JoVE Visualize What is visualize?
Stop Reading. Start Watching.
Advanced Search
Stop Reading. Start Watching.
Regular Search
Find video protocols related to scientific articles indexed in Pubmed.
Effectiveness of Mitigation Measures in Reducing Future Primary Particulate Matter (PM) Emissions from On-Road Vehicle Exhaust.
Environ. Sci. Technol.
PUBLISHED: 11-14-2014
Show Abstract
Hide Abstract
This work evaluates the effectiveness of on-road primary particulate matter emission reductions that can be achieved by long-term vehicle scrappage and retrofit measures on regional and global levels. Scenario analysis shows that scrappage can provide significant emission reductions as soon as the measures begin, whereas retrofit provides greater emission reductions in later years, when more advanced technologies become available in most regions. Reductions are compared with a baseline that already accounts for implementation of clean vehicle standards. The greatest global emission reductions from a scrappage program occur 5 to 10 years after its introduction and can reach as much as 70%. The greatest reductions with retrofit occur around 2030 and range from 16-31%. Monte Carlo simulations are used to evaluate how uncertainties in the composition of the vehicle fleet affect predicted reductions. Scrappage and retrofit reduce global emissions by 31-60% and 15-31%, respectively, within 95% confidence intervals, under a mid-range scenario in the year 2030. The simulations provide guidance about which strategies are most effective for specific regions. Retrofit is preferable for high-income regions. For regions where early emission standards are in place, scrappage is suggested, followed by retrofit after more advanced emission standards are introduced. The early implementation of advanced emission standards is recommended for Western and Eastern Africa.
Related JoVE Video
Dextransucrase-catalyzed elongation of polysaccharide brushes with immobilized mono-/di-saccharides as acceptors.
Chem. Commun. (Camb.)
PUBLISHED: 11-11-2014
Show Abstract
Hide Abstract
A quartz crystal microbalance (QCM) was used to monitor dextransucrase (DSase)-catalyzed polysaccharide elongation on the glucose-/maltose-ended self-assembly monolayer (SAM) surfaces. Kinetic parameters of the enzymatic elongation indicate that maltose is a promising substrate acceptor for DSase.
Related JoVE Video
Peripheral T-cell lymphoma at the injection site of influenza vaccination.
Indian J Dermatol Venereol Leprol
PUBLISHED: 11-11-2014
Show Abstract
Hide Abstract
Pseudolymphomas or B-cell lymphoma at the vaccination site have been reported by several authors. However, onset of cutaneous T-cell lymphoma with cytotoxic features is a rare complication of vaccination. We report a 27-year-old man who developed a nodule and ulcer that arose at the site of injection of influenza vaccine. The neoplastic cells reacted positively for CD56, CD3, CD2, perforin, and granzyme B, but negatively for CD4, CD8, CD10, CD19, CD30, CD34, CD79, and betaF1. Molecular studies showed T-cell receptor ? (TCR-?) chain monoclonal rearrangement. A diagnosis of peripheral T-cell lymphoma, not otherwise specified (NOS) was established. The patient had high fever, progressive liver dysfunction and a rapid fatal evolution.
Related JoVE Video
[Discussion of scattering in THz time domain spectrum tests].
Guang Pu Xue Yu Guang Pu Fen Xi
PUBLISHED: 11-01-2014
Show Abstract
Hide Abstract
Using THz-TDS to extract the absorption spectrum of a sample is an important branch of various THz applications. Basically, we believe that the THz radiation scatters from sample particles, leading to an obvious baseline increasing with frequencies in its absorption spectrum. The baseline will affect the measurement accuracy due to ambiguous height and pattern of the spectrum. The authors should try to remove the baseline, and eliminate the effects of scattering. In the present paper, we investigated the causes of baselines, reviewed some of scatter mitigating methods and summarized some of research aspects in the future. In order to validate the correctness of these methods, we designed a series of experiments to compare the computational accuracy of molar concentration. The result indicated that the computational accuracy of molar concentration can be improved, which can be the basis of quantitative analysis in further researches. Finally, with comprehensive experimental results, we presented further research directions on THz absorption spectrum that is needed for the removal of scattering effects.
Related JoVE Video
[Clinical Curative Efficacy of Inducing Remission for the Newly Diagnosed Aged AML Patients by Chemotherapy with IA and DA Regimens].
Zhongguo Shi Yan Xue Ye Xue Za Zhi
PUBLISHED: 10-24-2014
Show Abstract
Hide Abstract
This study was aimed to explore the clinical efficacy and toxicity of idarubicin (IA regimen) and daunoru-bicin combined with cytarabine (DA regimen) for treating aged patients with AML as induction chemotherapy. The clinical data of 60 newly diagnosed AML aged patients treated with IA or DA regimen were analyzed retrospectively. IA regimen group included 22 patients (8 male and 14 females with median age of 66 yrs), while the DA regimen group included 38 patients (20 males and 18 females with median age of 64 yrs). The complete remission rate, total effective rate and adverse effects after one chemotherapy course were compared. The results showed that the CR rate in IA regimen group was 63.63%, which was significantly higer than that in DA regimen group (31.58%) (P < 0.05). The total effective rate was 63.63% and 36.84% respectively in IA and DA regimen groups, there was significant difference between the two groups (P < 0.05). Both the hematological and non-hematological adverse effects were observed and no difference was found in the two regimen groups, neither in myelosupression (P > 0.05), the major hematological adverse effects, nor in non-hematological adverse effects (P > 0.05). It is concluded that for aged AML patients, IA regimen can achieve a higher CR rate and higher total effective rate than that in DA regimen without increase of adverse effects after one induction chemotherapy course.
Related JoVE Video
Continuous right thoracic paravertebral block following bolus initiation reduced postoperative pain after right-lobe hepatectomy: a randomized, double-blind, placebo-controlled trial.
Reg Anesth Pain Med
PUBLISHED: 10-12-2014
Show Abstract
Hide Abstract
We hypothesized that continuous right thoracic paravertebral block, following bolus initiation, decreases opioid consumption after right-lobe hepatectomy in patients receiving patient-controlled intravenous analgesia with sufentanil.
Related JoVE Video
[Detection of respiratory viruses in influenza-like illness in Shijiazhuang, China in 2011].
Bing Du Xue Bao
PUBLISHED: 10-03-2014
Show Abstract
Hide Abstract
This study aimed to investigate viral infections and the prevalence of influenza-like illness (ILI) in Shijiazhuang, China, in 2011 and to provide a scientific basis for the diagnosis and control of respiratory tract infections. Throat swab specimens were collected from 483 cases of ILI who were outpatients in the influenza surveillance sentinel hospitals in Shijiazhuang between January and December 2011. All specimens were examined by multiplex RT-PCR for the following 15 respiratory tract viruses: adenovirus (ADV), human rhinovirus (HRV), human parainfluenza virus (PIV types 1-4), influenza virus A (FluA), influenza virus B (FluB), human enterovirus (HEV), respiratory syncytial virus (RSV-A and -B), human metapneumovirus (HMPV), human coronavirus (HCoV-229E/NL63 and -OC43/HKU1), and human bocavirus (HBoV). Among the 483 cases of ILI, 214 (44.31%) were positive for viruses, including ADV (8.7%), HEV (8.7%), RSV-A (8.07%), HRV (7.45%), FluA (5.38%), HCoV-OC43/ HKU1 (2.9%), PIV-3 (2.9%), HMPV (1.86%), PIV-1 (1.24%), HCoV-229E/NL63 (1.04%), PIV-2 (1.04%), HBoV (0.83%), and FluB (0.41%). Twenty-six (5.38%) of all cases were co-infected with two or more viruses, most commonly HEV/HRV with other viruses. Cases of viral infection were detected throughout the year, with peaks in January and February. ADV and HRV were detected throughout almost the whole year without obvious seasonality. HEV was detected between April and November, with a peak of prevalence in summer and autumn. FluA and FluB reached epidemic levels mainly in winter and spring. All cases of RSV were identified to be subtype A. PIV infection was mainly caused by PIV-3. The positive rate of HCoV-OC43/HKU1 infection was significantly higher than that of HCoV-229E/NL63. The leading five viruses that resulted in ILI Shijiazhuang in 2011 were HEV, ADV, RSV-A, HRV, and FluA, and these viruses have different epidemiological features.
Related JoVE Video
[Double mulching application for Panax notoginseng growing seedlings].
