infection (CDI) can cause a wide range of disease, from mild diarrhea to fulminant systemic disease. The incidence of systemic CDI with fatal consequence has increased rapidly in recent years.
Related JoVE Video
The HDAC inhibitor depsipeptide transactivates the p53/p21 pathway by inducing DNA damage.
DNA Repair (Amst.)
PUBLISHED: 11-23-2011
Show Abstract
Hide Abstract
Histone deacetylase (HDAC) inhibitors have been proven to be effective therapeutic agents to kill cancer cells through inhibiting HDAC activity or altering the structure of chromatin. As a potent HDAC inhibitor, depsipeptide not only modulates histone deacetylation but also activates non-histone protein p53 to inhibit cancer cell growth. However, the mechanism of depsipeptide-induced p53 transactivity remains unknown. Here, we show that depsipeptide causes DNA damage through induction of reactive oxygen species (ROS) generation, as demonstrated by a comet assay and by detection of the phosphorylation of H2AX. Depsipeptide induced oxidative stress was confirmed to relate to a disturbance in reduction-oxidation (redox) reactions through inhibition of the transactivation of thioredoxin reductase (TrxR) in human cancer cells. Upon treatment with depsipeptide, p53 phosphorylation at threonine 18 (Thr18) was specifically induced. Furthermore, we also demonstrated that phosphorylation of p53 at Thr18 is required for p53 acetylation at lysine 373/382 and for p21 expression in response to depsipeptide treatment. Our results demonstrate that depsipeptide plays an anti-neoplastic role by generating ROS to elicit p53/p21 pathway activation.
Related JoVE Video
Identification of latent periodicity in domains of alkaline proteases.
Biochemistry Mosc.
PUBLISHED: 11-16-2011
Show Abstract
Hide Abstract
Internal repeats in protein sequences have wide-ranging implications for the structure and function of proteins. A keen analysis of the repeats in protein sequences may help us to better understand the structural organization of proteins and their evolutionary relations. In this paper, a mathematical method for searching for latent periodicity in protein sequences is developed. Using this method, we identified simple sequence repeats in the alkaline proteases and found that the sequences could show the same periodicity as their tertiary structures. This result may help us to reduce difficulties in the study of the relationship between sequences and their structures.
Related JoVE Video
pH manipulation: a facile method for lowering oxidation state and keeping good yield of poly(m-phenylenediamine) and its powerful Ag+ adsorption ability.
Langmuir
PUBLISHED: 10-19-2011
Show Abstract
Hide Abstract
A method of pH manipulation has been used to improve chemically oxidative polymerization of m-phenylenediamine (mPD) through concurrent addition of NaOH when adding oxidant (NH(4))(2)S(2)O(8). pH detection and open-circuit potential technique were adopted to monitor the polymerization process of mPD and to explain the oxidation state-pH and yield-pH relationships. Results from Fourier transformed infrared (FTIR) and X-ray photoelectron (XPS) spectroscopies indicate that a low oxidation state is under control by regulating NaOH concentration. At 2.5 M NaOH, the oxidation state of poly(m-phenylenediamine) (PmPD) is 64.7 mol % (measured by molar content of quinoid imine from XPS), while the yield is 84%. The synthesized PmPD possesses better Ag(+) adsorption performance when lowering its oxidation state. Moreover, the Ag(+) adsorbance of PmPD can reach 1693 mg g(-1). Meanwhile, Ag(+) adsorption mechanism was studied by pH tracking, X-ray diffraction (XRD) patterns, and X-ray photoelectron spectroscopy. The adsorption process includes redox reaction, chelation, and physical adsorption.
Related JoVE Video
Cloning, expression, purification, and characterization of a glutamate-specific endopeptidase from Bacillus licheniformis.
Protein Expr. Purif.
PUBLISHED: 10-14-2011
Show Abstract
Hide Abstract
A gene encoding a glutamate-specific endopeptidase (GSE) from Bacillus licheniformis (BL) has been cloned in Escherichia coli cells. The recombinant protein was expressed as cytoplasmic insoluble inclusion bodies. Immobilized metal affinity chromatography was employed to purify the protein, and then a 27-kDa GSE intermediate was obtained by gradient urea dialysis. The remaining pro-peptide was completely removed by treatment with trypsin to obtain mature GSE-BL with a molecular weight of 26 kD at a final yield of up to 140.9 mg/L. With Z (benzyloxycarbomyl)-Phe-Leu-Glu-pNA (p-nitroanilide) as the substrate, the optimal temperature and pH conditions for the enzyme were 37 °C and 8.5, respectively, K(m) was 1.495 ± 0.034 mM, and V(max) was 50.237 ?mol/mg min. The presence of calcium and ferrous ions enhanced the catalytic activity of GSE-BL. These results suggest that the recombinant protein is a relatively stable specific proteinase that could be effectively utilized in protein structure analysis, peptide synthesis, and the food industry.
