JoVE Visualize What is visualize?
Stop Reading. Start Watching.
Advanced Search
Stop Reading. Start Watching.
Regular Search
Find video protocols related to scientific articles indexed in Pubmed.
Crystal Structure of a Promoter Sequence in the B-raf Gene Reveals an Intertwined Dimer Quadruplex.
J. Am. Chem. Soc.
PUBLISHED: 12-11-2013
Show Abstract
Hide Abstract
The sequence d(GGGCGGGGAGGGGGAAGGGA) occurs in the promoter region of the B-raf gene. An X-ray crystallographic study has found that this forms an unprecedented dimeric quadruplex arrangement, with a core of seven consecutive G-quartets and an uninterrupted run of six potassium ions in the central channel of the quadruplex. Analogy with previously reported promoter quadruplexes had initially suggested that in common with these a monomeric quadruplex was to be expected. The structure has a distorted G·C·G·C base quartet at one end and four flipped-out adenosine nucleosides at the other. The only loops in the structure are formed by the cytosine and by the three adenosines within the sequence, with all of the guanosines participating in G-quartet formation. Solution UV and circular dichroism data are in accord with a stable quadruple arrangement being formed. 1D NMR data, together with gel electrophoresis measurements, are consistent with a dimer being the dominant species in potassium solution. A single-chain intramolecular quadruplex has been straightforwardly constructed using molecular modeling, by means of a six-nucleotide sequence joining 3 and 5 ends of each strand in the dimer. A human genomic database search has revealed a number of sequences containing eight or more consecutive short G-tracts, suggesting that such intramolecular quadruplexes could be formed within the human genome.
Related JoVE Video
A new plant-derived antibacterial is an inhibitor of efflux pumps in Staphylococcus aureus.
Int. J. Antimicrob. Agents
PUBLISHED: 07-12-2013
Show Abstract
Hide Abstract
An in-depth evaluation was undertaken of a new antibacterial natural product (1) recently isolated and characterised from the plant Hypericum olympicum L. cf. uniflorum. Minimum inhibitory concentrations (MICs) were determined for a panel of bacteria, including: meticillin-resistant and -susceptible strains of Staphylococcus aureus, Staphylococcus epidermidis and Staphylococcus haemolyticus; vancomycin-resistant and -susceptible Enterococcus faecalis and Enterococcus faecium; penicillin-resistant and -susceptible Streptococcus pneumoniae; group A streptococci (Streptococcus pyogenes); and Clostridium difficile. MICs were 2-8mg/L for most staphylococci and all enterococci, but were ?16mg/L for S. haemolyticus and were >32mg/L for all species in the presence of blood. Compound 1 was also tested against Gram-negative bacteria, including Escherichia coli, Pseudomonas aeruginosa and Salmonella enterica serovar Typhimurium but was inactive. The MIC for Mycobacterium bovis BCG was 60mg/L, and compound 1 inhibited the ATP-dependent Mycobacterium tuberculosis MurE ligase [50% inhibitory concentration (IC50)=75?M]. In a radiometric accumulation assay with a strain of S. aureus overexpressing the NorA multidrug efflux pump, the presence of compound 1 increased accumulation of (14)C-enoxacin in a concentration-dependent manner, implying inhibition of efflux. Only moderate cytotoxicity was observed, with IC50 values of 12.5, 10.5 and 8.9?M against human breast, lung and fibroblast cell lines, respectively, highlighting the potential value of this chemotype as a new antibacterial agent and efflux pump inhibitor.
Related JoVE Video
Optimization of anti-proliferative activity using a screening approach with a series of bis-heterocyclic G-quadruplex ligands.
Bioorg. Med. Chem. Lett.
PUBLISHED: 06-19-2013
Show Abstract
Hide Abstract
Using a phenotypic screening and SAR optimization approach, a phenyl-bis-oxazole derivative has been identified with anti-proliferative activity, optimized with the use of a panel of cancer cell lines. The lead compound was synthesized by means of a short and effective two-step synthesis using Pd-catalyzed direct arylation. The compound stabilizes several quadruplex DNA sequences including a human telomeric DNA and one from the promoter of the HSP90 gene, although the structure-activity relationships of the series are not obviously related to the quadruplex binding.
Related JoVE Video
The influence of positional isomerism on G-quadruplex binding and anti-proliferative activity of tetra-substituted naphthalene diimide compounds.
Bioorg. Med. Chem.