Zhongguo Zhong Yao Za Zhi
PUBLISHED: 09-11-2014
Show Abstract
Hide Abstract
In order to improve the irrigation for Panax notginseng growing seedlings, different mulching ways were carried out to investigate the effects of double mulching.
Related JoVE Video
[Relationship between disintegrin and metalloproteinase gene polymorphism of bronchial asthma and its severity in Uygur population].
Zhonghua Yi Xue Za Zhi
PUBLISHED: 08-27-2014
Show Abstract
Hide Abstract
To explore the relationship between disintegrin and metalloproteinase (ADAM33) gene polymorphism of bronchial asthma and its severity in Xinjiang Uygur population.
Related JoVE Video
Molecular Characterization of the BMP7 Gene and Its Potential Role in Shell Formation in Pinctada martensii.
Int J Mol Sci
PUBLISHED: 08-23-2014
Show Abstract
Hide Abstract
Bone morphogenetic protein 7 (BMP7), also called osteogenetic protein-1, can induce bone formation. In this study, the obtained full-length cDNA of BMP7 from Pinctada martensii (Pm-BMP7) was 2972 bp, including a 5'-untranslated region (UTR) of 294 bp, an open reading fragment of 1290 bp encoding a 429 amino acid polypeptide and a 3'-UTR of 1388 bp. The deduced protein sequence of Pm-BMP7 contained a signal peptide, a pro-domain and a mature peptide. The mature peptide consisted of 135 amino acids and included a transforming growth factor ? family domain with six shared cysteine residues. The protein sequence of Pm-BMP7 showed 66% identity with that from Crassostrea gigas. Two unigenes encoding Pm-BMPRI (Pm-BMP receptor I) and Pm-BMPRII were obtained from the transcriptome database of P. martensii. Tissue expression analysis demonstrated Pm-BMP7 and Pm-BMPRI were highly expressed in the mantle (shell formation related-tissue), while Pm-BMPRII was highly expressed in the foot. After inhibiting Pm-BMP7 expression using RNA interference (RNAi) technology, Pm-BMP7 mRNA was significantly down-regulated (p < 0.05) in the mantle pallium (nacre formation related-tissue) and the mantle edge (prismatic layer formation related-tissue). The microstructure, observed using a scanning electron microscope, indicated a disordered growth status in the nacre and obvious holes in the prismatic layer in the dsRNA-Pm-BMP7 injected-group. These results suggest that Pm-BMP7 plays a crucial role in the nacre and prismatic layer formation process of the shell.
Related JoVE Video
Involvement of RhoA/ROCK in insulin secretion of pancreatic ?-cells in 3D culture.
Cell Tissue Res.
PUBLISHED: 08-17-2014
Show Abstract
Hide Abstract
Cell-cell contacts and interactions between pancreatic ?-cells and/or other cell populations within islets are essential for cell survival, insulin secretion, and functional synchronization. Three-dimensional (3D) culture systems supply the ideal microenvironment for islet-like cluster formation and functional maintenance. However, the underlying mechanisms remain unclear. In this study, mouse insulinoma 6 (MIN6) cells were cultured in a rotating 3D culture system to form islet-like aggregates. Glucose-stimulated insulin secretion (GSIS) and the RhoA/ROCK pathway were investigated. In the 3D-cultured MIN6 cells, more endocrine-specific genes were up-regulated, and GSIS was increased to a greater extent than in cells grown in monolayers. RhoA/ROCK inactivation led to F-actin remodeling in the MIN6 cell aggregates and greater insulin exocytosis. The gap junction protein, connexin 36 (Cx36), was up-regulated in MIN6 cell aggregates and RhoA/ROCK-inactivated monolayer cells. GSIS dramatically decreased when Cx36 was knocked down by short interfering RNA and could not be reversed by RhoA/ROCK inactivation. Thus, the RhoA/ROCK signaling pathway is involved in insulin release through the up-regulation of Cx36 expression in 3D-cultured MIN6 cells.
Related JoVE Video
Intermolecular interactions and 3D structure in cellulose-NaOH-urea aqueous system.
J Phys Chem B
PUBLISHED: 08-15-2014
Show Abstract
Hide Abstract
The dissolution of cellulose in NaOH/urea aqueous solution at low temperature is a key finding in cellulose science and technology. In this paper, (15)N and (23)Na NMR experiments were carried out to clarify the intermolecular interactions in cellulose/NaOH/urea aqueous solution. It was found that there are direct interactions between OH(-) anions and amino groups of urea through hydrogen bonds and no direct interaction between urea and cellulose. Moreover, Na(+) ions can interact with both cellulose and urea in an aqueous system. These interactions lead to the formation of cellulose-NaOH-urea-H2O inclusion complexes (ICs). (23)Na relaxation results confirmed that the formation of urea-OH(-) clusters can effectively enhance the stability of Na(+) ions that attracted to cellulose chains. Low temperature can enhance the hydrogen bonding interaction between OH(-) ions and urea and improve the binding ability of the NaOH/urea/H2O clusters that attached to cellulose chains. Cryo-TEM observation confirmed the formation of cellulose-NaOH-urea-H2O ICs, which is in extended conformation with mean diameter of about 3.6 nm and mean length of about 300 nm. Possible 3D structure of the ICs was proposed by the M06-2X/6-31+G(d) theoretical calculation, revealing the O3H···O5 intramolecular hydrogen bonds could remain in the ICs. This work clarified the interactions in cellulose/NaOH/urea aqueous solution and the 3D structure of the cellulose chain in dilute cellulose/NaOH/urea aqueous solution.
Related JoVE Video
Stability profiling of anti-malarial drug piperaquine phosphate and impurities by HPLC-UV, TOF-MS, ESI-MS and NMR.
Malar. J.
PUBLISHED: 07-30-2014
Show Abstract
Hide Abstract
Piperaquine, 1,3-bis-[4-(7-chloroquinolyl-4)-piperazinyl-1]-propane, is an anti-malarial compound belonging to the 4-aminoquinolines, which has received renewed interest in treatment of drug resistant falciparum malaria in artemisinin-based combination therapy with dihydroartemisinin. The impurity profile of this drug product is paid an ever-increasing attention. However, there were few published studies of the complete characterization of related products or impurities in piperaquine phosphate bulk and forced degradation samples.
Related JoVE Video
Noncanonical NF-?B activation mediates STAT3-stimulated IDO upregulation in myeloid-derived suppressor cells in breast cancer.
J. Immunol.
PUBLISHED: 07-25-2014
Show Abstract
Hide Abstract
Immunotherapy for cancer treatment is achieved through the activation of competent immune effector cells and the inhibition of immunosuppressive cells, such as myeloid-derived suppressor cells (MDSCs). Although MDSCs have been shown to contribute to breast cancer development, the mechanism underlying MDSC-mediated immunosuppression is unclear. We have identified a poorly differentiated MDSC subset in breast cancer-suppressing T cell function through STAT3-dependent IDO upregulation. In this study we investigated the mechanisms underlying aberrant expression of IDO in MDSCs. MDSCs were induced by coculturing human CD33(+) myeloid progenitors with MDA-MB-231 breast cancer cells. Increased STAT3 activation in MDSCs was correlated with activation of the noncanonical NF-?B pathway, including increased NF-?B-inducing kinase (NIK) protein level, phosphorylation of cytoplasmic inhibitor of NF-?B kinase ? and p100, and RelB-p52 nuclear translocation. Blocking STAT3 activation with the small molecule inhibitor JSI-124 significantly inhibited the accumulation of NIK and IDO expression in MDSCs. Knockdown of NIK in MDSCs suppressed IDO expression but not STAT3 activation. RelB-p52 dimers were found to directly bind to the IDO promoter, leading to IDO expression in MDSCs. IL-6 was found to stimulate STAT3-dependent, NF-?B-mediated IDO upregulation in MDSCs. Furthermore, significant positive correlation between the numbers of pSTAT3(+) MDSCs, IDO(+) MDSCs, and NIK(+) MDSCs was observed in human breast cancers. These results demonstrate a STAT3/NF-?B/IDO pathway in breast cancer-derived MDSCs, which provides insight into understanding immunosuppressive mechanisms of MDSCs in breast cancer.
Related JoVE Video
A taxonomic study on the species of the genus Ocellarnaca (Orthoptera, Gryllacrididae, Gryllacridinae).