Related JoVE Video
5-Aza-2-deoxycytidine reactivates gene expression via degradation of pRb pocket proteins.
FASEB J.
PUBLISHED: 10-11-2011
Show Abstract
Hide Abstract
Not only does 5-aza-2-deoxycytidine (5-aza-CdR) induce the reexpression of silenced genes through the demethylation of CpG islands, but it increases the expression of unmethylated genes. However, the mechanism by which 5-aza-CdR activates the expression of genes is not completely understood. Here, we report that the pRb pocket proteins pRb, p107, and p130 were degraded in various cancer cell lines in response to 5-aza-CdR treatment, and this effect was dependent on the proteasome pathway. Mouse double minute 2 (MDM2) played a critical role in this 5-aza-CdR-induced degradation of pRb. Furthermore, PP2A phosphatase-induced MDM2 dephosphorylation at S260 was found to be essential for MDM2 binding to pRb in the presence of 5-aza-CdR. pRb degradation resulted in the significant reexpression of several genes, including methylated CDKN2A, RASFF1A, and unmethylated CDKN2D. Finally, knockdown of pRb pocket proteins by either RNAi or 5-aza-CdR treatment induced a significant decrease in the recruitment of SUV39H1 and an increase in the enrichment of KDM3B and KDM4A to histones around the promoter of RASFF1A and thus reduced H3K9 di- and trimethylation, by which RASFF1A expression is activated. Our data reveal a novel mechanism by which 5-aza-CdR induces the expression of both methylated and unmethylated genes by degrading pRb pocket proteins.
Related JoVE Video
Morphological changes of ricin toxin-induced apoptosis in human cervical cancer cells.
Toxicol Ind Health
PUBLISHED: 09-21-2011
Show Abstract
Hide Abstract
The morphological changes of ricin-induced apoptosis in a human cervical cancer cell line were studied. To shed light on the mechanism of action of ricin toxin (RT) at the cellular level, we examined cell growth, apoptosis, changes of mitochondrial membrane potential (MMP) and cytochrome C translocation in HeLa cells by exposing these cells to RT for indicated times. The effect of RT on cell proliferation was measured by 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS), inner salt; MTS assay and apoptosis were measured using flow cytometry, fluorescence microscopy and electron microscopy. Changes in MMP were monitored using flow cytometry. Western blot analysis was used to evaluate the release of mitochondrial cytochrome C. RT noticeably inhibited the proliferation of HeLa cells, and the half maximal inhibitory concentration dose was about 100 ng/ml. HeLa cells treated with RT showed typical characteristics of apoptosis rather than necrosis, including phosphatidylserine exposed from the inner to the outer leaflet of the plasma membrane, abnormal cell morphology, chromatin condensation and nuclear fragmentation. In contrast, during the process of cellular apoptosis, the messenger RNA (mRNA) and protein expression of cytochrome C in treated and untreated Hela cells were not significantly changed (data not shown). However, when cells were treated with RT, the massive translocation of cytochrome C to the nucleus was evident. Our results indicate that RT-induced HeLa cell apoptosis, especially for cytochrome C translocation, may play an important role in apoptosis induced by RT.
Related JoVE Video
Detection of functional modules from protein interaction networks with an enhanced random walk based algorithm.
Int J Comput Biol Drug Des
PUBLISHED: 07-21-2011
Show Abstract
Hide Abstract
In this paper, we propose a new random walk-based clustering algorithm for detecting functional modules in protein-protein interaction (PPI) networks. It has been tested on two yeast PPI networks. Greater precision, better homogeneity and higher modularity were achieved in comparison with the results produced by the recently developed RRW clustering technique and the well-known CFinder algorithm. A much higher level of true positives were observed in the clustering results. The analysis indicated that the proposed method can not only detect overlapping modules but also be potentially used to identify functional modules with different topological structures, which may not be highly connected.
Related JoVE Video
Mixotrophic cultivation of Chlorella pyrenoidosa with diluted primary piggery wastewater to produce lipids.
Bioresour. Technol.