PUBLISHED: 04-08-2013
Show Abstract
Hide Abstract
The synthesis together with biophysical and biological evaluation of a series of tetra-substituted naphthalene diimide (ND) compounds, are presented. These compounds are positional isomers of a recently-described series of quadruplex-binding ND derivatives, in which the two N-methyl-piperidine-alkyl side-chains have now been interchanged with the positions of side-chains bearing a range of end-groups. Molecular dynamics simulations of a pair of positional isomers are in accord with the quadruplex stabilization and biological data for these compounds. Analysis of structure-activity data indicates that for compounds where the side-chains are not of equivalent length then the positional isomers described here tend to have improved cell proliferation potency and in some instances, superior quadruplex stabilization ability.
Related JoVE Video
Structure-based design and evaluation of naphthalene diimide G-quadruplex ligands as telomere targeting agents in pancreatic cancer cells.
J. Med. Chem.
PUBLISHED: 04-02-2013
Show Abstract
Hide Abstract
Tetra-substituted naphthalene diimide (ND) derivatives with positively charged termini are potent stabilizers of human telomeric and gene promoter DNA quadruplexes and inhibit the growth of human cancer cells in vitro and in vivo. The present study reports the enhancement of the pharmacological properties of earlier ND compounds using structure-based design. Crystal structures of three complexes with human telomeric intramolecular quadruplexes demonstrate that two of the four strongly basic N-methyl-piperazine groups can be replaced by less basic morpholine groups with no loss of intermolecular interactions in the grooves of the quadruplex. The new compounds retain high affinity to human telomeric quadruplex DNA but are 10-fold more potent against the MIA PaCa-2 pancreatic cancer cell line, with IC50 values of ~10 nM. The lead compound induces cellular senescence but does not inhibit telomerase activity at the nanomolar dosage levels required for inhibition of cellular proliferation. Gene array qPCR analysis of MIA PaCa-2 cells treated with the lead compound revealed significant dose-dependent modulation of a distinct subset of genes, including strong induction of DNA damage responsive genes CDKN1A, DDIT3, GADD45A/G, and PPM1D, and repression of genes involved in telomere maintenance, including hPOT1 and PARP1.
Related JoVE Video
Thioester derivatives of the natural product psammaplin A as potent histone deacetylase inhibitors.
Beilstein J Org Chem
PUBLISHED: 01-15-2013
Show Abstract
Hide Abstract
There has been significant interest in the bioactivity of the natural product psammaplin A, most recently as a potent and isoform selective HDAC inhibitor. Here we report our preliminary studies on thioester HDAC inhibitors derived from the active monomeric (thiol) form of psammaplin A, as a means to improve compound delivery into cells. We have discovered that such compounds exhibit both potent cytotoxicity and enzymatic inhibitory activity against recombinant HDAC1. The latter effect is surprising since previous SAR suggested that modification of the thiol functionality should detrimentally affect HDAC potency. We therefore also report our preliminary studies on the mechanism of action of this observed effect.
Related JoVE Video
Molecular basis of structure-activity relationships between salphen metal complexes and human telomeric DNA quadruplexes.
J. Med. Chem.
PUBLISHED: 12-13-2011
Show Abstract
Hide Abstract
The first X-ray crystal structures of nickel(II) and copper(II) salphen metal complexes bound to a quadruplex DNA are presented. Two structures have been determined and show that these salphen-metal complexes bind to human telomeric quadruplexes by end-stacking, with the metal in each case almost in line with the potassium ion channel. Quadruplex and duplex DNA binding is presented for these two and other related salphen complexes, all with side-chains terminating in pyrrolidino end-groups and differing patterns of substitution on the salphen core. The crystal structures are able to provide rationalizations for the structure-activity data, and in particular for the superior quadruplex-binding of the nickel complexes compared to that of the copper-containing ones. The complexes show significant antiproliferative activity for the compounds in a panel of cancer cell lines. They also show telomerase inhibitory activity in the telomerase TRAP-LIG assay.
Related JoVE Video
Targeting pancreatic cancer with a G-quadruplex ligand.
Bioorg. Med. Chem.