Zootaxa
PUBLISHED: 07-08-2014
Show Abstract
Hide Abstract
A taxonomic study of the genus Ocellarnaca Gorochov, 2004 was presented. Four new species were described: O. omeica sp. nov., O. coomani sp. nov., O. xiai sp. nov., O. brevicauda sp. nov.. A key to the species and the distributional data of Ocellarnaca were provided. 
Related JoVE Video
[Effects of temperature on fecundity of nine lepidopteran species in Tiantong National Forest Park, Zhejiang Province, China].
Ying Yong Sheng Tai Xue Bao
PUBLISHED: 07-03-2014
Show Abstract
Hide Abstract
Detailed experiments were carried out to investigate the effects of temperature on fecundity of nine lepidopteran species in Tiantong National Forest Park, Zhejiang Province, China. In the temperature range of 19-28 degrees C, nine lepidopteran moths laid eggs and the eggs hatched successfully, and the preoviposition period was shortened with the rising of temperature. The largest fecundity of Ourapteryx ebuleata szechuana and other seven lepidopteran species occurred at 22 degrees C, while that of Miltochrista ziczac occured at 25 degrees C. The period of the embryonic stages of the nine lepidopteran species were shortened with the rising of the temperature. O. ebuleata szechuana had a lower developmental threshold temperature at 9.52 degrees C and a higher effective accumulated temperature of 120. 82 degree-day, while the other 8 species got the developmental threshold temperature between 13.32 degrees C to 14.72 degrees C, and the effective accumulated temperature between 45.09 degree-day to 68.30 degree-day. The regressive equation of effective accumulated temperature obtained in the research could be used to preliminarily forecast the occurring of the nine lepidopterans.
Related JoVE Video
A rabbit model of spontaneous thrombosis induced by lipopolysaccharide.
J. Atheroscler. Thromb.
PUBLISHED: 06-05-2014
Show Abstract
Hide Abstract
Inflammation plays a critical role in the development of atherosclerotic plaque, and lipopolysaccharide (LPS) is a potentially important source of inflammation. The aim of this study was to develop a rabbit model of spontaneous thrombosis mimicking the pathophysiological and morphological characteristics of atherosclerotic plaque in humans.
Related JoVE Video
Activation of epidermal growth factor receptor mediates mucin production stimulated by p40, a Lactobacillus rhamnosus GG-derived protein.
J. Biol. Chem.
PUBLISHED: 06-03-2014
Show Abstract
Hide Abstract
The mucus layer coating the gastrointestinal tract serves as the first line of intestinal defense against infection and injury. Probiotics promote mucin production by goblet cells in the intestine. p40, a Lactobacillus rhamnosus GG-derived soluble protein, has been shown to transactivate the EGF receptor (EGFR) in intestinal epithelial cells, which is required for inhibition of apoptosis and preservation of barrier function in the colon, thereby ameliorating intestinal injury and colitis. Because activation of EGFR has been shown to up-regulate mucin production in goblet cells, the purpose of this study was to investigate the effects and mechanisms of p40 regulation of mucin production. p40 activated EGFR and its downstream target, Akt, in a concentration-dependent manner in LS174T cells. p40 stimulated Muc2 gene expression and mucin production in LS174T cells, which were abolished by inhibition of EGFR kinase activity, down-regulation of EGFR expression by EGFR siRNA transfection, or suppression of Akt activation. Treatment with p40 increased mucin production in the colonic epithelium, thus thickening the mucus layer in the colon of wild type, but not of Egfr(wa5) mice, which have a dominant negative mutation in the EGFR kinase domain. Furthermore, inhibition of mucin-type O-linked glycosylation suppressed the effect of p40 on increasing mucin production and protecting intestinal epithelial cells from TNF-induced apoptosis in colon organ culture. Thus, these results suggest that p40-stimulated activation of EGFR mediates up-regulation of mucin production, which may contribute to the mechanisms by which p40 protects the intestinal epithelium from injury.
Related JoVE Video
A rapid and sensitive UPLC-MS/MS method for determination of HZ08 in rat plasma and tissues: Application to a pharmacokinetic study of liposome injections.
J Pharm Biomed Anal
PUBLISHED: 06-01-2014
Show Abstract
Hide Abstract
Overexpression of P-glycoprotein leads to tumor multidrug resistance (MDR). HZ08, a novel tetrahydro-isoquinoline derivate, was discovered to inhibit the MDR in the cancer cell lines of MCF-7/ADM, K562/ADM and KBV in our previous studies. A rapid and sensitive ultra-performance liquid chromatography-tandem mass spectrometric method (UPLC-MS/MS) was developed and validated for determination of HZ08 in rat plasma and tissues after intravenous administration of HZ08 liposome injection at different doses. The analytes were extracted from plasma and tissues using protein precipitation by acetonitrile with clotrimazole as internal standard. The chromatographic separation was performed on a Thermo BDS HYPERSIL C18 column (100mm×4.6mm, 2.4?m) at a flow rate of 0.7ml/min using 0.2% ammonium acetate solution (containing 0.1% formic acid) and methanol as mobile phase. The total run time was 4min. The tandem mass detection was applied with electrospray ionization in positive ion selected reaction monitoring mode. The ion transitions monitored were m/z 523.5 to 342.3 for HZ08 and 277.1 to 165.1 for the internal standard, respectively. The calibration curves obtained were linear in different matrices, and the lower limit of quantification (LLOQ) achieved was 1ng/ml for rat plasma and 0.25ng/ml for rat tissues, respectively. The RSDs for intra- and inter-day precision were less than 15%. Extraction recovery, matrix effect and stability were satisfactory in rat plasma and tissues. The developed method was successfully applied to a pharmacokinetic study of HZ08 liposome injection following intravenous administration of 1, 3, 10mg/kg to Sprague-Dawley rats. The data profiles revealed that HZ08 had linear pharmacokinetic properties at the tested doses, and was rapidly distributed into the systemic circulation with wide distribution throughout the body followed by a rapid elimination phase. The major distribution tissues of HZ08 in rats were lung, spleen and liver. These results provided constructive contribution to support the clinical evaluation.
Related JoVE Video
Mass Production of Multi-Channeled Porous Carbon Nanofibers and Their Application as Binder-Free Electrodes for High-Performance Supercapacitors.
Small
PUBLISHED: 05-30-2014
Show Abstract
Hide Abstract
A unique class of multi-channeled porous carbon nanofibers (MCPCNFs) are designed with dual-pathway ion transport capability via a modified electrospinning approach. Combined with other features including high conductivity and numerous functional groups for facilitating the formation of electric double-layer charges, the MCPCNFs exhibit excellent supercapacitive performance, holding great potential for high-performance supercapacitor electrode materials.
Related JoVE Video
Tissue inhibitor of metalloproteinase gene from pearl oyster Pinctada martensii participates in nacre formation.
Biochem. Biophys. Res. Commun.
PUBLISHED: 05-13-2014
Show Abstract
Hide Abstract
Tissue inhibitors of metalloproteinases (TIMPs) are nature inhibitors of matrix metalloproteinases and play a vital role in the regulation of extracellular matrix turnover, tissue remodeling and bone formation. In this study, the molecular characterization of TIMP and its potential function in nacre formation was described in pearl oyster Pinctada martensii. The cDNA of TIMP gene in P. martensii (Pm-TIMP) was 901 bp long, containing a 5' untranslated region (UTR) of 51 bp, a 3' UTR of 169 bp, and an open reading fragment (ORF) of 681 bp encoding 226 amino acids with an estimated molecular mass of 23.37 kDa and a theoretical isoelectric point of 5.42; The predicted amino acid sequence had a signal peptide, 13 cysteine residues, a N-terminal domain and a C-terminal domain, similar to that from other species. Amino acid multiple alignment showed Pm-TIMP had the highest (41%) identity to that from Crassostrea gigas. Tissue expression analysis indicated Pm-TIMP was highly expressed in nacre formation related-tissues, including mantle and pearl sac. After decreasing Pm-TIMP gene expression by RNA interference (RNAi) technology in the mantle pallium, the inner nacreous layer of the shells showed a disordered growth. These results indicated that the obtained Pm-TIMP in this study participated in nacre formation.
Related JoVE Video
Comparative Study of Trigeminocardiac Reflex After Trigeminal Ganglion Compression During Total Intravenous Anesthesia.
