JoVE Visualize What is visualize?
Stop Reading. Start Watching.
Advanced Search
Stop Reading. Start Watching.
Regular Search
Find video protocols related to scientific articles indexed in Pubmed.
Production of Water-Soluble Few-Layer Graphene Mesosheets by Dry Milling with Hydrophobic Drug.
Langmuir
PUBLISHED: 11-20-2014
Show Abstract
Hide Abstract
A novel, fast and easy mechano-chemistry-based (dry milling) method has been developed to exfoliate graphene with hydrophobic drugs generating few layer graphene mesosheets (< 10 nm in thickness and ~ 1 µm in width). The electronic properties of the graphitic structure were partially preserved after the milling treatment compared to Graphene Oxide (GO) prepared by Hummers' method. Several characterization techniques such as thermogravimetric analysis (TGA), Raman spectroscopy, atomic force microscopy (AFM), Electron Microscopy (EM) and molecular dynamics simulation were used to characterize this material. The drug-exfoliated mesosheets were pharmacologically inactive offering a new approach for making water-soluble few-layer graphene mesosheets upon dry milling with hydrophobic drugs, mainly used as exfoliating agents.
Related JoVE Video
Structural insights into binding of small molecule inhibitors to Enhancer of Zeste Homolog 2.
J. Comput. Aided Mol. Des.
PUBLISHED: 08-20-2014
Show Abstract
Hide Abstract
Enhancer of Zeste Homolog 2 (EZH2) is a SET domain protein lysine methyltransferase (PKMT) which has recently emerged as a chemically tractable and therapeutically promising epigenetic target, evidenced by the discovery and characterization of potent and highly selective EZH2 inhibitors. However, no experimental structures of the inhibitors co-crystallized to EZH2 have been resolved, and the structural basis for their activity and selectivity remains unknown. Considering the need to minimize cross-reactivity between prospective PKMT inhibitors, much can be learned from understanding the molecular basis for selective inhibition of EZH2. Thus, to elucidate the binding of small-molecule inhibitors to EZH2, we have developed a model of its fully-formed cofactor binding site and used it to carry out molecular dynamics simulations of protein-ligand complexes, followed by molecular mechanics/generalized born surface area calculations. The obtained results are in good agreement with biochemical inhibition data and reflect the structure-activity relationships of known ligands. Our findings suggest that the variable and flexible post-SET domain plays an important role in inhibitor binding, allowing possibly distinct binding modes of inhibitors with only small variations in their structure. Insights from this study present a good basis for design of novel and optimization of existing compounds targeting the cofactor binding site of EZH2.
Related JoVE Video
Bioadhesive tablets containing cyclodextrin complex of itraconazole for the treatment of vaginal candidiasis.
Int. J. Biol. Macromol.
PUBLISHED: 03-30-2014
Show Abstract
Hide Abstract
Itraconazole (ITR) is commonly used in the treatment of Candida infections. It has a nephrotoxic effect and low bioavailability in patients who suffer from renal insufficiency, and its poor solubility in water makes ITR largely unavailable. Cyclodextrins (CyDs) are used to form inclusion complexes with drugs to improve their aqueous solubility and to reduce their side effects. In this study, ITR was complexed with ?-cyclodextrin (?-CyD), hydroxypropyl-?-cyclodextrin (HP-?-CyD), methyl-?-cyclodextrin (Met-?-CyD) and sulphobutyl ether-?-cyclodextrin (SBE7-?-CyD) to increase its water solubility and to reduce the side effects of the drug without decreasing antifungal activity. Complex formation between ITR and CyDs was evaluated using SEM, (1)H NMR and XRD studies. The antifungal activity of the complexes was analyzed on Candida albicans strains, and the susceptibility of the strains was found to be higher for the ITR-SBE7-?-CyD complex than for the complexes that were prepared with other CyDs. Vaginal bioadhesive sustained release tablet formulations were developed using the ITR-SBE7-?-CyD inclusion complex to increase the residence time of ITR in the vagina, thereby boosting the efficacy of the treatment. The swelling, matrix erosion and bioadhesion properties of formulations and the drug release rate of these tablets were analyzed, and the most therapeutically effective vaginal formulation was determined.
Related JoVE Video
Rapid detection of sildenafil analogue in Eurycoma longifolia products using a new two-tier procedure of the near infrared (NIR) spectra database.
Food Chem
PUBLISHED: 02-23-2014
Show Abstract
Hide Abstract
A simple and cost-effective two-tier drug screening procedure comprises a 'dedicated' NIR spectral database of common medicines and a 'unified' database was developed to detect the sildenafil analogue in Eurycoma longifolia products. Diffuse reflectance spectra of ten commercial herbal products containing E. longifolia were obtained over the wavelength range of 1100-2500 nm. The spectral search of two products purchased via the internet against a dedicated database of reputable E. longifolia products have resulted in the similarity index of more than 0.1 which indicated significantly different spectra. Further searches against the unified database showed a close match to the spectra of drug containing sildenafil citrate suggesting the presence of a sildenafil analogue. This finding was supported by clustering of these spectra in the PCA score plot within 5% significance level. This approach has alleviated the use of reference product or standard active for direct comparison and has a potential to be used for adulterated food and drugs detection.
Related JoVE Video
A phytochemical comparison of saw palmetto products using gas chromatography and (1) H nuclear magnetic resonance spectroscopy metabolomic profiling.