PUBLISHED: 08-16-2011
Show Abstract
Hide Abstract
The integrity of telomeres in most cancer cells is maintained by the action of the telomerase enzyme complex, which catalyzes the synthesis of telomeric DNA repeats in order to replace those lost during replication. Telomerase is especially up-regulated in metastatic cancer and is thus emerging as a major therapeutic target. One approach to telomerase inhibition involves the sequestration of the single-stranded 3 ends of telomeric DNA into higher-order quadruplex structures. We have recently shown that tetra-substituted naphthalene diimide compounds are potent quadruplex-stabilizing molecules with telomerase inhibitory activity in cells. We show here that one such compound, BMSG-SH-3, which has been optimized by computer modeling, has significant in vivo antitumor activity against a model for pancreatic cancer, a cancer that is especially resistant to current therapies. A large reduction in telomerase activity in treated tumors was observed and the naphthalene diimide compound was found to be selectively localized in the treated tumors. We find that the expression of the therapeutically important chaperone protein HSP90, a regulator of telomerase is also reduced in vivo by BMSG-SH-3 treatment. The compound is a potent stabilizer of two G-quadruplex sequences found in the promoter region of the HSP90 gene, as well as a G-quadruplex from human telomeric DNA. It is proposed that the simultaneous targeting of these quadruplexes may be an effective anti-tumor strategy.
Related JoVE Video
Rational design of acridine-based ligands with selectivity for human telomeric quadruplexes.
J. Am. Chem. Soc.
PUBLISHED: 08-20-2010
Show Abstract
Hide Abstract
Structure-based modeling methods have been used to design a series of disubstituted triazole-linked acridine compounds with selectivity for human telomeric quadruplex DNAs. A focused library of these compounds was prepared using click chemistry and the selectivity concept was validated against two promoter quadruplexes from the c-kit gene with known molecular structures, as well as with duplex DNA using a FRET-based melting method. Lead compounds were found to have reduced effects on the thermal stability of the c-kit quadruplexes and duplex DNA structures. These effects were further explored with a series of competition experiments, which confirmed that binding to duplex DNA is very low even at high duplex:telomeric quadruplex ratios. Selectivity to the c-kit quadruplexes is more complex, with some evidence of their stabilization at increasing excess over human telomeric quadruplex DNA. Selectivity is a result of the dimensions of the triazole-acridine compounds, and in particular the separation of the two alkyl-amino terminal groups. Both lead compounds also have selective inhibitory effects on the proliferation of cancer cell lines compared to a normal cell line, and one has been shown to inhibit the activity of the telomerase enzyme, which is selectively expressed in tumor cells, where it plays a role in maintaining telomere integrity and cellular immortalization.
Related JoVE Video
Tetrasubstituted naphthalene diimide ligands with selectivity for telomeric G-quadruplexes and cancer cells.
Bioorg. Med. Chem. Lett.
PUBLISHED: 08-11-2010
Show Abstract
Hide Abstract
A series of tetrasubstituted naphthalene diimide compounds with N-methylpiperazine end groups has been synthesized and evaluated as G-quadruplex ligands. They have high affinity and selectivity for telomeric G-quadruplex DNA over duplex DNA. CD studies show that they induce formation of a parallel G-quadruplex topology. They inhibit the binding of hPOT1 and topoisomerase III? to telomeric DNA and inhibit telomerase activity in MCF7 cells. The compounds have potent activity in a panel of cancer cell lines, with typical IC(50) values of ?0.1 ?M, and up to 100-fold lower toxicity in a normal human fibroblast cell line.
Related JoVE Video
Bis-guanylhydrazone diimidazo[1,2-a:1,2-c]pyrimidine as a novel and specific G-quadruplex binding motif.
Chem. Commun. (Camb.)
PUBLISHED: 06-28-2010
Show Abstract
Hide Abstract
A bis-guanylhydrazone derivative of diimidazo[1,2-a:1,2-c]pyrimidine has unexpectedly been found to be a potent stabiliser of several quadruplex DNAs, whereas there is no significant interaction with duplex DNA. Molecular modeling suggests that the guanylhydrazone groups play an active role in quadruplex binding.
Related JoVE Video
Biaryl polyamides as a new class of DNA quadruplex-binding ligands.
Chem. Commun. (Camb.)
PUBLISHED: 06-05-2009
Show Abstract
Hide Abstract
We report a novel class of biaryl polyamides highly selective for G-quadruplex DNA, and with significant cytotoxicity in several cancer cell lines; they form planar U-shaped structures that match the surface area dimensions of a terminal G-quartet in quadruplex structures rather than the grooves of duplex DNA.