PUBLISHED: 07-18-2011
Show Abstract
Hide Abstract
Piggery wastewater that is used for microalgae cultivation has usually been treated by secondary treatment processes. The present study investigates mixotrophic cultivation of the green microalgae Chlorella pyrenoidosa with primary piggery wastewater that has merely been diluted before use. The biomass productivity of the microalgae exhibited a positive linear correlation with the initial COD values, which ranged from 250 to 1000 mg/L. Nutrients in the piggery wastewater were removed efficiently; for example, the removal rate of ammonium was over 90% in all diluted samples. Profiles of fatty acids in the algal lipids were different after cultivation in piggery wastewater medium compared to Bristols solution. The maximum lipid productivity of 6.3 mg L(-1) day(-1), which was achieved when the initial COD was 1000 mg/L, is not superior to other reports, but it suggests a convenient way to reduce the high organic content of piggery waste with the production of algal lipids.
Related JoVE Video
Multichannel oscillatory-flow multiplex PCR microfluidics for high-throughput and fast detection of foodborne bacterial pathogens.
Biomed Microdevices
PUBLISHED: 06-22-2011
Show Abstract
Hide Abstract
In the field of continuous-flow PCR, the amplification throughput in a single reaction solution is low and the single-plex PCR is often used. In this work, we reported a flow-based multiplex PCR microfluidic system capable of performing high-throughput and fast DNA amplification for detection of foodborne bacterial pathogens. As a demonstration, the mixture of DNA targets associated with three different foodborne pathogens was included in a single PCR solution. Then, the solution flowed through microchannels incorporated onto three temperature zones in an oscillatory manner. The effect factors of this oscillatory-flow multiplex PCR thermocycling have been demonstrated, including effects of polymerase concentration, cycling times, number of cycles, and DNA template concentration. The experimental results have shown that the oscillatory-flow multiplex PCR, with a volume of only 5 ?l, could be completed in about 13 min after 35 cycles (25 cycles) at 100 ?l/min (70 ?l/min), which is about one-sixth of the time required on the conventional machine (70 min). By using the presently designed DNA sample model, the minimum target concentration that could be detected at 30 ?l/min was 9.8?×?10(-2) ng/?l (278-bp, S. enterica), 11.2?×?10(-2) ng/?l (168-bp, E. coli O157: H7), and 2.88?×?10(-2) ng/?l (106-bp, L. monocytogenes), which corresponds to approximately 3.72?×?10(4) copies/?l, 3.58?×?10(4) copies/?l, and 1.79?×?10(4) copies/?l, respectively. This level of speed and sensitivity is comparable to that achievable in most other continuous-flow PCR systems. In addition, the four individual channels were used to achieve multi-target PCR analysis of three different DNA samples from different food sources in parallel, thereby achieving another level of multiplexing.
Related JoVE Video
A large scale comparative genomic analysis reveals insertion sites for newly acquired genomic islands in bacterial genomes.
BMC Microbiol.
PUBLISHED: 06-15-2011
Show Abstract
Hide Abstract
Bacterial virulence enhancement and drug resistance are major threats to public health worldwide. Interestingly, newly acquired genomic islands (GIs) from horizontal transfer between different bacteria strains were found in Vibrio cholerae, Streptococcus suis, and Mycobacterium tuberculosis, which caused outbreak of epidemic diseases in recently years.
Related JoVE Video
Mouse relapse model of Clostridium difficile infection.
Infect. Immun.
PUBLISHED: 05-16-2011
Show Abstract
Hide Abstract
Clostridium difficile is the causative agent of primary and recurrent antibiotic-associated diarrhea and colitis in hospitalized patients. The disease is caused mainly by two exotoxins, TcdA and TcdB, produced by the bacteria. Recurrent C. difficile infection (CDI) constitutes one of the most significant clinical issues of this disease, occurs in more than 20% of patients after the first episode, and may be increasing in frequency. However, there is no well-established animal model of CDI relapse currently available for studying disease pathogenesis, prevention, and therapy. Here we report the establishment of a conventional mouse model of recurrence/relapse CDI. We found that the primary episode of CDI induced little or no protective antibody response against C. difficile toxins and mice continued shedding C. difficile spores. Antibiotic treatment of surviving mice induced a second episode of diarrhea, while a simultaneous reexposure of animals to C. difficile bacteria or spores elicited a full spectrum of CDI similar to that of the primary infection. Moreover, mice treated with immunosuppressive agents were prone to more severe and fulminant recurrent disease. Finally, utilizing this model, we demonstrated that vancomycin only delayed disease recurrence, whereas neutralizing polysera against both TcdA and TcdB completely protected mice against CDI relapse. In conclusion, we have established a mouse relapse CDI model that allows for future investigations of the role of the host immune response in the diseases pathogenesis and permits critical testing of new therapeutics targeting recurrent disease.