J. Pharm. Pharmacol.
PUBLISHED: 01-13-2014
Show Abstract
Hide Abstract
Preparations containing saw palmetto berries are used in the treatment of benign prostatic hyperplasia (BPH). There are many products on the market, and relatively little is known about their chemical variability and specifically the composition and quality of different saw palmetto products notwithstanding that in 2000, an international consultation paper from the major urological associations from the five continents on treatments for BPH demanded further research on this topic. Here, we compare two analytical approaches and characterise 57 different saw palmetto products.
Related JoVE Video
Crystal Structure of a Promoter Sequence in the B-raf Gene Reveals an Intertwined Dimer Quadruplex.
J. Am. Chem. Soc.
PUBLISHED: 12-11-2013
Show Abstract
Hide Abstract
The sequence d(GGGCGGGGAGGGGGAAGGGA) occurs in the promoter region of the B-raf gene. An X-ray crystallographic study has found that this forms an unprecedented dimeric quadruplex arrangement, with a core of seven consecutive G-quartets and an uninterrupted run of six potassium ions in the central channel of the quadruplex. Analogy with previously reported promoter quadruplexes had initially suggested that in common with these a monomeric quadruplex was to be expected. The structure has a distorted G·C·G·C base quartet at one end and four flipped-out adenosine nucleosides at the other. The only loops in the structure are formed by the cytosine and by the three adenosines within the sequence, with all of the guanosines participating in G-quartet formation. Solution UV and circular dichroism data are in accord with a stable quadruple arrangement being formed. 1D NMR data, together with gel electrophoresis measurements, are consistent with a dimer being the dominant species in potassium solution. A single-chain intramolecular quadruplex has been straightforwardly constructed using molecular modeling, by means of a six-nucleotide sequence joining 3 and 5 ends of each strand in the dimer. A human genomic database search has revealed a number of sequences containing eight or more consecutive short G-tracts, suggesting that such intramolecular quadruplexes could be formed within the human genome.
Related JoVE Video
Molecular dynamic simulations of ocular tablet dissolution.
J Chem Inf Model
PUBLISHED: 10-21-2013
Show Abstract
Hide Abstract
Small tablets for implantation into the subconjunctival space in the eye are being developed to inhibit scarring after glaucoma filtration surgery (GFS). There is a need to evaluate drug dissolution at the molecular level to determine how the chemical structure of the active may correlate with dissolution in the nonsink conditions of the conjunctival space. We conducted molecular dynamics simulations to study the dissolution process of tablets derived from two drugs that can inhibit fibrosis after GFS, 5-fluorouracil (5-FU) and the matrix metalloprotease inhibitor (MMPi), ilomastat. The dissolution was simulated in the presence of simple point charge (SPC) water molecules, and the liquid turnover of the aqueous humor in the subconjunctival space was simulated by removal of the dissolved drug molecules at regular intervals and replacement by new water molecules. At the end of the simulation, the total molecular solvent accessible surface area of 5-FU tablets increased by 60 times more than that of ilomastat as a result of tablet swelling and release of molecules into solution. The tablet dissolution pattern shown in our molecular dynamic simulations tends to correlate with experimental release profiles. This work indicates that a series of molecular dynamic simulations can be used to predict the influence of the molecular properties of a drug on its dissolution profile and could be useful during preformulation where sufficient amounts of the drug are not always available to perform dissolution studies.
Related JoVE Video
Potential of lichen secondary metabolites against Plasmodium liver stage parasites with FAS-II as the potential target.
J. Nat. Prod.
PUBLISHED: 06-19-2013
Show Abstract
Hide Abstract
Chemicals targeting the liver stage (LS) of the malaria parasite are useful for causal prophylaxis of malaria. In this study, four lichen metabolites, evernic acid (1), vulpic acid (2), psoromic acid (3), and (+)-usnic acid (4), were evaluated against LS parasites of Plasmodium berghei. Inhibition of P. falciparum blood stage (BS) parasites was also assessed to determine stage specificity. Compound 4 displayed the highest LS activity and stage specificity (LS IC50 value 2.3 ?M, BS IC50 value 47.3 ?M). The compounds 1-3 inhibited one or more enzymes (PfFabI, PfFabG, and PfFabZ) from the plasmodial fatty acid biosynthesis (FAS-II) pathway, a potential drug target for LS activity. To determine species specificity and to clarify the mechanism of reported antibacterial effects, 1-4 were also evaluated against FabI homologues and whole cells of various pathogens (S. aureus, E. coli, M. tuberculosis). Molecular modeling studies suggest that lichen acids act indirectly via binding to allosteric sites on the protein surface of the FAS-II enzymes. Potential toxicity of compounds was assessed in human hepatocyte and cancer cells (in vitro) as well as in a zebrafish model (in vivo). This study indicates the therapeutic and prophylactic potential of lichen metabolites as antibacterial and antiplasmodial agents.
Related JoVE Video
Investigation of the protein alkylation sites of the STAT3:STAT3 inhibitor Stattic by mass spectrometry.
Bioorg. Med. Chem. Lett.
PUBLISHED: 03-26-2013
Show Abstract
Hide Abstract
STAT3 (Signal Transducer and Activator of Transcription factor 3) is constitutively active in a wide range of human tumours. Stattic is one of the first non-peptidic small molecules reported to inhibit formation of the STAT3:STAT3 protein dimer complex. A mass spectrometry method has been developed to investigate the binding of Stattic to the un-phosphorylated STAT3?tc (U-STAT3) protein. Alkylation of four cysteine residues has been observed with possible reaction at a fifth which could account for the mechanism of action.
