JoVE Visualize What is visualize?
Stop Reading. Start Watching.
Advanced Search
Stop Reading. Start Watching.
Regular Search
Find video protocols related to scientific articles indexed in Pubmed.
A new mouse allele of glutamate receptor delta 2 with cerebellar atrophy and progressive ataxia.
PLoS ONE
PUBLISHED: 01-01-2014
Show Abstract
Hide Abstract
Spinocerebellar degenerations (SCDs) are a large class of sporadic or hereditary neurodegenerative disorders characterized by progressive motion defects and degenerative changes in the cerebellum and other parts of the CNS. Here we report the identification and establishment from a C57BL/6J mouse colony of a novel mouse line developing spontaneous progressive ataxia, which we refer to as ts3. Frequency of the phenotypic expression was consistent with an autosomal recessive Mendelian trait of inheritance, suggesting that a single gene mutation is responsible for the ataxic phenotype of this line. The onset of ataxia was observed at about three weeks of age, which slowly progressed until the hind limbs became entirely paralyzed in many cases. Micro-MRI study revealed significant cerebellar atrophy in all the ataxic mice, although individual variations were observed. Detailed histological analyses demonstrated significant atrophy of the anterior folia with reduced granule cells (GC) and abnormal morphology of cerebellar Purkinje cells (PC). Study by ultra-high voltage electron microscopy (UHVEM) further indicated aberrant morphology of PC dendrites and their spines, suggesting both morphological and functional abnormalities of the PC in the mutants. Immunohistochemical studies also revealed defects in parallel fiber (PF)-PC synapse formation and abnormal distal extension of climbing fibers (CF). Based on the phenotypic similarities of the ts3 mutant with other known ataxic mutants, we performed immunohistological analyses and found that expression levels of two genes and their products, glutamate receptor delta2 (grid2) and its ligand, cerebellin1 (Cbln1), are significantly reduced or undetectable. Finally, we sequenced the candidate genes and detected a large deletion in the coding region of the grid2 gene. Our present study suggests that ts3 is a new allele of the grid2 gene, which causes similar but different phenotypes as compared to other grid2 mutants.
Related JoVE Video
Zygosity determination in hairless mice by PCR based on Hr(hr) gene analysis.
Exp. Anim.
PUBLISHED: 08-02-2013
Show Abstract
Hide Abstract
We analyzed the Hr gene of a hairless mouse strain of unknown origin (HR strain, http://animal.nibio.go.jp/e_hr.html) to determine whether the strain shares a mutation with other hairless strains, such as HRS/J and Skh:HR-1, both of which have an Hr(hr) allele. Using PCR with multiple pairs of primers designed to amplify multiple overlapping regions covering the entire Hr gene, we found an insertion mutation in intron 6 of mutant Hr genes in HR mice. The DNA sequence flanking the mutation indicated that the mutation in HR mice was the same as that of Hr(hr) in the HRS/J strain. Based on the sequence, we developed a genotyping method using PCR to determine zygosities. Three primers were designed: S776 (GGTCTCGCTGGTCCTTGA), S607 (TCTGGAACCAGAGTGACAGACAGCTA), and R850 (TGGGCCACCATGGCCAGATTTAACACA). The S776 and R850 primers detected the Hr(hr) allele (275-bp amplicon), and S607 and R850 identified the wild-type Hr allele (244-bp amplicon). Applying PCR using these three primers, we confirmed that it is possible to differentiate among homozygous Hr(hr) (longer amplicons only), homozygous wild-type Hr(shorter amplicons only), and heterozygous (both amplicons) in HR and Hos:HR-1 mice. Our genomic analysis indicated that the HR, HRS/J, and Hos:HR-1 strains, and possibly Skh:HR-1 (an ancestor of Hos:HR-1) strain share the same Hr(hr) gene mutation. Our genotyping method will facilitate further research using hairless mice, and especially immature mice, because pups can be genotyped before their phenotype (hair coat loss) appears at about 2 weeks of age.
Related JoVE Video
Adult onset cardiac dilatation in a transgenic mouse line with Gal?1,3GalNAc ?2,3-sialyltransferase II (ST3Gal-II) transgenes: a new model for dilated cardiomyopathy.
Proc. Jpn. Acad., Ser. B, Phys. Biol. Sci.
PUBLISHED: 10-12-2011
Show Abstract
Hide Abstract