J Neurosurg Anesthesiol
PUBLISHED: 05-09-2014
Show Abstract
Hide Abstract
Percutaneous compression of the trigeminal ganglion (PCTG) is an alternative surgical treatment for trigeminal neuralgia (TN). Manipulation of PCTG can lead to significant hemodynamic changes, which may increase the risk of cardiovascular complications. However, to our knowledge, few studies have focused on anesthesia experience during PCTG as treatment for TN so far. It was our primary focus on how to ensure the stability of hemodynamics during our clinical anesthesia experience. This study aimed to compare the study group (using sodium nitroprusside [SNP] as soon as the puncture began) with the control group (without using SNP as soon as the puncture began) to investigate cardiovascular parameters (systolic blood pressure [SBP], diastolic blood pressure [DBP], and heart rate [HR]) at 5 periods during total intravenous anesthesia.
Related JoVE Video
Antioxidative properties of 4-methylumbelliferone are related to antibacterial activity in the silkworm (Bombyx mori) digestive tract.
J. Comp. Physiol. B, Biochem. Syst. Environ. Physiol.
PUBLISHED: 04-21-2014
Show Abstract
Hide Abstract
Umbelliferones have gained significant attention due to their tumor-inhibitory effects in vitro. This study was undertaken to examine the impact of umbelliferones in an invertebrate model organism, Bombyx mori, to assess the underlying antimicrobial activities via antioxidation in vivo. Oral administration of 4 mM 4-methylumbelliferone (4-MU), a model umbelliferone drug, in B. Mori larvae caused a rapid increase in reactive oxygen species, such as hydrogen peroxide (H2O2) and antimicrobial activity in the digestive tract. In addition, a significant increase in total antioxidant capacity as well as superoxide anion radical-inhibiting activity and reduced glutathione were detected. The antioxidant defense system was activated following induction of H2O2, resulting in a significant rise in catalase (50-66 %) and glutathione peroxidase (175 %) activities, which were helpful in defending digestive tract cells against oxidative injury. These results help in understanding the anticancer mechanism of 4-MU based on its antioxidation in organisms.
Related JoVE Video
PLC?1: a potential target of RNA interference therapy for gastric cancer.
Biochem. Biophys. Res. Commun.
PUBLISHED: 04-21-2014
Show Abstract
Hide Abstract
Phospholipase C epsilon 1 (PLC?1) has been recently identified as a novel potential biomarker for gastric cancer because of its critical role in inflammation and tumorigenesis. Until now, there are no further reports to investigate the feasibility of gene therapy by suppressing PLC?1 expression for gastric cancer. In this study, a small interfering RNA (shRNA) targeting PLC?1 was firstly transfected into gastric cancer cells in order to silence PLC?1 expression. Both mRNA and protein expression of PLC?1 in gastric cancer cells significantly reduced by RT-PCR and Western blotting analysis. Moreover, subsequent results revealed that PLC?1 shRNA depressed the in vitro and in vivo growth of gastric cancer cells by using MTT assay and tumor xenograft experiment. Furthermore, after PLC?1 shRNA transfection, the expression of proinflammatory molecules including tumor necrosis factor-? (TNF-?), cyclooxygenase 2 (COX-2), interleukin (IL)-6 and chemokine (C-X-C motif) ligand (CXCL)-1 were unaffected, but only chemokine (C-C motif) ligand (CCL)-2 expression decreased in the gastric cancer cells. It is implied that PLC?1 may inhibit the growth of gastric cancer cells via CCL-2 protein mediated pathway. These results suggest that PLC?1 might be an alternative molecular target for gastric cancer gene therapy.
Related JoVE Video
Platelet-derived growth factor-BB induces matrix metalloproteinase-2 expression and rat vascular smooth muscle cell migration via ROCK and ERK/p38 MAPK pathways.
Mol. Cell. Biochem.
PUBLISHED: 04-12-2014
Show Abstract
Hide Abstract
Matrix metalloproteinases (MMP) play a pivotal role in the pathogenesis of cardiovascular diseases. Their expressions are altered in response to a variety of stimuli, including growth factors, inflammatory markers, and cytokines. In this study, we demonstrated that platelet-derived growth factor-BB (PDGF-BB) induces a dose- and time-dependent increase in MMP-2 expression in rat vascular smooth muscle cells (VSMC). Treatment with either the Rho-associated protein kinase (ROCK) inhibitor Y-27632 or suppression of ROCK-1/2 by small interfering RNA technology significantly reduced the MMP-2 expression, thus suggesting that ROCK regulates such expression. Similar results were observed when VSMC were pretreated with either U0126 or SB203580, which are selective inhibitors of extracellular signal-regulated kinase and p38 mitogen-activated protein kinase, respectively, thus suggesting that these kinases are important for the induction of MMP-2 expression by PDGF-BB. In conclusion, these results described a novel mechanism in atherosclerosis through PDGF-BB signaling in VSMC, in which MMP-2 expression is induced via extracellular signal-regulated kinases and p38 mitogen-activated protein kinase phosphorylation, as well as ROCK.
Related JoVE Video
The role of the PTEN/PI3K/Akt pathway on prognosis in epithelial ovarian cancer: a meta-analysis.
Oncologist
PUBLISHED: 04-09-2014
Show Abstract
Hide Abstract
The PTEN/PI3K/Akt signaling pathway, a key player in mediating apoptosis, metabolism, cell proliferation, and cell growth, is frequently dysregulated in many cancers. However, the pathway's prognostic impact in epithelial ovarian cancer (EOC) is still inconsistent. We performed a meta-analysis based on individual study outcomes to more precisely evaluate its clinical significance in EOC patients. Methods. We searched all potentially relevant studies published between January 1, 1990, and March 1, 2013, that assessed the association between PTEN, PI3K, and Akt status and survival in EOC. Meta-analysis was performed using a fixed-effect or random-effects model as appropriate. We investigated the possibility of publication bias through a funnel plot and identified the heterogeneity by I(2) statistics. Results. Eleven eligible studies were analyzed for PTEN, 5 for PI3K, and 11 for pAkt. High PI3K and pAkt expression was associated with poor overall survival (OS; pooled adjusted hazard ratio [HR] = 1.44, 95% CI, 1.08-1.91 for PI3K; HR = 1.60, 95% CI, 1.26-2.04 for pAkt). In addition, both the meta-analyses of univariate and multivariate estimates showed that only high pAkt expression was significantly associated with poor progression-free survival (PFS; pooled unadjusted HR = 1.24, 95% CI, 1.10-1.39; pooled adjusted HR = 1.65, 95% CI, 1.07-2.55). Conclusion. Published studies suggest that high pAkt expression is significantly associated with poor OS and PFS in EOC patients, but currently available evidence is insufficient to recommend that PTEN, PI3K, or Akt be used as prognostic predictors in EOC in clinical practice.
Related JoVE Video
Formulation and characterization of albumin microspheres containing norcantharidate for liver tumor targeting.
Drug Deliv
PUBLISHED: 03-28-2014
Show Abstract
Hide Abstract
Abstract The objectives of this study were first to encapsulate norcantharidate into albumin microspheres by the emulsion crosslinking method and second to characterize the microspheres in terms of the morphological examination, particle size, and encapsulation efficiency. The in vitro release of norcantharidate from the microspheres was studied by using the dialysis bag method. Pharmacokinetics and biodistribution studies were used to evaluate the advantages of microspheres than the conventional formulations. The microspheres prepared by crosslink emulsion were with uniform size, smooth surface, spherical shape, and disperse evenly. The particle size was uniform (13.3?±?0.4?µm) and the encapsulation efficiency was 54.3?±?4.18%. In vitro release indicated that the norcantharidate microspheres had a well-sustained release efficacy and fitted Korsmeyer's Peppas release model. In vivo studies showed that pharmacokinetics of norcantharidate microspheres could be described by the model of two-compartment after i.v. administration and had higher AUC inside liver and spleen than the injection group. No histological change occurred to the rat liver after the administration of norcantharidate microspheres.
Related JoVE Video
Serum-free medium optimization based on trial design and support vector regression.
Biomed Res Int
PUBLISHED: 03-17-2014
Show Abstract
Hide Abstract
The Plackett-Burman design and support vector machine (SVM) were reported to be used on many fields such as some feature selections, protein structure prediction, or forecasting of other situations. Here, with suspension adapted Chinese hamster ovary (CHO) cells as the object of study, a serum-free medium for the culture of CHO cells in suspension was optimized by this method. Support vector machine based on genetic algorithm was used to predict the growth rate of CHO and prove the results from the trial designs. Experimental results indicated that ZnSO4, transferrin, and bovine serum albumin (BSA) were important ones. The same conclusion was arrived at when the support vector regression model analyzed the experimental results. With the methods mentioned, the influence of 7 medium supplements on the growth of CHO cells in suspension was evaluated efficiently.