Related JoVE Video
Cationic poly-L-lysine dendrimer complexes doxorubicin and delays tumor growth in vitro and in vivo.
ACS Nano
PUBLISHED: 03-07-2013
Show Abstract
Hide Abstract
We report in this study the complexation of the chemotherapeutic drug doxorubicin (DOX) with the novel sixth-generation cationic poly-l-lysine dendrimer (DM) (MW 8149 kDa), which we previously reported to exhibit systemic antiangiogenic activity in tumor-bearing mice. DOX-DM complexation was confirmed by florescence polarization measurement, proton nuclear magnetic resonance spectroscopy, and molecular modeling. Enhanced penetration of DOX-DM (at 1:10 molar ratio), compared to the free DOX, into prostate 3D multicellular tumor spheroids (MTS) was confirmed by confocal laser scanning microscopy. Furthermore, DOX-DM complexes achieved a significantly higher cytotoxicity in DU145 MTS system compared to the free drug, as shown by growth delay curves. Incubation of MTS with low DOX concentration (1 ?M) complexed with DM led to a significant delay in MTS growth compared to untreated MTS or MTS treated with free DOX. DOX-DM complex retention was also achieved in a Calu-6 lung cancer xenograft model in tumor-bearing mice, as shown by live whole animal fluorescence imaging. Therapeutic experiments in B16F10 tumor bearing mice have shown enhanced therapeutic efficacy of DOX when complexed to DM. This study suggests that the cationic poly-l-lysine DM molecules studied here could, in addition to their systemic antiangiogenic property, complex chemotherapeutic drugs such as DOX and improve their accumulation and cytotoxicity into MTS and solid tumors in vivo. Such an approach offers new capabilities for the design of combinatory antiangiogenic/anticancer therapeutics.
Related JoVE Video
Antibacterial acylphloroglucinols from Hypericum olympicum.
J. Nat. Prod.
PUBLISHED: 09-07-2011
Show Abstract
Hide Abstract
New antibacterial acylphloroglucinols (1-5) were isolated and characterized from the aerial parts of the plant Hypericum olympicum L. cf. uniflorum. The structures of these compounds were confirmed by extensive 1D- and 2D-NMR experiments to be 4,6-dihydroxy-2-O-(3?,7?-dimethyl-2?,6?-octadienyl)-1-(2-methylbutanoyl)benzene (1), 4,6-dihydroxy-2-O-(7?-hydroxy-3?,7?-dimethyl-2?,5?-octadienyl)-1-(2-methylbutanoyl)benzene (2), 4,6-dihydroxy-2-O-(6?-hydroxy-3?,7?-dimethyl-2?,7?-octadienyl)-1-(2-methylbutanoyl)benzene (3), 4,6-dihydroxy-2-O-(6?-hydroperoxy-3?,7?-dimethyl-2?,7?-octadienyl)-1-(2-methylbutanoyl)benzene (4), and 4,6-dihydroxy-2-O-(6?,7?-epoxy-3?,7?-dimethyloct-2?-enyl)-1-(2-methylbutanoyl)benzene (5). These new natural products have been given the trivial names olympicins A-E (1-5). All compounds were evaluated against a panel of methicillin-resistant Staph. aureus and multidrug-resistant strains of Staph. aureus. Compound 1 exhibited minimum inhibitory concentrations (MICs) of 0.5-1 mg/L against the tested Staph. aureus strains. Compounds 2 to 5 were also shown to be active, with MICs ranging from 64 to 128 mg/L. Compound 1 was synthesized using a simple four-step method that can be readily utilized to give a number of structural analogues of 1.
Related JoVE Video
Computational design principles for bioactive dendrimer based constructs as antagonists of the TLR4-MD-2-LPS complex.
Biomaterials
PUBLISHED: 07-19-2011
Show Abstract
Hide Abstract
The cell surface interaction between bacterial lipopolysaccharide (LPS), Toll-like receptor 4 (TLR4) and MD-2 is central to bacterial sepsis syndromes and wound healing. We have shown that a generation (G) 3.5 polyamidoamine (PAMAM) dendrimer that was partially glycosylated with glucosamine inhibits TLR4-MD-2-LPS induced inflammation in a rabbit model of tissue scaring. However, it was a mixture of closely related chemical species because of the polydispersity of the starting PAMAM dendrimer. Generation 2 triazine dendrimers with single chemical entity material status are available at low cost and at the kilogram scale. PAMAM dendrimer can be synthetically grafted onto this triazine core dendrimer to make new triazine-PAMAM hybrid dendrimers. This led us to examine whether molecular modelling methods could be used to identify the key structural design principles for a bioactive lead molecule that could be synthesized and biologically evaluated. We describe our computer aided molecular studies of several dendrimer based constructs and the key design principles identified. Our approach should be more broadly applicable to the biologically focused, rational and accelerated design of molecules for other TLR receptors. They could be useful for treating infectious, inflammatory and malignant diseases.
Related JoVE Video
Partially glycosylated dendrimers block MD-2 and prevent TLR4-MD-2-LPS complex mediated cytokine responses.
PLoS Comput. Biol.