Related JoVE Video
G-quadruplex compounds and cis-platin act synergistically to inhibit cancer cell growth in vitro and in vivo.
Biochem. Pharmacol.
PUBLISHED: 05-29-2009
Show Abstract
Hide Abstract
The ability of two structurally diverse telomeric G-quadruplex-binding compounds to synergise the action of cis-platin has been investigated in two cancer cell lines. One compound is a trisubstituted acridine compound AS1410, a close analogue of BRACO-19, and the other is a non-polycyclic compound synthesised using click chemistry and containing two triazole rings. Both compounds produce growth arrest at sub-cytotoxic concentrations in the two cell lines (MCF7 and A549), with behaviour consistent with telomere targeting mechanisms. Synergistic behaviour was observed in both cell lines with both compounds in combination with cis-platin, but only when the ratio of AS1410:cis-platin is >1. In vivo tumour xenograft studies with the A549 lung cancer model and the trisubstituted acridine compound AS1410 showed only a modest anti-tumour effect when administered alone, but produced rapid and highly significant decreases in tumour volume when administered in combination with cis-platin.
Related JoVE Video
Targeting human gastrointestinal stromal tumor cells with a quadruplex-binding small molecule.
J. Med. Chem.
PUBLISHED: 05-28-2009
Show Abstract
Hide Abstract
Most of human gastrointestinal stromal tumors (GIST) are driven by activating mutations in the proto-oncogene KIT, a tyrosine kinase receptor. Clinical treatment with imatinib targets the kinase domain of KIT, but tumor regrowth occurs as a result of the development of resistant mutations in the kinase active site. An alternative small-molecule approach to GIST therapy is described, in which the KIT gene is directly targeted, and thus, kinase resistance may be circumvented. A naphthalene diimide derivative has been used to demonstrate the concept of dual quadruplex targeting. This compound strongly stabilizes both telomeric quadruplex DNA and quadruplex sites in the KIT promoter in vitro. It is shown here that the compound is a potent inducer of growth arrest in a patient-derived GIST cell line at a concentration (approximately 1 microM) that also results in effective inhibition of telomerase activity and almost complete suppression of KIT mRNA and KIT protein expression. Molecular modeling studies with a telomeric quadruplex have been used to rationalize aspects of the experimental quadruplex melting data.
Related JoVE Video
Bioactive pyridine-N-oxide disulfides from Allium stipitatum.
J. Nat. Prod.
PUBLISHED: 03-24-2009
Show Abstract
Hide Abstract
From Allium stipitatum, three pyridine-N-oxide alkaloids (1-3) possessing disulfide functional groups were isolated. The structures of these natural products were elucidated by spectroscopic means as 2-(methyldithio)pyridine-N-oxide (1), 2-[(methylthiomethyl)dithio]pyridine-N-oxide (2), and 2,2-dithio-bis-pyridine-N-oxide (3). The proposed structure of 1 was confirmed by synthetic S-methylthiolation of commercial 2-thiopyridine-N-oxide. Compounds 1 and 2 are new natural products, and 3 is reported for the first time from an Allium species. All compounds were evaluated for activity against fast-growing species of Mycobacterium, methicillin-resistant Staphylococcus aureus, and a multidrug-resistant (MDR) variants of S. aureus. Compounds 1 and 2 exhibited minimum inhibitory concentrations (MICs) of 0.5-8 microg/mL against these strains. A small series of analogues of 1 were synthesized in an attempt to optimize antibacterial activity, although the natural product had the most potent in vitro activity. In a whole-cell assay at 30 microg/mL, 1 was shown to give complete inhibition of the incorporation of (14)C-labeled acetate into soluble fatty acids, indicating that it is potentially an inhibitor of fatty acid biosynthesis. In a human cancer cell line antiproliferative assay, 1 and 2 displayed IC(50) values ranging from 0.3 to 1.8 microM with a selectivity index of 2.3 when compared to a human somatic cell line. Compound 1 was evaluated in a microarray analysis that indicated a similar mode of action to menadione and 8-quinolinol by interfering with the thioredoxin system and up-regulating the production of various heat shock proteins. This compound was also assessed in a mouse model for in vivo toxicity.
Related JoVE Video
Sequences in the HSP90 promoter form G-quadruplex structures with selectivity for disubstituted phenyl bis-oxazole derivatives.
Bioorg. Med. Chem. Lett.