Related JoVE Video
Regulation of p53-targeting microRNAs by polycyclic aromatic hydrocarbons: Implications in the etiology of multiple myeloma.
Mol. Carcinog.
PUBLISHED: 03-07-2014
Show Abstract
Hide Abstract
Multiple myeloma (MM) is a common and deadly cancer of blood plasma cells. A unique feature of MM is the extremely low somatic mutation rate of the p53 tumor suppressor gene, in sharp contrast with about half of all human cancers where this gene is frequently mutated. Eleven miRNAs have been reported to repress p53 through direct interaction with the 3' untranslated region. The expression of nine of them is higher in MM plasma cells than in healthy donor counterparts, suggesting that miRNA overexpression is responsible for p53 inactivation in MM. Here, we report that the environmental carcinogen benzo[a]pyrene (BaP) upregulated the expression of seven p53-targeting miRNAs (miR-25, miR-15a, miR-16, miR-92, miR-125b, miR-141, and miR-200a), while 2,3,7,8-tetrachlorodibenzo-?-dioxin (TCDD) upregulated two of them (miR-25 and miR-92) in MM cells. The miR-25 promoter was activated by both BaP and TCDD, and this response was mediated by the aryl hydrocarbon receptor (AhR). We screened 727 compounds that inhibit MM cell survival and down-regulate the expression of p53-targeting miRNAs. We found that (-)-epigallocatechin-3-gallate (EGCG), a constituent of green tea and a major component of the botanical drug Polyphenon® E, reduced the expression of four p53-targeting miRNAs, including miR-25, miR-92, miR-141, and miR-200a. Collectively, these data implicate polycyclic aromatic hydrocarbons and AhR in the regulation of p53-targeting miRNAs in MM and identify a potential therapeutic and preventive agent to combat this deadly disease. © 2014 Wiley Periodicals, Inc.
Related JoVE Video
A diverse paleobiota in early eocene Fushun amber from China.
Curr. Biol.
PUBLISHED: 03-03-2014
Show Abstract
Hide Abstract
Paleogene arthropod biotas have proved important for tracing the faunal turnover and intercontinental faunal interchange driven by climatic warming and geodynamic events [1-5]. Despite the large number of Paleogene fossil arthropods in Europe and North America [5-8], little is known about the typical Asian (Laurasia-originated) arthropod biota. Here, we report a unique amber biota (50-53 million years ago) from the Lower Eocene of Fushun in northeastern China, which fills a large biogeographic gap in Eurasia. Fushun amber is derived from cupressaceous trees, as determined by gas chromatography-mass spectrometry, infrared spectroscopy, and paleobotanical observations. Twenty-two orders and more than 80 families of arthropods have been reported so far, making it among the most diverse amber biotas. Our results reveal that an apparent radiation of ecological keystone insects, including eusocial, phytophagous, and parasitoid lineages, occurred at least during the Early Eocene Climatic Optimum. Some insect taxa have close phylogenetic affinities to those from coeval European ambers, showing a biotic interchange between the eastern and western margins of the Eurasian landmass during the Early Paleogene.
Related JoVE Video
Transcriptome analysis of the Bombyx mori fat body after constant high temperature treatment shows differences between the sexes.
Mol. Biol. Rep.
PUBLISHED: 02-25-2014
Show Abstract
Hide Abstract
Ambient temperature plays a large role in insect growth, development and even their distribution. The elucidation of the associated molecular mechanism that underlies the effect of constant high temperature will enables us to further understand the stress responses. We constructed four digital gene expression libraries from the fat body of female and male Bombyx mori. Differential gene expression was analyzed after constant high temperature treatment. The results showed that there were significant changes to the gene expression in the fat body after heat treatment, especially in binding, catalytic, cellular and metabolic processes. Constant high temperature may induce more traditional cryoprotectants, such as glycerol, glycogen, sorbitol and lipids, to protect cells from damage, and induce heat oxidative stress in conjunction with the heat shock proteins. The data also indicated a difference between males and females. The heat shock protein-related genes were up-regulated in both sexes but the expression of Hsp25.4 and DnaJ5 were down-regulated in the male fat body of B. mori. This is the first report of such a result. Constant high temperature also affected the expression of other functional genes and differences were observed between male and female fat bodies in the expression of RPS2, RPL37A and MREL. These findings provide abundant data on the effect of high temperature on insects at the molecular level. The data will also be beneficial to the study of differences between the sexes, manifested in variations in gene expression under high temperature.
Related JoVE Video
Chitin synthase A: a novel epidermal development regulation gene in the larvae of Bombyx mori.
Mol. Biol. Rep.
PUBLISHED: 02-13-2014
Show Abstract
Hide Abstract
Chitin synthase is the key regulatory enzyme for chitin synthesis and excretion in insects, as well as a specific target of insecticides. The chitin synthase A gene (BmChsA) cloned from Bombyx mori, the model species of lepidopteran, is an epidermis-specific expressed gene during the molting stage. Knockdown BmChsA gene in 3rd instar larvae increased the number of non-molting and abnormal molting larvae. Exposure to nikkomycin Z, a chitin synthase inhibitor downregulated the expression of BmChsA and decreased the amount of epidermis chitin during the molting process. The thickness of the new epidermis and its dense structure varied greatly. The exogenous hormones significantly upregulated the expression of BmChsA with low levels of endogenous MH and high levels of endogenous JH immediately after molting. With low levels of endogenous hormones during the mulberry intake process, BmChsA was rarely upregulated by exogenous hormones. With high levels of endogenous MH and low levels of endogenous JH during the molting stage, we did not detect the upregulation of BmChsA by exogenous hormones. The expression of BmChsA was regulated by endocrine hormones, which directly affected the chitin synthesis-dependent epidermal regeneration and molting process.
Related JoVE Video
Activation of EGFR and ERBB2 by Helicobacter pylori results in survival of gastric epithelial cells with DNA damage.
Gastroenterology
PUBLISHED: 02-06-2014
Show Abstract
Hide Abstract
The gastric cancer-causing pathogen Helicobacter pylori up-regulates spermine oxidase (SMOX) in gastric epithelial cells, causing oxidative stress-induced apoptosis and DNA damage. A subpopulation of SMOX(high) cells are resistant to apoptosis, despite their high levels of DNA damage. Because epidermal growth factor receptor (EGFR) activation can regulate apoptosis, we determined its role in SMOX-mediated effects.
Related JoVE Video
Initial hemodialysis with a temporary catheter is associated with complications of a later permanent vascular access.
Blood Purif.
PUBLISHED: 02-02-2014
Show Abstract
Hide Abstract
The aim was to identify the risk factors of long-term vascular access complications. The study cohort consisted of 239 incident hemodialysis (HD) patients from 1998 to 2010 in a single center. Among these patients, 59.8% had initially been dialyzing with a temporary catheter. Within 3 months after starting dialysis, all catheters had been converted into permanent accesses. 45 patients incurred long-term access complications after the first 2 years of dialysis, and 34 (75.6%) had used a temporary catheter starting HD. Complication occurrence was associated with age, initiation dialysis with a catheter and heart failure by logistic regression (odds ratios were 1.04, 2.77 and 2.23, respectively; p < 0.05). The 2-year primary patency rates of arteriovenous fistulae were significantly higher than those of arteriovenous grafts (79.5 vs. 50%, p = 0.002). We concluded that age, using a catheter and heart failure in HD initiation had a strong impact on long-term access complications.
Related JoVE Video
Schistosoma japonicum egg specific protein SjE16.7 recruits neutrophils and induces inflammatory hepatic granuloma initiation.