PUBLISHED: 05-04-2011
Show Abstract
Hide Abstract
The crystal structure of the TLR4-MD-2-LPS complex responsible for triggering powerful pro-inflammatory cytokine responses has recently become available. Central to cell surface complex formation is binding of lipopolysaccharide (LPS) to soluble MD-2. We have previously shown, in biologically based experiments, that a generation 3.5 PAMAM dendrimer with 64 peripheral carboxylic acid groups acts as an antagonist of pro-inflammatory cytokine production after surface modification with 8 glucosamine molecules. We have also shown using molecular modelling approaches that this partially glycosylated dendrimer has the flexibility, cluster density, surface electrostatic charge, and hydrophilicity to make it a therapeutically useful antagonist of complex formation. These studies enabled the computational study of the interactions of the unmodified dendrimer, glucosamine, and of the partially glycosylated dendrimer with TLR4 and MD-2 using molecular docking and molecular dynamics techniques. They demonstrate that dendrimer glucosamine forms co-operative electrostatic interactions with residues lining the entrance to MD-2s hydrophobic pocket. Crucially, dendrimer glucosamine interferes with the electrostatic binding of: (i) the 4phosphate on the di-glucosamine of LPS to Ser118 on MD-2; (ii) LPS to Lys91 on MD-2; (iii) the subsequent binding of TLR4 to Tyr102 on MD-2. This is followed by additional co-operative interactions between several of the dendrimer glucosamines carboxylic acid branches and MD-2. Collectively, these interactions block the entry of the lipid chains of LPS into MD-2s hydrophobic pocket, and also prevent TLR4-MD-2-LPS complex formation. Our studies have therefore defined the first nonlipid-based synthetic MD-2 antagonist using both animal model-based studies of pro-inflammatory cytokine responses and molecular modelling studies of a whole dendrimer with its target protein. Using this approach, it should now be possible to computationally design additional macromolecular dendrimer based antagonists for other Toll Like Receptors. They could be useful for treating a spectrum of infectious, inflammatory and malignant diseases.
Related JoVE Video
Near-infrared spectroscopy (NIRS) and chemometric analysis of Malaysian and UK paracetamol tablets: a spectral database study.
Int J Pharm
PUBLISHED: 03-01-2011
Show Abstract
Hide Abstract
The influx of medicines from different sources into healthcare systems of developing countries presents a challenge to monitor their origin and quality. The absence of a repository of reference samples or spectra prevents the analysis of tablets by direct comparison. A set of paracetamol tablets purchased in Malaysian pharmacies were compared to a similar set of sample purchased in the UK using near-infrared spectroscopy (NIRS). Additional samples of products containing ibuprofen or paracetamol in combination with other actives were added to the study as negative controls. NIR spectra of the samples were acquired and compared by using multivariate modeling and classification algorithms (PCA/SIMCA) and stored in a spectral database. All analysed paracetamol samples contained the purported active ingredient with only 1 out of 20 batches excluded from the 95% confidence interval, while the negative controls were clearly classified as outliers of the set. Although the substandard products were not detected in the purchased sample set, our results indicated variability in the quality of the Malaysian tablets. A database of spectra was created and search methods were evaluated for correct identification of tablets. The approach presented here can be further developed as a method for identifying substandard pharmaceutical products.
Related JoVE Video
Relative quantification of polyethylene glycol 400 excreted in the urine of male and female volunteers by direct injection electrospray-selected ion monitoring mass spectrometry.
Int J Pharm
PUBLISHED: 02-18-2011
Show Abstract
Hide Abstract
The use of polyethylene glycol 400 (PEG 400) as an excipient in oral formulations can have profound and differing effects on drug bioavailability in men and women; therefore an understanding of the pharmacokinetics of this excipient is required. A direct injection electrospray selected ion monitoring mass spectrometry methodology was developed and validated for the quantitation of PEG 400 excreted in human urine after oral administration. The most abundant ions corresponding to PEG 400 oligomers at m/z 365, 409, 453, 497, 541, and 585 were used for selected ion monitoring (SIM). Pre-dose urine of volunteers was spiked with various amounts of PEG 400 to generate calibration curves over the concentration range 2.5-90 ?g/mL for all SIM channels. The relative standard deviations of intra- and inter-day analysis of PEG 400 in human urine were lower than 11.8% and bias percentage was less than 9.7%. This specific method for relative quantitation of PEG 400 was then used to analyse urine samples with minimal sample preparation. Urine samples of twelve healthy volunteers (six men and six women) who received 0.75 g and 1.5 g PEG 400 on two separate occasions were collected over 24h. On average 36.5% of the orally administered dose of PEG 400 was recovered in the urine of the volunteers, with no significant difference observed between men and women.
Related JoVE Video
In silico screening for antibiotic escort molecules to overcome efflux.
J Mol Model
PUBLISHED: 01-17-2011
Show Abstract
Hide Abstract
Resistance to antibiotics is a growing problem worldwide and occurs in part due to the overexpression of efflux pumps responsible for the removal of antibiotics from bacterial cells. The current study examines complex formation between efflux pump substrates and escort molecules as a criterion for an in silico screening method for molecules that are able to potentiate antibiotic activities. Initially, the SUPERDRUG database was queried to select molecules that were similar to known multidrug resistance (MDR) modulators. Molecular interaction fields generated by GRID and the docking module GLUE were used to calculate the interaction energies between the selected molecules and the antibiotic norfloxacin. Ten compounds forming the most stable complexes with favourable changes to the norfloxacin molecular properties were tested for their potentiation ability by efflux pump modulation assays. Encouragingly, two molecules were proven to act as efflux pump modulators, and hence provide evidence that complex formation between a substrate and a drug can be used for in silico screening for novel escort molecules.