Related JoVE Video
Predictive integration of gene functional similarity and co-expression defines treatment response of endothelial progenitor cells.
BMC Syst Biol
PUBLISHED: 03-30-2011
Show Abstract
Hide Abstract
Endothelial progenitor cells (EPCs) have been implicated in different processes crucial to vasculature repair, which may offer the basis for new therapeutic strategies in cardiovascular disease. Despite advances facilitated by functional genomics, there is a lack of systems-level understanding of treatment response mechanisms of EPCs. In this research we aimed to characterize the EPCs response to adenosine (Ado), a cardioprotective factor, based on the systems-level integration of gene expression data and prior functional knowledge. Specifically, we set out to identify novel biosignatures of Ado-treatment response in EPCs.
Related JoVE Video
Screening of the common culture conditions affecting crystallinity of bacterial cellulose.
J. Ind. Microbiol. Biotechnol.
PUBLISHED: 03-25-2011
Show Abstract
Hide Abstract
By analyzing with X-ray diffraction and FT-IR spectroscopy, the main effective factors among common culture conditions on crystallinity index and I(?) fraction of cellulose produced by Gluconacetobacter xylinus were examined with Plackett-Burman design experiment. Varying pH value in the medium by adjusting the composition of citrate buffer or by adding HCl/NaOH solution indicates it is the content of citrate buffer rather than its function of pH buffering that gives the influence on crystallinity. Further experiment reveals that Na+ concentration of 0.174 mol/l in medium with citrate buffer added would decrease the crystallinity index significantly. Comparison of carbon sources shows that fructose leads to a higher crystallinity index than glucose, which suggests a relationship between crystallinity and production speed of bacterial cellulose affected by carbon sources. An interesting phenomenon was that a longer period of cultivation would decrease the crystallinity of bacterial cellulose. The reason is assumed to be the dense network of cellulose formed by bacterial cells that restrict the motion of themselves as the incubation period extends. Though the effect of inoculum age is still unclear, the influence on crystallinity of bacterial cellulose caused by variation of some ordinary culture conditions can be drawn out from data of this work.
Related JoVE Video
Laboratory-based surveillance of extensively drug-resistant tuberculosis, China.
Emerging Infect. Dis.
PUBLISHED: 03-12-2011
Show Abstract
Hide Abstract
To estimate the prevalence of extensively drug-resistant tuberculosis (XDR TB) in China, we retrospectively analyzed drug-resistance profiles of 989 clinical Mycobacterium tuberculosis isolates. We found 319 (32.3%) isolates resistant to ?1 first-line drugs; 107 (10.8%) isolates were multidrug resistant, of which 20 (18.7%) were XDR. XDR TB is of major concern in China.
Related JoVE Video
Overexpression of Shadoo protein in transgenic mice does not impact the pathogenesis of scrapie.
Neurosci. Lett.
PUBLISHED: 02-22-2011
Show Abstract
Hide Abstract
Shadoo is a glycoprotein expressed in the adult brain that is an interacting protein of prion protein; however, its function remains to be determined. To elucidate its role in prion pathogenesis, we generated transgenic mice overexpressing wild-type (wt) Shadoo driven by the murine PrP promoter. Expression of the murine Sprn transgene significantly increased brain Shadoo protein levels in all three mouse lines generated. Following infection with mouse-adapted scrapie strain 22L, all transgenic mice tested exhibited characteristics of scrapie disease. Importantly, there was no correlation between the expression level or incubation time of Shadoo with disease phenotype. We therefore conclude that Shadoo has little or no influence on the outcome of transmissible spongiform encephalopathy (TSE) disease in transgenic mice.
Related JoVE Video
A machine learning approach to assessing gait patterns for Complex Regional Pain Syndrome.
Med Eng Phys
PUBLISHED: 02-08-2011
Show Abstract
Hide Abstract
Complex Regional Pain Syndrome (CRPS) is a condition that causes a long-term burning pain in a limb or part of a limb and it can cause various degrees of the physical functional performance deterioration. Objective assessment of physical functional performance of patients is one critical component to evaluate the therapy outcome for CRPS. This paper aims to investigate the feasibility of assessing the physical performance of patients with Complex Regional Pain Syndrome based on the analysis of gait data recorded by an accelerometer in short walking distances. Ten subjects with CRPS and ten control subjects were recruited. Thirty three features were extracted from each recording. A machine learning method, Multilayer perceptron neural-networks (MLP), was applied to classify the normal and abnormal gait patterns from data obtained on a 2.4m performance evaluation test. The best classification accuracy (99.38%) was achieved using 3 features selected by a step-wise-forward method. To further validate its performance, an independent test set including 14 cases extracted from data obtained on a 20 m performance evaluation test was adopted. A prediction accuracy of 85.7% was obtained.