PLoS Negl Trop Dis
PUBLISHED: 02-01-2014
Show Abstract
Hide Abstract
Neutrophils are known to play a major role in the egg granulomatous lesions caused by Schistosoma japonicum, but the precise mechanism by which eggs recruit or active neutrophil is unknown. Here we report S. japonicum egg specific EF-hand protein-SjE16.7 is a potent neutrophil recruiter and initiates the egg associated inflammatory granuloma in schistosomiasis. We show that the expression of SjE16.7 at level of both mRNA and protein is restricted to the egg stage. It locates in the miracidium and subshell area of the egg and can be secreted by the egg. The antigenic properties of SjE16.7 strongly suggest a role for SjE16.7 as an egg-derived molecule involved in host-parasite interactions. To study SjE16.7 functions in vivo, we challenged murine air pouch with recombinant SjE16.7. The results showed SjE16.7 trigged more inflammatory cell infiltration than vehicle or control protein. Using peritoneal exudate neutrophils from mice, we found that SjE16.7 significantly induced neutrophil chemotaxis in vitro, and the observed phenotypes were associated with enhanced Rac GTPase activation in SjE16.7 treated cells. Finally, in vivo hepatic granuloma formation model showed SjE16.7 coupled beads recruited more inflammatory cell infiltration than control beads. Our findings suggest SjE16.7 is an important pathogenic factor derived from egg. By recruiting neutrophils and inducing local inflammation, SjE16.7 facilitates eggs to be excreted through gut tissues and also initiates pathology in the liver; therefore SjE16.7 is a possible target for the prevention and treatment of schistosomiasis.
Related JoVE Video
High-intensity focused ultrasound treatment of late-stage pancreatic body carcinoma: optimal tumor depth for safe ablation.
Ultrasound Med Biol
PUBLISHED: 01-22-2014
Show Abstract
Hide Abstract
Objective criteria are currently not available for assessing the extent of ablation by high-intensity focused ultrasound (HIFU). A retrospective review was conducted in Chinese patients with late-stage pancreatic body carcinoma treated with 1 h/d intermittent HIFU at a single center. Clinical and procedure-related characteristics were examined in relation to tumor posterior depth. Clinically, tumor ablation was negatively correlated with posterior tumor depth, with a 1-cm increase in depth decreasing ablation by 30.7%. At a computed tomography (CT)-determined 7-cm posterior tumor depth (considered the critical value for the procedure), ablation sensitivity and specificity were 77.8% and 72.7%, respectively. Tumor ablation >30% in patients with a CT-determined posterior tumor depth ?7 cm was 9.333 times better than that in patients with a CT-determined posterior tumor depth >7 cm. Adverse effects did not affect the efficacy of HIFU. Tumors with posterior depths <7 cm may effectively be treated with HIFU-induced ablation with minimal adverse events.
Related JoVE Video
Whole-genome sequence of a flatfish provides insights into ZW sex chromosome evolution and adaptation to a benthic lifestyle.
Nat. Genet.
PUBLISHED: 01-10-2014
Show Abstract
Hide Abstract
Genetic sex determination by W and Z chromosomes has developed independently in different groups of organisms. To better understand the evolution of sex chromosomes and the plasticity of sex-determination mechanisms, we sequenced the whole genomes of a male (ZZ) and a female (ZW) half-smooth tongue sole (Cynoglossus semilaevis). In addition to insights into adaptation to a benthic lifestyle, we find that the sex chromosomes of these fish are derived from the same ancestral vertebrate protochromosome as the avian W and Z chromosomes. Notably, the same gene on the Z chromosome, dmrt1, which is the male-determining gene in birds, showed convergent evolution of features that are compatible with a similar function in tongue sole. Comparison of the relatively young tongue sole sex chromosomes with those of mammals and birds identified events that occurred during the early phase of sex-chromosome evolution. Pertinent to the current debate about heterogametic sex-chromosome decay, we find that massive gene loss occurred in the wake of sex-chromosome 'birth'.
Related JoVE Video
Thyrotropin increases hepatic triglyceride content through upregulation of SREBP-1c activity.
J. Hepatol.
PUBLISHED: 01-07-2014
Show Abstract
Hide Abstract
Hallmarks of non-alcoholic fatty liver disease (NAFLD) are increased triglyceride accumulation within hepatocytes. The prevalence of NAFLD increases steadily with increasing thyrotropin (TSH) levels. However, the underlying mechanisms are largely unknown. Here, we focused on exploring the effect and mechanism of TSH on the hepatic triglyceride content.
Related JoVE Video
Identification of a Bombyx mori gene encoding small heat shock protein BmHsp27.4 expressed in response to high-temperature stress.
Gene
PUBLISHED: 01-06-2014
Show Abstract
Hide Abstract
Elucidating the mechanisms underlying the response and resistance to high-temperature stress in the Lepidoptera is essential for understanding the effect of high-temperature on the regulation of gene expression. A tag (CATGAACGTGAAGAGATTCAG) matching the predicted gene BGIBMGA005823-TA in SilkDB identified the most significant response to high-temperature stress in a screen of the heat-treated digital gene expression library of Bombyx mori (B. mori) (Unpublished data). BLAST and RACE showed that the gene is located on chromosome 5 and has an open reading frame (ORF) of 741bp. Phylogenetic analysis found that B. mori small heat shock protein 27.4 (BmHSP27.4) is in an evolutionary branch separate from other small heat shock proteins. Expression analysis showed that BmHsp27.4 is highly expressed in brain, eyes and fat bodies in B. mori. Its mRNA level was elevated at high-temperature and this increase was greater in females. The ORF without the signal peptide sequence was cloned into vector pET-28a(+), transformed and over-expressed in Escherichia coli Rosetta (DE3). Western blotting and immunofluorescence analysis with a polyclonal antibody, confirmed that the level of protein BmHSP27.4 increased at a high-temperature, in accordance with its increased mRNA level. In this study, BmHsp27.4 was identified as a novel B. mori gene with an important role in response to high-temperature stress.
Related JoVE Video
Tumor-associated macrophages induce lymphangiogenesis in cervical cancer via interaction with tumor cells.
APMIS
PUBLISHED: 01-03-2014
Show Abstract
Hide Abstract
Our studies were conducted to investigate the clinical and functional significance of tumor-associated macrophages (TAMs) in cervical tumor lymphatic metastasis. We found that the increase in macrophages in tumor stroma is significantly associated with lymphatic metastasis (p = 0.017), through performing immunohistochemical staining in 111 cervical samples (55 invasive squamous carcinomas of uterine cervix, 27 cervical intraepithelial neoplasms III, and 29 normal cervix). The human lymphatic endothelial cells (HLEC), which were cultured in conditioned medium of cervical cancer cell-macrophage coculture, formed more tube-like structures in vitro, when compared with those in conditioned mediums of LEC, normal cervical epithelium, single macrophage, and single cervical cancer cell (all p < 0.001). The mRNA expressions of IL-1? and IL-8 in cervical cancer cells cocultured with macrophages were increased, compared with those in cervical cancer cell cultured alone (pIL-1?  < 0.05 and pIL-8  < 0.01). Meanwhile, the mRNA expression of VEGF-C and VEGF-A was increased in macrophages cocultured with cervical cancer cells, compared with the expression in those macrophages cultured alone (both p < 0.05). Taken together, the results suggest that TAMs promote lymphangiogenesis mainly through interaction with surrounding cervical cancer cells.
Related JoVE Video
Activation of the epidermal growth factor receptor in macrophages regulates cytokine production and experimental colitis.
J. Immunol.
PUBLISHED: 01-03-2014
Show Abstract
Hide Abstract
Macrophages regulate innate immunity to maintain intestinal homeostasis and play pathological roles in intestinal inflammation. Activation of the epidermal growth factor receptor (EGFR) promotes cellular proliferation, differentiation, survival, and wound closure in several cell types. However, the impact of EGFR in macrophages remains unclear. This study was to investigate whether EGFR activation in macrophages regulates cytokine production and intestinal inflammation. We found that EGFR was activated in colonic macrophages in mice with dextran sulfate sodium (DSS)-induced colitis and in patients with ulcerative colitis. DSS-induced acute colitis was ameliorated, and recovery from colitis was promoted in Egfr(fl/fl)LysM-Cre mice with myeloid cell-specific deletion of EGFR, compared with LysM-Cre mice. DSS treatment increased IL-10 and TNF levels during the acute phase of colitis, and increased IL-10 but reduced TNF levels during the recovery phase in Egfr(fl/fl)LysM-Cre mice. An anti-IL-10 neutralizing Ab abolished these effects of macrophage-specific EGFR deletion on DSS-induced colitis in Egfr(fl/fl)LysM-Cre mice. LPS stimulated EGFR activation and inhibition of EGFR kinase activity enhanced LPS-stimulated NF-?B activation in RAW 264.7 macrophages. Furthermore, induction of IL-10 production by EGFR kinase-blocked RAW 264.7 cells, in response to LPS plus IFN-?, correlated with decreased TNF production. Thus, although selective deletion of EGFR in macrophages leads to increases in both pro- and anti-inflammatory cytokines in response to inflammatory stimuli, the increase in the IL-10 level plays a role in suppressing proinflammatory cytokine production, resulting in protection of mice from intestinal inflammation. These results reveal an integrated response of macrophages regulated by EGFR in intestinal inflammatory disorders.