Related JoVE Video
From sequence to 3D structure of hyperbranched molecules: application to surface modified PAMAM dendrimers.
J Mol Model
PUBLISHED: 01-07-2011
Show Abstract
Hide Abstract
The molecular modeling of hyperbranched molecules is currently constrained by difficulties in model building, due partly to lack of parameterization of their building blocks. We have addressed this problem with specific relevance to a class of hyperbranched macromolecules known as dendrimers by describing a new concept and developing a method that translates monomeric linear sequences into a full atomistic model of a hyperbranched molecule. Such molecular-modeling-based advances will enable modeling studies of important biological interactions between naturally occurring macromolecules and synthetic macromolecules. Our results also suggest that it should be possible to apply this sequence-based methodology to generate hyperbranched structures of other dendrimeric structures and of linear polymers.
Related JoVE Video
Structural studies of biologically active glycosylated polyamidoamine (PAMAM) dendrimers.
J Mol Model
PUBLISHED: 09-15-2010
Show Abstract
Hide Abstract
The partial modification of carboxylic acid terminated polyamidoamine (PAMAM) dendrimers with glucosamine has been reported to give dendrimer glucosamine conjugates novel immuno-modulatory and anti-angiogenic properties. Experimental analysis of these glycosylated dendrimers showed that, on average, eight glucosamine molecules were covalently bound to each dendrimer. In order to better understand the surface loading and distribution of these glucosamine molecules, molecular reactivity was determined by evaluation of electronic properties using frontier molecular orbital theory (FMOT) and molecular dynamics simulations. It was shown that the surface loading and distribution of zero length amide bond-conjugated glucosamine molecules was determined by both electronic effects and by the different dynamic conformations adopted by the modified dendrimer during the incremental addition of glucosamine. Importantly, the structural features and the dynamic behavior of the partially glycosylated generation 3.5 PAMAM dendrimer showed that its flexibility and polarity changed with the incremental addition of glucosamine. These peripheral glucosamine molecules remained available on the dendrimers surface for interaction with the biological target.
Related JoVE Video
Targeting glycolysis: a fragment based approach towards bifunctional inhibitors of hLDH-5.
Chem. Commun. (Camb.)
PUBLISHED: 07-30-2010
Show Abstract
Hide Abstract
hLDH-5 has emerged as a promising target for anti-glycolytic cancer chemotherapy. Here we report a first generation of bifunctional inhibitors, which show promising activity against hLDH-5.
Related JoVE Video
2-Hexadecynoic acid inhibits plasmodial FAS-II enzymes and arrests erythrocytic and liver stage Plasmodium infections.
Bioorg. Med. Chem.
PUBLISHED: 06-02-2010
Show Abstract
Hide Abstract
Acetylenic fatty acids are known to display several biological activities, but their antimalarial activity has remained unexplored. In this study, we synthesized the 2-, 5-, 6-, and 9-hexadecynoic acids (HDAs) and evaluated their in vitro activity against erythrocytic (blood) stages of Plasmodium falciparum and liver stages of Plasmodium yoelii infections. Since the type II fatty acid biosynthesis pathway (PfFAS-II) has recently been shown to be indispensable for liver stage malaria parasites, the inhibitory potential of the HDAs against multiple P. falciparum FAS-II (PfFAS-II) elongation enzymes was also evaluated. The highest antiplasmodial activity against blood stages of P. falciparum was displayed by 5-HDA (IC(50) value 6.6 ?g/ml), whereas the 2-HDA was the only acid arresting the growth of liver stage P. yoelii infection, in both flow cytometric assay (IC(50) value 2-HDA 15.3 ?g/ml, control drug atovaquone 2.5 ng/ml) and immunofluorescence analysis (IC(50) 2-HDA 4.88 ?g/ml, control drug atovaquone 0.37 ng/ml). 2-HDA showed the best inhibitory activity against the PfFAS-II enzymes PfFabI and PfFabZ with IC(50) values of 0.38 and 0.58 ?g/ml (IC(50) control drugs 14 and 30 ng/ml), respectively. Enzyme kinetics and molecular modeling studies revealed valuable insights into the binding mechanism of 2-HDA on the target enzymes. All HDAs showed in vitro activity against Trypanosoma brucei rhodesiense (IC(50) values 3.7-31.7 ?g/ml), Trypanosoma cruzi (only 2-HDA, IC(50) 20.2 ?g/ml), and Leishmania donovani (IC(50) values 4.1-13.4 ?g/ml) with generally low or no significant toxicity on mammalian cells. This is the first study to indicate therapeutic potential of HDAs against various parasitic protozoa. It also points out that the malarial liver stage growth inhibitory effect of the 2-HDA may be promoted via PfFAS-II enzymes. The lack of cytotoxicity, lipophilic nature, and calculated pharmacokinetic properties suggests that 2-HDA could be a useful compound to study the interaction of fatty acids with these key P. falciparum enzymes.
Related JoVE Video
An analysis of the legal high mephedrone.
Bioorg. Med. Chem. Lett.