Related JoVE Video
Systems-based biological concordance and predictive reproducibility of gene set discovery methods in cardiovascular disease.
J Biomed Inform
PUBLISHED: 01-31-2011
Show Abstract
Hide Abstract
The discovery of novel disease biomarkers is a crucial challenge for translational bioinformatics. Demonstration of both their classification power and reproducibility across independent datasets are essential requirements to assess their potential clinical relevance. Small datasets and multiplicity of putative biomarker sets may explain lack of predictive reproducibility. Studies based on pathway-driven discovery approaches have suggested that, despite such discrepancies, the resulting putative biomarkers tend to be implicated in common biological processes. Investigations of this problem have been mainly focused on datasets derived from cancer research. We investigated the predictive and functional concordance of five methods for discovering putative biomarkers in four independently-generated datasets from the cardiovascular disease domain. A diversity of biosignatures was identified by the different methods. However, we found strong biological process concordance between them, especially in the case of methods based on gene set analysis. With a few exceptions, we observed lack of classification reproducibility using independent datasets. Partial overlaps between our putative sets of biomarkers and the primary studies exist. Despite the observed limitations, pathway-driven or gene set analysis can predict potentially novel biomarkers and can jointly point to biomedically-relevant underlying molecular mechanisms.
Related JoVE Video
Methyltransferase Set7/9 regulates p53 activity by interacting with Sirtuin 1 (SIRT1).
Proc. Natl. Acad. Sci. U.S.A.
PUBLISHED: 01-18-2011
Show Abstract
Hide Abstract
Numerous studies indicate that Sirtuin 1 (SIRT1), a mammalian nicotinamide adenine dinucleotide (NAD(+))-dependent histone deacetylase (HDAC), plays a crucial role in p53-mediated stress responses by deacetylating p53. Nevertheless, the acetylation levels of p53 are dramatically increased upon DNA damage, and it is not well understood how the SIRT1-p53 interaction is regulated during the stress responses. Here, we identified Set7/9 as a unique regulator of SIRT1. SIRT1 interacts with Set7/9 both in vitro and in vivo. In response to DNA damage in human cells, the interaction between Set7/9 and SIRT1 is significantly enhanced and coincident with an increase in p53 acetylation levels. Importantly, the interaction of SIRT1 and p53 is strongly suppressed in the presence of Set7/9. Consequently, SIRT1-mediated deacetylation of p53 is abrogated by Set7/9, and p53-mediated transactivation is increased during the DNA damage response. Of note, whereas SIRT1 can be methylated at multiple sites within its N terminus by Set7/9, a methylation-defective mutant of SIRT1 still retains its ability to inhibit p53 activity. Taken together, our results reveal that Set7/9 is a critical regulator of the SIRT1-p53 interaction and suggest that Set7/9 can modulate p53 function indirectly in addition to acting through a methylation-dependent mechanism.
Related JoVE Video
Mining, knowledge and decision support.
Technol Health Care
PUBLISHED: 11-25-2010
Show Abstract
Hide Abstract
Decision support systems (DSS) are software entities that assist the physician in the decision making process. They have found application in medicine due to the large amounts of data (e.g. laboratory measurements such as blood pressure, heart rate, body-mass index) and information (e.g. patient history, population statistics based on age and sex) that must be considered before diagnosing any disease or recommending a therapy. A well known example is the embedded software in defibrillators which allows a shock to be delivered, by analyzing the electrocardiogram for known conditions (heart attack). The shock can restart the heart and timely delivery can resuscitate the patient. As well as assisting in primary diagnosis, a DSS can reduce medical error, assist compliance with clinical guidelines, improve efficiency of care delivery and improve quality of care. Decision support still has significant acceptance issues in clinical routine, but can achieve more prominence, as systems are demonstrated to provide effective knowledge based support. Data mining is often used to provide some insight to a data set and update our accepted knowledge. In this section, we discuss a study which examines where electrocardiographic information should be recorded from a patients torso in order to increase diagnostic yield.
Related JoVE Video
Identifying sources and assessing potential risk of heavy metals in soils from direct exposure to children in a mine-impacted city, Changsha, China.