Show Abstract
Hide Abstract
The HSP90 protein is an important target in cancer. We report here that stable quadruplex DNAs can be formed from a promoter sequence in the HSP90 gene, on the basis of melting, circular and NMR studies, and show that these can be selectively targeted by non-macrocyclic quadruplex-stabilizing phenyl bis-oxazole derivatives. These do not bind significantly to duplex DNA and show low stabilization of the human telomeric quadruplex. These results suggest an approach to targeting HSP90 at the DNA level.
Related JoVE Video
The prenylated dioxopiperazine alkaloid Cristatin A has selective telomeric DNA G-quadruplex stabilising properties.
Chem. Commun. (Camb.)
Show Abstract
Hide Abstract
Cristatin A (1a/b), a prenylated dioxopiperazine alkaloid, has been shown to bind selectively to telomeric quadruplex DNA using a FRET-based DNA melting assay. Crucially, the molecule is more drug-like than most previously identified quadruplex-binding agents, and provides a unique chemical scaffold for future chemical biology and drug discovery studies.
Related JoVE Video
Bioactive compounds from Carissa spinarum.
Phytother Res
Show Abstract
Hide Abstract
In our continuing efforts to find new antiherpetic agents from plants, an extract prepared from the stems of Carissa spinarum L. was found to possess appreciable activity against herpes simplex viruses (HSV I and II). A chemical study of this plant was then initiated, and this led to the isolation of 12 compounds, including a coumarin, two cardiac glycosides and nine lignans. These isolated compounds were evaluated for several biological activities, including antiherpetic, cytotoxic, antioxidant and antibacterial effects. The cardiac glycoside evomonoside was found to be the only antiherpetic principle, showing moderate activity against herpes simplex virus types I and II in the inactivation method. The lignans (-)-carinol, (-)-carissanol and (-)-nortrachelogenin exhibited cytotoxicity against breast (MCF7) and lung (A549) cancer cells. Moderate anti-DPPH free radical activity was observed for all the lignans. None of the isolates showed antibacterial activity.
Related JoVE Video
Defining the mechanism of action and enzymatic selectivity of psammaplin A against its epigenetic targets.
J. Med. Chem.
Show Abstract
Hide Abstract
Psammaplin A (11c) is a marine metabolite previously reported to be a potent inhibitor of two classes of epigenetic enzymes: histone deacetylases and DNA methyltransferases. The design and synthesis of a focused library based on the psammaplin A core has been carried out to probe the molecular features of this molecule responsible for its activity. By direct in vitro assay of the free thiol generated upon reduction of the dimeric psammaplin scaffold, we have unambiguously demonstrated that 11c functions as a natural prodrug, with the reduced form being highly potent against HDAC1 in vitro (IC(50) 0.9 nM). Furthermore, we have shown it to have high isoform selectivity, being 360-fold selective for HDAC1 over HDAC6 and more than 1000-fold less potent against HDAC7 and HDAC8. SAR around our focused library revealed a number of features, most notably the oxime functionality to be important to this selectivity. Many of the compounds show significant cytotoxicity in A549, MCF7, and W138 cells, with the SAR of cytotoxicity correlating to HDAC inhibition. Furthermore, compound treatment causes upregulation of histone acetylation but little effect on tubulin acetylation. Finally, we have found no evidence for 11c functioning as a DNMT inhibitor.
Related JoVE Video
Discovery of new G-quadruplex binding chemotypes.
Chem. Commun. (Camb.)
Show Abstract
Hide Abstract
We report here on the discovery and preliminary evaluation of a novel non-macrocyclic low molecular weight quadruplex-stabilizing chemotype. The lead compounds, based on a furan core, show high G-quadruplex stabilisation and selectivity as well as potent in vitro anti-proliferative activity.
Related JoVE Video

What is Visualize?

JoVE Visualize is a tool created to match the last 5 years of PubMed publications to methods in JoVE's video library.

How does it work?

We use abstracts found on PubMed and match them to JoVE videos to create a list of 10 to 30 related methods videos.

Video X seems to be unrelated to Abstract Y...

In developing our video relationships, we compare around 5 million PubMed articles to our library of over 4,500 methods videos. In some cases the language used in the PubMed abstracts makes matching that content to a JoVE video difficult. In other cases, there happens not to be any content in our video library that is relevant to the topic of a given abstract. In these cases, our algorithms are trying their best to display videos with relevant content, which can sometimes result in matched videos with only a slight relation.