PUBLISHED: 04-08-2010
Show Abstract
Hide Abstract
Legal highs are compounds, plant or fungal material which can be readily bought from the internet without legal restriction and the single chemicals may be structurally related to illegal drugs of abuse such as the amphetamines. Several recent deaths in the UK have been attributed to these legal highs and unfortunately there is little chemical or biological literature on these materials or certified standards. Here, we detail the analysis of the widely consumed synthetic N-methyl-cathinone analogue known as mephedrone ((1) 2-aminomethyl-1-tolyl-propan-1-one (4-methylmethcathinone)) and report its spectral data and molecular properties. Material was purchased from an internet site and examined by extensive one- and two-dimensional NMR studies, high-resolution mass spectrometry, elemental analysis and optical rotation, which demonstrated the sample to be of high purity and racemic in nature. Additionally, we report the molecular modelling properties of methyl-cathinones and compare them to their corresponding methyl-amphetamine series. This indicated that the methyl-cathinones are considerably more hydrophilic than the methyl-amphetamines which may account for the higher doses that are needed to demonstrate similar effects. The presence of a ketone in the side chain introduces a far more planar quality to the methyl-cathinones which is absent in the methyl-amphetamine series, and this planarity may contribute to toxicity.
Related JoVE Video
Structure-activity relationships of monomeric C2-aryl pyrrolo[2,1-c][1,4]benzodiazepine (PBD) antitumor agents.
J. Med. Chem.
PUBLISHED: 03-12-2010
Show Abstract
Hide Abstract
A comprehensive SAR investigation of the C2-position of pyrrolo[2,1-c][1,4]benzodiazepine (PBD) monomer antitumor agents is reported, establishing the molecular requirements for optimal in vitro cytotoxicity and DNA-binding affinity. Both carbocyclic and heterocyclic C2-aryl substituents have been studied ranging from single aryl rings to fused ring systems, and also styryl substituents, establishing across a library of 80 analogues that C2-aryl and styryl substituents significantly enhance both DNA-binding affinity and in vitro cytotoxicity, with a correlation between the two. The optimal C2-grouping for both DNA-binding affinity and cytotoxicity was found to be the C2-quinolinyl moiety which, according to molecular modeling, is due to the overall fit of the molecule in the DNA minor groove, and potential specific contacts with functional groups in the floor and walls of the groove. This analogue (14l) was shown to delay tumor growth in a HCT-116 (bowel) human tumor xenograft model.
Related JoVE Video
Purification, characterisation and identification of acidocin LCHV, an antimicrobial peptide produced by Lactobacillus acidophilus n.v. Er 317/402 strain Narine.
Int. J. Antimicrob. Agents
PUBLISHED: 01-05-2010
Show Abstract
Hide Abstract
In the last two decades, antimicrobial peptides (AMPs) have been gaining attention as antimicrobial alternatives to chemical food preservatives and commonly used antibiotics. Lactobacillus acidophilus n.v. Er 317/402 strain Narine produces a small AMP with a molecular weight of 1.1kDa, designated acidocin LCHV. In this study, the AMP was extremely heat stable (90min at 130 degrees C), was active over a wide pH range and was found to be sensitive to proteolytic enzymes (trypsin, pepsin and proteinase K). Acidocin LCHV has a broad spectrum of activity both against Gram-positive and Gram-negative pathogens, including several that are classified as Especially Dangerous Infections by the World Health Organization as well as meticillin-resistant Staphylococcus aureus (MRSA) and Clostridium difficile. Matrix-assisted laser desorption/ionisation time-of-flight mass spectrometry (MALDI-TOF/MS) was used to determine the molecular mass and sequence of the purified peptide. Complete killing with immediate impact on cells was observed within a very short period of time (10min).
Related JoVE Video
Induction of the cytoprotective enzyme heme oxygenase-1 by statins is enhanced in vascular endothelium exposed to laminar shear stress and impaired by disturbed flow.
J. Biol. Chem.
PUBLISHED: 05-19-2009
Show Abstract
Hide Abstract
In addition to cholesterol-lowering properties, statins exhibit lipid-independent immunomodulatory, anti-inflammatory actions. However, high concentrations are typically required to induce these effects in vitro, raising questions concerning therapeutic relevance. We present evidence that endothelial cell sensitivity to statins depends upon shear stress. Using heme oxygenase-1 expression as a model, we demonstrate differential heme oxygenase-1 induction by atorvastatin in atheroresistant compared with atheroprone sites of the murine aorta. In vitro, exposure of human endothelial cells to laminar shear stress significantly reduced the statin concentration required to induce heme oxygenase-1 and protect against H(2)O(2)-mediated injury. Synergy was observed between laminar shear stress and atorvastatin, resulting in optimal expression of heme oxygenase-1 and resistance to oxidative stress, a response inhibited by heme oxygenase-1 small interfering RNA. Moreover, treatment of laminar shear stress-exposed endothelial cells resulted in a significant fall in intracellular cholesterol. Mechanistically, synergy required Akt phosphorylation, activation of Kruppel-like factor 2, NF-E2-related factor-2 (Nrf2), increased nitric-oxide synthase activity, and enhanced HO-1 mRNA stability. In contrast, heme oxygenase-1 induction by atorvastatin in endothelial cells exposed to oscillatory flow was markedly attenuated. We have identified a novel relationship between laminar shear stress and statins, demonstrating that atorvastatin-mediated heme oxygenase-1-dependent antioxidant effects are laminar shear stress-dependent, proving the principle that biomechanical signaling contributes significantly to endothelial responsiveness to pharmacological agents. Our findings suggest statin pleiotropy may be suboptimal at disturbed flow atherosusceptible sites, emphasizing the need for more specific therapeutic agents, such as those targeting Kruppel-like factor 2 or Nrf2.