J. Environ. Qual.
PUBLISHED: 11-04-2010
Show Abstract
Hide Abstract
Heavy metal pollutants in soils can usually enter the human body and pose heath risks through a soil-crop-human body pathway (indirect exposure) or soil-human body pathway (direct exposure). Previous studies often neglected the direct exposure in human health risk assessment, especially for children. We collected surface soil samples from urban and suburb areas in Changsha City, China, to analyze the content ofAs, Cd, Hg, Ni, Pb, and Zn. A combination of principal component analysis, geostatistics, and triangulated irregular network (TIN) model was successfully used to discriminate the sources of heavy metals. The direct exposure method, sequential indicator simulation, and geographical information system (GIS) technologies were used to perform a health risk assessment of heavy metal exposure to children living in the study area. Results show that heavy metal contamination in Changsha may originate from coal usage and industrial activities. One thousand equiprobable realizations suggest that not all sites within the study area may be suitable for housing or allotments without remediation. Most high hazard indexes are located in the suburb and mining areas. Moreover, arsenic presents a high health risk in comparison with other elements. Compared with inhalation and dermal contact in direct soil exposure, soil ingestion is the largest contribution to potential health risks for children. This study indicates that we should attach great importance to the direct soil exposure for childrens health.
Related JoVE Video
Ontology- and graph-based similarity assessment in biological networks.
Bioinformatics
PUBLISHED: 08-27-2010
Show Abstract
Hide Abstract
A standard systems-based approach to biomarker and drug target discovery consists of placing putative biomarkers in the context of a network of biological interactions, followed by different guilt-by-association analyses. The latter is typically done based on network structural features. Here, an alternative analysis approach in which the networks are analyzed on a semantic similarity space is reported. Such information is extracted from ontology-based functional annotations. We present SimTrek, a Cytoscape plugin for ontology-based similarity assessment in biological networks.
Related JoVE Video
Multi-level integrative analysis of Protein Protein Interaction networks: connecting completeness, depth and robustness.
Int J Comput Biol Drug Des
PUBLISHED: 08-05-2010
Show Abstract
Hide Abstract
A fully extended Protein Protein Interaction (PPI) network can consist of upwards of several thousand nodes and edges. To simplify analysis, smaller child samples are often used in substitution of the global network. In this study, the impact of different levels of sampling was evaluated on six PPI networks. Results from the case studies suggest that restricting analysis to the first network level, using metrics such as degree and BC, could lead to misrepresentative results, omitting potentially significant nodes. Fault-tolerance analysis also indicates that key nodes within the second network level, and above, contribute to the stability of the global network.
Related JoVE Video
Potential health risk of arsenic and cadmium in groundwater near Xiangjiang River, China: a case study for risk assessment and management of toxic substances.
Environ Monit Assess
PUBLISHED: 05-06-2010
Show Abstract
Hide Abstract
As part of our efforts to find effective methods to the drinking water risk management, the health risk assessment of arsenic and cadmium in groundwater near Xiangjiang River was analyzed. The results suggest that although the arsenic and cadmium concentrations in 97% of groundwater sources are less than the requirement of Water Quality Standards for Drinking Water (GB5749-2006) in China, the residents served by almost all of the investigated centralized drinking water sources have a significant potential health risk by consumption, especially cancer risk. It is justified through analyses that risk assessment is an effective tool for risk management, and the maximum permissible concentration of arsenic and cadmium in drinking water (0.01 and 0.005 mg L(-1), respectively) is suitable for China at present, considering the current economic status of China. Risk managers develop cleanup standards designed to protect against all possible adverse effects, which should take into account highly exposed individuals, effects of mixtures of toxic substances, attendant uncertainties, and other factors such as site-specific (or generic) criteria, technical feasibility, cost-benefit analyses, and sociopolitical concerns.
Related JoVE Video
Ingestion risks of metals in groundwater based on TIN model and dose-response assessment - A case study in the Xiangjiang watershed, central-south China.
Sci. Total Environ.
PUBLISHED: 04-11-2010
Show Abstract
Hide Abstract
Groundwater samples were collected in the Xiangjiang watershed in China from 2002 to 2008 to analyze concentrations of arsenic, cadmium, chromium, copper, iron, lead, mercury, manganese, and zinc. Spatial and seasonal trends of metal concentrations were then discussed. Combined with geostatistics, an ingestion risk assessment of metals in groundwater was performed using the dose-response assessment method and the triangulated irregular network (TIN) model. Arsenic concentration in groundwater had a larger variation from year to year, while the variations of other metal concentrations were minor. Meanwhile, As concentrations in groundwater over the period of 2002-2004 were significantly higher than that over the period of 2005-2007, indicating the improvement of groundwater quality within the later year. The hazard index (HI) in 2002 was also significantly higher than that in 2005, 2006, 2007 and 2008. Moreover, more than 80% of the study area recorded an HI of more than 1.0 for children, suggesting that some people will experience deleterious health effects from drinking groundwater in the Xiangjiang watershed. Arsenic and manganese were the largest contributors to human health risks (HHRs). This study highlights the value of long-term health risk evaluation and the importance of geographic information system (GIS) technologies in the assessment of watershed-scale human health risk.