Related JoVE Video
Adipose stem cells promote smooth muscle cells to secrete elastin in rat abdominal aortic aneurysm.
PLoS ONE
PUBLISHED: 01-01-2014
Show Abstract
Hide Abstract
Abdominal aortic aneurysm (AAA) is a life-threatening disease and its prevalence rate increases with social aging. The degradation of elastic is an important factor in the formation of AAA.
Related JoVE Video
Peroxisome proliferator-activated receptor ? activation induces hepatic steatosis, suggesting an adverse effect.
PLoS ONE
PUBLISHED: 01-01-2014
Show Abstract
Hide Abstract
Non-alcoholic fatty liver disease (NAFLD) is characterized by hepatic triglyceride accumulation, ranging from steatosis to steatohepatitis and cirrhosis. NAFLD is a risk factor for cardiovascular diseases and is associated with metabolic syndrome. Antihyperlipidemic drugs are recommended as part of the treatment for NAFLD patients. Although fibrates activate peroxisome proliferator-activated receptor ? (PPAR?), leading to the reduction of serum triglyceride levels, the effects of these drugs on NAFLD remain controversial. Clinical studies have reported that PPAR? activation does not improve hepatic steatosis. In the present study, we focused on exploring the effect and mechanism of PPAR? activation on hepatic triglyceride accumulation and hepatic steatosis. Male C57BL/6J mice, Ppar?-null mice and HepG2 cells were treated with fenofibrate, one of the most commonly used fibrate drugs. Both low and high doses of fenofibrate were administered. Hepatic steatosis was detected through oil red O staining and electron microscopy. Notably, in fenofibrate-treated mice, the serum triglyceride levels were reduced and the hepatic triglyceride content was increased in a dose-dependent manner. Oil red O staining of liver sections demonstrated that fenofibrate-fed mice accumulated abundant neutral lipids. Fenofibrate also increased the intracellular triglyceride content in HepG2 cells. The expression of sterol regulatory element-binding protein 1c (SREBP-1c) and the key genes associated with lipogenesis were increased in fenofibrate-treated mouse livers and HepG2 cells in a dose-dependent manner. However, the effect was strongly impaired in Ppar?-null mice treated with fenofibrate. Fenofibrate treatment induced mature SREBP-1c expression via the direct binding of PPAR? to the DR1 motif of the SREBP-1c gene. Taken together, these findings indicate the molecular mechanism by which PPAR? activation increases liver triglyceride accumulation and suggest an adverse effect of fibrates on the pathogenesis of hepatic steatosis.
Related JoVE Video
Inhibition of baicalin on metabolism of phenacetin, a probe of CYP1A2, in human liver microsomes and in rats.
PLoS ONE
PUBLISHED: 01-01-2014
Show Abstract
Hide Abstract
Baicalin has been used as mainly bioactive constituent of about 100 kinds of traditional Chinese medicines in Chinese pharmacopoeia. The effect of baicalin on cytochrome P450 should be paid more attention because baicalin was used widely. The aim of this study was to investigate whether baicalin could inhibit CYP1A2 in pooled human liver microsomes (HLMs) and in rats in vivo and the gene polymorphisms could affect inter-individual variation in IC50 in 28 human livers. Phenacetin was used as probe of CYP1A2. Kinetic parameter of CYP1A2 and IC50 of baicalin on CYP1A2 to each sample were measured and the common CYP1A2 polymorphisms (-3860G>A and -163C>A) were genotyped. The results showed that baicalin exhibited a mixed-type inhibition in pooled HLMs, with a Ki value of 25.4 µM. There was substantial variation in Km, Vmax, CLint of CYP1A2 and IC50 of baicalin on CYP1A2 (3?10-fold). The range was from 26.6 to 114.8 µM for Km, from 333 to 1330 pmol·min(-1)·mg(-1)protein for Vmax and from 3.8 to 45.3 µL·min(-1)·mg(-1) protein for CLint in HLMs (n?=?28). The Mean (range) value of IC50 in 28 HLMs was 36.3 (18.9 to 56.1) µM. The genotypes of -3860G>A and -163C>A had no significant effect on the inhibition of baicalin on CYP1A2. The animal experiment results showed that baicalin (450 mg/kg, i.v.) significantly decreased the Cmax and CL of phenacetin, and increased C(60 min), t1/2, Vd and AUC (P<0.05). There were significant correlations between percentage of control in C(60 min), t1/2, CL, AUC of phenacetin and Cmax of baicalin in 11 rats (P<0.05). Protein binding experiments in vitro showed that baicalin (0-2000 mg/L) increased the unbound phenacetin from 14.5% to 28.3%. In conclusion, baicalin can inhibit the activity of CYP1A2 in HLMs and exhibit large inter-individual variation that has no relationship with gene polymorphism. Baicalin can change the pharmacokinetics of phenacetin in rats.
Related JoVE Video
Characterization of a novel hemolytic activity of human IgG fractions arising from diversity in protein and oligosaccharide components.
PLoS ONE
PUBLISHED: 01-01-2014
Show Abstract
Hide Abstract
Human IgG is a well-established multifunctional antigen specific immunoglobulin molecule of the adaptive immune system. However, an antigen nonspecific immunological function of human IgG has never been reported. In this study, human IgG was isolated using ammonium sulfate fractional precipitation and diethylaminoethanol (DEAE) cellulose 52 ion exchange chromatography, from which h-IgG and hs-IgG fractions were purified on the basis of their differential binding to rabbit anti-shrimp hemocyanin antibody (h) and rabbit anti-shrimp hemocyanin's small subunit antibody (hs), respectively. We found that h-IgG had a higher hemolytic activity than hs-IgG against erythrocytes from humans, rabbits, mice and chickens, whereas the control IgG showed negligible activity. h-IgG could interact directly with erythrocyte membranes, and this interaction was suppressed by high molecular weight osmoprotectants, showing that it may follow a colloid-osmotic mechanism. In comparative proteomics and glycomics studies, h-IgG and hs-IgG yielded 20 and 5 significantly altered protein spots, respectively, on a 2-D gel. The mean carbohydrate content of h-IgG and hs-IgG was approximately 3.6- and 2-fold higher than that of IgG, respectively, and the ?-d-mannose/?-d-glucose content was in the order of h-IgG>hs-IgG>IgG. In this study, a novel antigen nonspecific immune property of human IgG was investigated, and the diversity in the protein constituents and glycosylation levels may have functional signficance.
Related JoVE Video
Therapeutic drug monitoring of psychotropic drugs in china: a nationwide survey.
Ther Drug Monit
PUBLISHED: 11-23-2013
Show Abstract
Hide Abstract
To understand the status of therapeutic drug monitoring (TDM) of psychotropic drugs in psychiatric facilities in mainland China and to lay the foundation for improvement of TDM in psychiatry.
Related JoVE Video
[Correlation of ¹?F-FDG uptake with tumor-proliferating antigen Ki-67 expression in aggressive lymphoma].
Zhonghua Zhong Liu Za Zhi
PUBLISHED: 09-24-2013
Show Abstract
Hide Abstract
To investigate the correlation between ¹?F-FDG uptake in positron emission tomography/computed tomography imaging and tumor-proliferating antigen Ki-67 expression in aggressive lymphoma.
Related JoVE Video
Solution Structure of Energy Stored System I: Aqua-B(OH)4(-): A DFT, Car-Parrinello Molecular Dynamics, and Raman Study.