Related JoVE Video
Direct metabolic fingerprinting of commercial herbal tinctures by nuclear magnetic resonance spectroscopy and mass spectrometry.
Phytochem Anal
PUBLISHED: 05-01-2009
Show Abstract
Hide Abstract
Tinctures are widely used liquid pharmaceutical preparations traditionally obtained by maceration of one or more medicinal plants in ethanol-water solutions. Such a process results in the extraction of virtually hundreds of structurally diverse compounds with different polarities. Owing to the large chemical diversity of the constituents present in the herbal tinctures, the analytical tools used for the quality control of tinctures are usually optimised only for the detection of single chemical entities or specific class of compounds.
Related JoVE Video
Disruption of D-alanyl esterification of Staphylococcus aureus cell wall teichoic acid by the {beta}-lactam resistance modifier (-)-epicatechin gallate.
J. Antimicrob. Chemother.
PUBLISHED: 03-22-2009
Show Abstract
Hide Abstract
The naturally occurring polyphenol (-)-epicatechin gallate (ECg) increases oxacillin susceptibility in mecA-containing strains of Staphylococcus aureus. Decreased susceptibility to lysostaphin suggests alterations to the wall teichoic acid (WTA) content of ECg-grown bacteria. Changes in WTA structure in response to ECg were determined.
Related JoVE Video
C9orf72 hexanucleotide repeat associated with amyotrophic lateral sclerosis and frontotemporal dementia forms RNA G-quadruplexes.
Sci Rep
Show Abstract
Hide Abstract
Large expansions of a non-coding GGGGCC-repeat in the first intron of the C9orf72 gene are a common cause of both amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). G-rich sequences have a propensity for forming highly stable quadruplex structures in both RNA and DNA termed G-quadruplexes. G-quadruplexes have been shown to be involved in a range of processes including telomere stability and RNA transcription, splicing, translation and transport. Here we show using NMR and CD spectroscopy that the C9orf72 hexanucleotide expansion can form a stable G-quadruplex, which has profound implications for disease mechanism in ALS and FTD.
Related JoVE Video
Prediction of aqueous solubility of drug-like molecules using a novel algorithm for automatic adjustment of relative importance of descriptors implemented in counter-propagation artificial neural networks.
Int J Pharm
Show Abstract
Hide Abstract
In this work, we present a novel approach for the development of models for prediction of aqueous solubility, based on the implementation of an algorithm for the automatic adjustment of descriptors relative importance (AARI) in counter-propagation artificial neural networks (CPANN). Using this approach, the interpretability of the models based on artificial neural networks, which are traditionally considered as "black box" models, was significantly improved. For the development of the model, a data set consisting of 374 diverse drug-like molecules, divided into training (n=280) and test (n=94) sets using self-organizing maps, was used. Heuristic method was applied in preselecting a small number of the most significant descriptors to serve as inputs for CPANN training. The performances of the final model based on 7 descriptors for prediction of solubility were satisfactory for both training (RMSEP(train)=0.668) and test set (RMSEP(test)=0.679). The model was found to be a highly interpretable in terms of solubility, as well as rationalizing structural features that could have an impact on the solubility of the compounds investigated. Therefore, the proposed approach can significantly enhance model usability by giving guidance for structural modifications of compounds with the aim of improving solubility in the early phase of drug discovery.
Related JoVE Video
Sequences in the HSP90 promoter form G-quadruplex structures with selectivity for disubstituted phenyl bis-oxazole derivatives.
Bioorg. Med. Chem. Lett.
Show Abstract
Hide Abstract
The HSP90 protein is an important target in cancer. We report here that stable quadruplex DNAs can be formed from a promoter sequence in the HSP90 gene, on the basis of melting, circular and NMR studies, and show that these can be selectively targeted by non-macrocyclic quadruplex-stabilizing phenyl bis-oxazole derivatives. These do not bind significantly to duplex DNA and show low stabilization of the human telomeric quadruplex. These results suggest an approach to targeting HSP90 at the DNA level.
Related JoVE Video
Preventing acute gut wall damage in infectious diarrhoeas with glycosylated dendrimers.
EMBO Mol Med
Show Abstract
Hide Abstract
Intestinal pathogens use the hosts excessive inflammatory cytokine response, designed to eliminate dangerous bacteria, to disrupt epithelial gut wall integrity and promote their tissue invasion. We sought to develop a non-antibiotic-based approach to prevent this injury. Molecular docking studies suggested that glycosylated dendrimers block the TLR4-MD-2-LPS complex, and a 13.6 kDa polyamidoamine (PAMAM) dendrimer glucosamine (DG) reduced the induction of human monocyte interleukin (IL)-6 by Gram-negative bacteria. In a rabbit model of shigellosis, PAMAM-DG prevented epithelial gut wall damage and intestinal villous destruction, reduced local IL-6 and IL-8 expression, and minimized bacterial invasion. Computational modelling studies identified a 3.3 kDa polypropyletherimine (PETIM)-DG as the smallest likely bioactive molecule. In human monocytes, high purity PETIM-DG potently inhibited Shigella Lipid A-induced IL-6 expression. In rabbits, PETIM-DG prevented Shigella-induced epithelial gut wall damage, reduced local IL-6 and IL-8 expression, and minimized bacterial invasion. There was no change in ?-defensin, IL-10, interferon-?, transforming growth factor-?, CD3 or FoxP3 expression. Small and orally delivered DG could be useful for preventing gut wall tissue damage in a wide spectrum of infectious diarrhoeal diseases.