Related JoVE Video
Melanoma-specific marker expression in skin biopsy tissues as a tool to facilitate melanoma diagnosis.
J. Invest. Dermatol.
PUBLISHED: 04-01-2010
Show Abstract
Hide Abstract
Diagnosis of cutaneous melanoma requires accurate differentiation of true malignant tumors from highly atypical lesions, which lack the capacity to develop uncontrolled proliferation and to metastasize. We used melanoma markers from previous work to differentiate benign and atypical lesions from melanoma using paraffin-embedded tissue. This critical step in diagnosis generates the most uncertainty and discrepancy between dermatopathologists. A total of 193 biopsy tissues were selected: 47 melanomas, 48 benign nevi, and 98 atypical/suspicious, including 48 atypical nevi and 50 melanomas as later assigned by expert dermatopathologists. Performance for SILV, GDF15, and L1CAM normalized to TYR in unequivocal melanoma versus benign nevi resulted in an area under the curve (AUC) of 0.94, 0.67, and 0.5, respectively. SILV also differentiated atypical cases classified as melanoma from atypical nevi with an AUC=0.74. Furthermore, SILV showed a significant difference between suspicious melanoma and each suspicious atypia group: melanoma versus severe atypia and melanoma versus moderate atypia had P-values of 0.0077 and 0.0009, respectively. SILV showed clear discrimination between melanoma and benign unequivocal cases as well as between different atypia subgroups in the group of suspicious samples. The role and potential utility of this molecular assay as an adjunct to the morphological diagnosis of melanoma are discussed.
Related JoVE Video
Ascomycota has a faster evolutionary rate and higher species diversity than Basidiomycota.
Sci China Life Sci
PUBLISHED: 03-18-2010
Show Abstract
Hide Abstract
Differences in rates of nucleotide or amino acid substitutions among major groups of organisms are repeatedly found and well documented. A growing body of evidence suggests a link between the rate of neutral molecular change within populations and the evolution of species diversity. More than 98% of terrestrial fungi belong to the phyla Ascomycota or Basidiomycota. The former is considerably richer in number of species than the latter. We obtained DNA sequences of 21 protein-coding genes from the lichenized fungus Rhizoplaca chrysoleuca and used them together with sequences from GenBank for subsequent analyses. Three datasets were used to test rate discrepancies between Ascomycota and Basidiomycota and that within Ascomycota: (i) 13 taxa including 105 protein-coding genes, (ii) nine taxa including 21 protein-coding genes, and (iii) nuclear LSU rDNA of 299 fungal species. Based on analyses of the 105 protein-coding genes and nuclear LSU rDNA datasets, we found that the evolutionary rate was higher in Ascomycota than in Basidiomycota. The differences in substitution rates between Ascomycota and Basidiomycota were significant. Within Ascomycota, the species-rich Sordariomycetes has the fastest evolutionary rate, while Leotiomycetes has the slowest. Our results indicate that the main contribution to the higher substitution rates in Ascomycota does not come from mutualism, ecological conditions, sterility, metabolic rate or shorter generation time, but is possibly caused by the founder effect. This is another example of the correlation between species number and evolutionary rates, which is consistent with the hypothesis that the founder effect is responsible for accelerated substitution rates in diverse clades.
Related JoVE Video
Identification of sequence repetitions in immunoglobulin folds.
J. Mol. Graph. Model.
PUBLISHED: 01-20-2010
Show Abstract
Hide Abstract
A lot of evidence suggests that many proteins with the symmetric structures have evolved by internal duplication and fusion. Meanwhile many internal sequence repeats correspond to functional and structural units. These proteins, which have internal structural symmetry, this means that their sequences should be made up of identical repeats. However, many of these repeat signals can only be seen at the structural level yet. We have developed a de novo algorithm, modified recurrence correlation analysis, to detect the symmetries in the primary sequences of immunoglobulin folds (Ig folds), which adopt highly symmetrical tertiary structures while their sequences appear nearly random. Using this method, we show that the internal repetitions of the immunoglobulin folds could be identified directly at the sequence level. These results may give us some help to study the hypotheses about the origin of Ig folds by duplication of simpler fragments and it may also give us some helps to understand the relationship between the sequences and their tertiary structures.