Sugar chain abnormalities in glycolipids and glycoproteins are associated with various diseases. Here, we report an adult onset cardiac dilatation in a transgenic mouse line with Gal?1,3GalNAc ?2,3-sialyltransferase II (ST3Gal-II) transgenes. The transgenic hearts at the end-stage, at around 7 months old, were enlarged, with enlarged cavities and thin, low-tensile walls, typical of dilated cardiomyopathy. Although no apparent change was found in heart gangliosides, glycosylation of heart proteins was altered. Interestingly, sugar moieties not directly related to the ST3Gal-II catalytic reaction were also changed. Significant increases in calreticulin and calnexin were observed in hearts of the transgenic mice. These results suggest that expression of ST3Gal-II transgenes induces abnormal protein glycosylation, which disorganizes the endoplasmic/sarcoplasmic reticulum quality control system and elevates the calreticulin/calnexin level, resulting in suppression of cardiac function. The transgenic mice showed 100% incidence of adult onset cardiac dilatation, suggesting great potential as a new model for dilated cardiomyopathy.
Related JoVE Video
Use of sample mixtures for standard curve creation in quantitative western blots.
Exp. Anim.
PUBLISHED: 04-23-2011
Show Abstract
Hide Abstract
For accurate protein quantification when using quantitative western blot analysis with chemiluminescence reagents, standard curves are needed because of the narrow quantifiable ranges. However, they are often difficult to obtain because authentic proteins are not always available. Here we present our original and convenient method using a sample mixture as a scale to create standard curves. This method allowed us to determine the quantifiable range of target and loading control proteins, making quantitative comparisons among independent blots more reproducible. Our results indicate that using a sample mixture to create standard curves is a practical method that guarantees the accuracy and reproducibility of quantitative western blot analysis.
Related JoVE Video
Involvement of SIK3 in glucose and lipid homeostasis in mice.
PLoS ONE
Show Abstract
Hide Abstract
Salt-inducible kinase 3 (SIK3), an AMP-activated protein kinase-related kinase, is induced in the murine liver after the consumption of a diet rich in fat, sucrose, and cholesterol. To examine whether SIK3 can modulate glucose and lipid metabolism in the liver, we analyzed phenotypes of SIK3-deficent mice. Sik3(-/-) mice have a malnourished the phenotype (i.e., lipodystrophy, hypolipidemia, hypoglycemia, and hyper-insulin sensitivity) accompanied by cholestasis and cholelithiasis. The hypoglycemic and hyper-insulin-sensitive phenotypes may be due to reduced energy storage, which is represented by the low expression levels of mRNA for components of the fatty acid synthesis pathways in the liver. The biliary disorders in Sik3(-/-) mice are associated with the dysregulation of gene expression programs that respond to nutritional stresses and are probably regulated by nuclear receptors. Retinoic acid plays a role in cholesterol and bile acid homeostasis, wheras ALDH1a which produces retinoic acid, is expressed at low levels in Sik3(-/-) mice. Lipid metabolism disorders in Sik3(-/-) mice are ameliorated by the treatment with 9-cis-retinoic acid. In conclusion, SIK3 is a novel energy regulator that modulates cholesterol and bile acid metabolism by coupling with retinoid metabolism, and may alter the size of energy storage in mice.
Related JoVE Video

What is Visualize?

JoVE Visualize is a tool created to match the last 5 years of PubMed publications to methods in JoVE's video library.

How does it work?

We use abstracts found on PubMed and match them to JoVE videos to create a list of 10 to 30 related methods videos.

Video X seems to be unrelated to Abstract Y...

In developing our video relationships, we compare around 5 million PubMed articles to our library of over 4,500 methods videos. In some cases the language used in the PubMed abstracts makes matching that content to a JoVE video difficult. In other cases, there happens not to be any content in our video library that is relevant to the topic of a given abstract. In these cases, our algorithms are trying their best to display videos with relevant content, which can sometimes result in matched videos with only a slight relation.