Related JoVE Video
Target fishing and docking studies of the novel derivatives of aryl-aminopyridines with potential anticancer activity.
Bioorg. Med. Chem.
Show Abstract
Hide Abstract
A set of 16 previously synthesized aryl-aminopyridine and aryl-aminoquinoline derivatives have been evaluated for cytotoxic activity against three cancer cell lines (human cervical cancer-HeLa; human chronic myeloid leukemia-K562; human melanoma-Fem-x) and two types of normal peripheral blood mononuclear cells, with and without phytohemaglutinin (PBMC-PHA; PBMC+PHA). Twelve of the studied compounds showed moderate cytotoxicity, with selectivity against K562 but not the remaining two cancer cell lines. Four compounds were not active in cytotoxicity assays, presumably due to high predicted lipophilicity and low solubility. To rationalize the observed cytotoxic effects, structure-based virtual screening was carried out against a pool of potential targets constructed using the inverse docking program Tarfisdock and bibliographical references. The putative targets were identified on the basis of the best correlation between docking scores and in vitro cytotoxicity. It is proposed that the mechanism of action of the studied aminopyridines involves the disruption of signaling pathways and cancer cell cycle through the inhibition of cyclin-dependent kinases and several tyrosine kinases, namely Bcr-Abl kinase and KIT receptor kinase. The obtained results can guide further structural modifications of the studied compounds aimed at developing selective agents targeting proteins involved in cancer cell survival and proliferation.
Related JoVE Video
A prodrug nanoparticle approach for the oral delivery of a hydrophilic peptide, leucine(5)-enkephalin, to the brain.
Mol. Pharm.
Show Abstract
Hide Abstract
The oral use of neuropeptides to treat brain disease is currently not possible because of a combination of poor oral absorption, short plasma half-lives and the blood-brain barrier. Here we demonstrate a strategy for neuropeptide brain delivery via the (a) oral and (b) intravenous routes. The strategy is exemplified by a palmitic ester prodrug of the model drug leucine(5)-enkephalin, encapsulated within chitosan amphiphile nanoparticles. Via the oral route the nanoparticle-prodrug formulation increased the brain drug levels by 67% and significantly increased leucine(5)-enkephalins antinociceptive activity. The nanoparticles facilitate oral absorption and the prodrug prevents plasma degradation, enabling brain delivery. Via the intravenous route, the nanoparticle-prodrug increases the peptide brain levels by 50% and confers antinociceptive activity on leucine(5)-enkephalin. The nanoparticle-prodrug enables brain delivery by stabilizing the peptide in the plasma although the chitosan amphiphile particles are not transported across the blood-brain barrier per se, and are excreted in the urine.
Related JoVE Video
Site-specific PEGylation at histidine tags.
Bioconjug. Chem.
Show Abstract
Hide Abstract
The efficacy of protein-based medicines can be compromised by their rapid clearance from the blood circulatory system. Achieving optimal pharmacokinetics is a key requirement for the successful development of safe protein-based medicines. Protein PEGylation is a clinically proven strategy to increase the circulation half-life of protein-based medicines. One limitation of PEGylation is that there are few strategies that achieve site-specific conjugation of PEG to the protein. Here, we describe the covalent conjugation of PEG site-specifically to a polyhistidine tag (His-tag) on a protein. His-tag site-specific PEGylation was achieved with a domain antibody (dAb) that had a 6-histidine His-tag on the C-terminus (dAb-His(6)) and interferon ?-2a (IFN) that had an 8-histidine His-tag on the N-terminus (His(8)-IFN). The site of PEGylation at the His-tag for both dAb-His(6)-PEG and PEG-His(8)-IFN was confirmed by digestion, chromatographic, and mass-spectral studies. A methionine was also inserted directly after the N-terminal His-tag in IFN to give His(8)Met-IFN. Cyanogen bromide digestion studies of PEG-His(8)Met-IFN were also consistent with PEGylation at the His-tag. By using increased stoichiometries of the PEGylation reagent, it was possible to conjugate two separate PEG molecules to the His-tag of both the dAb and IFN proteins. Stability studies followed by in vitro evaluation confirmed that these PEGylated proteins retained their biological activity. In vivo PK studies showed that all of the His-tag PEGylated samples displayed extended circulation half-lives. Together, our results indicate that site-specific, covalent PEG conjugation at a His-tag can be achieved and biological activity maintained with therapeutically relevant proteins.
Related JoVE Video

What is Visualize?

JoVE Visualize is a tool created to match the last 5 years of PubMed publications to methods in JoVE's video library.

How does it work?

We use abstracts found on PubMed and match them to JoVE videos to create a list of 10 to 30 related methods videos.

Video X seems to be unrelated to Abstract Y...

In developing our video relationships, we compare around 5 million PubMed articles to our library of over 4,500 methods videos. In some cases the language used in the PubMed abstracts makes matching that content to a JoVE video difficult. In other cases, there happens not to be any content in our video library that is relevant to the topic of a given abstract. In these cases, our algorithms are trying their best to display videos with relevant content, which can sometimes result in matched videos with only a slight relation.