Related JoVE Video
A knowledge-driven probabilistic framework for the prediction of protein-protein interaction networks.
Comput. Biol. Med.
PUBLISHED: 01-01-2010
Show Abstract
Hide Abstract
This study applied a knowledge-driven data integration framework for the inference of protein-protein interactions (PPI). Evidence from diverse genomic features is integrated using a knowledge-driven Bayesian network (KD-BN). Receiver operating characteristic (ROC) curves may not be the optimal assessment method to evaluate a classifiers performance in PPI prediction as the majority of the area under the curve (AUC) may not represent biologically meaningful results. It may be of benefit to interpret the AUC of a partial ROC curve whereby biologically interesting results are represented. Therefore, the novel application of the assessment method referred to as the partial ROC has been employed in this study to assess predictive performance of PPI predictions along with calculating the True positive/false positive rate and true positive/positive rate. By incorporating domain knowledge into the construction of the KD-BN, we demonstrate improvement in predictive performance compared with previous studies based upon the Naive Bayesian approach.
Related JoVE Video
[Comparison of net photosynthetic rate changes in different species of Siraitia grosvenorii in late growth period].
Zhongguo Zhong Yao Za Zhi
PUBLISHED: 12-03-2009
Show Abstract
Hide Abstract
To analyze the relationship between the net photosynthetic rate and the quality of Siraitia grosvenorii.
Related JoVE Video
Bioequivalence of a single 10-mg dose of finasteride 5-mg oral disintegrating tablets and standard tablets in healthy adult male Han Chinese volunteers: a randomized sequence, open-label, two-way crossover study.
Clin Ther
PUBLISHED: 06-30-2009
Show Abstract
Hide Abstract
Finasteride, an inhibitor of the steroid 5alpha-reductase, has been approved for the treatment of benign prostatic hyperplasia and androgenetic alopecia. An orally disintegrating tablet (ODT) 5-mg formulation of finasteride was recently developed. Information regarding its pharmacokinetics and bioequivalence was required to assess the efficacy and safety of this formulation before marketing it in China.
Related JoVE Video
Proliferating cell nuclear antigen is protected from degradation by forming a complex with MutT Homolog2.
J. Biol. Chem.
PUBLISHED: 05-06-2009
Show Abstract
Hide Abstract
Proliferating cell nuclear antigen (PCNA) has been demonstrated to interact with multiple proteins involved in several metabolic pathways such as DNA replication and repair. However, there have been fewer reports about whether these PCNA-binding proteins influence stability of PCNA. Here, we observed a physical interaction between PCNA and MutT homolog2 (MTH2), a new member of the MutT-related proteins that hydrolyzes 8-oxo-7,8-dihydrodeoxyguanosine triphosphate (8-oxo-dGTP). In several unstressed human cancer cell lines and in normal human fibroblast cells, PCNA and MTH2 formed a complex and their mutual binding fragments were confirmed. It was intriguing that PCNA and MTH2 were dissociated dependent on acetylation of PCNA, which in turn induced degradation of PCNA in response to UV irradiation, but not in response to other forms of DNA-damaging stress. To further explore the link between dissociation of PCNA-MTH2 and degradation of PCNA, RNAi against MTH2 was performed to mimic the dissociated status of PCNA to evaluate changes in the half-life of PCNA. Knockdown of MTH2 significantly promoted degradation of PCNA, suggesting that the physiological interaction of PCNA-MTH2 may confer protection from degradation for PCNA, whereas UV irradiation accelerates PCNA degradation by inducing dissociation of PCNA-MTH2. Moreover, secondary to degradation of PCNA, UV-induced inhibition of DNA synthesis or cell cycle progression was enhanced. Collectively, our data demonstrate for the first time that PCNA is protected by this newly identified partner molecule MTH2, which is related to DNA synthesis and cell cycle progression.
Related JoVE Video

What is Visualize?

JoVE Visualize is a tool created to match the last 5 years of PubMed publications to methods in JoVE's video library.

How does it work?

We use abstracts found on PubMed and match them to JoVE videos to create a list of 10 to 30 related methods videos.

Video X seems to be unrelated to Abstract Y...

In developing our video relationships, we compare around 5 million PubMed articles to our library of over 4,500 methods videos. In some cases the language used in the PubMed abstracts makes matching that content to a JoVE video difficult. In other cases, there happens not to be any content in our video library that is relevant to the topic of a given abstract. In these cases, our algorithms are trying their best to display videos with relevant content, which can sometimes result in matched videos with only a slight relation.