J Phys Chem B
PUBLISHED: 09-23-2013
Show Abstract
Hide Abstract
A systematic study on the structure, stability, and Raman spectra of the metaborate anion hydrated clusters, B(OH)4(-)(H2O)n, (n = 1-15) was carried out by DFT in both gaseous and aqueous phase at the B3LYP/aug-cc-pVDZ level; all of these stable configurations were described, and the most stable hydrated clusters were chosen. The hydrogen bonds in those hydrated clusters were described in three different items: symmetrical double hydrogen bonding (DHB), single hydrogen bonding (SHB), and interwater hydrogen bonding (WHB). The distance of SHB is shorter than that of DHB, and multiple SHBs are more stable than a single DHB. In small size clusters (n ? 5), a structure with more DHBs is more stable than other arrangements. With continued increase in size, more SHBs were found in the first hydration sphere: when n ? 9, only SHBs can be found, and when n ? 12, a full hydration structure is formed with 12 SHBs and a hydration number of 10-12. The Car-Parrinello molecular dynamics simulation shows that only the first hydration sphere can be found, and the hydration number of B(OH)4(-) is 9.2 and the hydration distance is 3.68. The total symmetrical stretching vibration of B(OH)4(-) in hydrated B(OH)4(-)(H2O)n is blue shifted with increasing cluster size. After consideration of hydration, the calculated characteristic frequencies are in accord with the experiment characteristic frequency of B(OH)4(-).
Related JoVE Video
A Lactobacillus rhamnosus GG-derived soluble protein, p40, stimulates ligand release from intestinal epithelial cells to transactivate epidermal growth factor receptor.
J. Biol. Chem.
PUBLISHED: 09-16-2013
Show Abstract
Hide Abstract
p40, a Lactobacillus rhamnosus GG (LGG)-derived soluble protein, ameliorates intestinal injury and colitis, reduces apoptosis, and preserves barrier function by transactivation of the EGF receptor (EGFR) in intestinal epithelial cells. The aim of this study is to determine the mechanisms by which p40 transactivates the EGFR in intestinal epithelial cells. Here we show that p40-conditioned medium activates EGFR in young adult mouse colon epithelial cells and human colonic epithelial cell line, T84 cells. p40 up-regulates a disintegrin and metalloproteinase domain-containing protein 17 (ADAM17) catalytic activity, and broad spectrum metalloproteinase inhibitors block EGFR transactivation by p40 in these two cell lines. In ADAM17-deficient mouse colonic epithelial (ADAM17(-/-) MCE) cells, p40 transactivation of EGFR is blocked, but can be rescued by re-expression with WT ADAM17. Furthermore, p40 stimulates release of heparin binding (HB)-EGF, but not transforming growth factor (TGF)? or amphiregulin, in young adult mouse colon cells and ADAM17(-/-) MCE cells overexpressing WT ADAM17. Knockdown of HB-EGF expression by siRNA suppresses p40 effects on transactivating EGFR and Akt, preventing apoptosis, and preserving tight junction function. The effects of p40 on HB-EGF release and ADAM17 activation in vivo are examined after administration of p40-containing pectin/zein hydrogel beads to mice. p40 stimulates ADAM17 activity and EGFR activation in colonic epithelial cells and increases HB-EGF levels in blood from WT mice, but not from mice with intestinal epithelial cell-specific ADAM17 deletion. Thus, these data define a mechanism of a probiotic-derived soluble protein in modulating intestinal epithelial cell homeostasis through ADAM17-mediated HB-EGF release, leading to transactivation of EGFR.
Related JoVE Video
Direct visual evidence for chemical mechanism of SERRS of the S-complex of pyrimidine molecule adsorbed on silver nanoparticle via charge transfer.
Spectrochim Acta A Mol Biomol Spectrosc
PUBLISHED: 08-27-2013
Show Abstract
Hide Abstract
In this paper, the S-complex of pyrimidine molecule absorbed on silver clusters was employed as a model molecule to study the enhancement mechanism in surface-enhanced resonance Raman scattering (SERRS). We described the chemical enhancement of SERRS through charge transfer (CT) from Ag20 to pyrimidine on resonance excitation, and electromagnetic enhancement through intracluster charge redistribution (CR) on the electronic intracluster collective oscillation excitation. It is shown that SERRS process of the pyrimidine molecule absorbed on silver clusters with different incident wavelength are dominated by different enhancement mechanisms. Both experimental and theoretical works have been performed to understand the CT process in SERRS.
Related JoVE Video
Alkaloids from corals.
Chem. Biodivers.
PUBLISHED: 08-14-2013
Show Abstract
Hide Abstract
Alkaloids, which are generally basic N-containing compounds, have been found in a variety of natural sources. Recently, the interest in alkaloids from corals increased significantly due to their remarkable bioactivities. This review deals with the chemical structures and biological activities of alkaloids in corals. The literature has been covered up to June 2011, and a total of 102 alkaloids from the 51 publications are discussed and reviewed. Some of these compounds showed various biological properties, such as cytotoxic, antibacterial, insecticidal, antifouling, and other activities.
Related JoVE Video
Pharmacokinetic changes of unbound theophylline are due to plasma protein binding displacement and CYP1A2 activity inhibition by baicalin in rats.
J Ethnopharmacol
PUBLISHED: 07-23-2013
Show Abstract
Hide Abstract
Baicalin is one of the major bioactive constituents of Scutellariae Radix, the root of Scutellariae baicalensis Georgi and possesses a wide variety of pharmacological properties.
Related JoVE Video
MSLoc-DT: A new method for predicting the protein subcellular location of multispecies based on decision templates.
Anal. Biochem.
PUBLISHED: 07-21-2013
Show Abstract
Hide Abstract
Revealing the subcellular location of newly discovered protein sequences can bring insight to their function and guide research at the cellular level. The rapidly increasing number of sequences entering the genome databanks has called for the development of automated analysis methods. Currently, most existing methods used to predict protein subcellular locations cover only one, or a very limited number of, species. Therefore, it is necessary to develop reliable and effective computational approaches to further improve the performance of protein subcellular prediction and, at the same time, cover more species. The present study reports the development of a novel predictor called MSLoc-DT to predict the protein subcellular locations of human, animal, plant, bacteria, virus, fungi and archaea by introducing a novel feature extraction approach termed Amino Acid Index Distribution (AAID) and then fusing gene ontology information, sequential evolutionary information and sequence statistical information through four different modes of pseudo amino acid composition (PseACC) with a decision template rule. Using the jackknife test, MSLoc-DT can achieve 86.5%, 98.3%, 90.3%, 98.5%, 95.9%, 98.1% and 99.3% overall accuracy for human, animal, plant, bacteria, virus, fungi and archaea, respectively, on seven stringent benchmark datasets. Compared with other predictors (e.g., Gpos-PLoc, Gneg-PLoc, Virus-PLoc, Plant-PLoc, Plant-mPLoc, ProLoc-Go, Hum-PLoc and GOASVM) on the Gram-positive dataset, Gram-negative dataset, Virus dataset, Plant dataset, Eukaryotic dataset and Human dataset, the new MSLoc-DT predictor is much more effective and robust. Although the MSLoc-DT predictor is designed to predict the single location of proteins, our method can be extended to multiple locations of proteins by introducing multilabel machine learning approaches, such as the support vector machine or deep learning, as substitutes for the K-Nearest Neighbor (KNN) method. As a user-friendly web server, MSLoc-DT is freely accessible at http://bioinfo.ibp.ac.cn/MSLOC_DT/index.html.
Related JoVE Video
[The clinical study of invasive fungal infection in 76 cases of hematologic diseases].
Zhonghua Nei Ke Za Zhi
PUBLISHED: 07-17-2013
Show Abstract
Hide Abstract
To investigate the risk factors, clinical features, efficacy and adverse reactions in patients of hematologic diseases with invasive fungal infections (IFI).
Related JoVE Video
Antioxidative capacity in the fat body of Bombyx mori is increased following oral administration of 4-methylumbelliferone.
Comp. Biochem. Physiol. C Toxicol. Pharmacol.
PUBLISHED: 07-12-2013
Show Abstract
Hide Abstract
Plant sources of umbelliferones have tumor-inhibitory effects at the cellular level. However, their physiological functions in animals are largely unresolved. In this study, we provide evidence to show that 4-methylumbelliferone (4-MU) participates in the regulation of antioxidative capacity in the fat body of Bombyx mori, a tissue similar to mammalian liver in this model invertebrate. Larvae (3rd day of the 5th instar) were orally exposed to 4mM 4-MU, an umbelliferone, which swiftly induced the generation of a large number of ROS (e.g. H2O2 increased 6 to 8-fold), and 4-MU was detected in the fat body 8min after administration. In addition, the activities of CAT and GPx were up-regulated 4 to 11-fold and 2 to 16-fold, respectively, and were helpful in defending fat body cells against oxidative injury in combination with NADPH. Furthermore, significant increases in the contents of T-AOC (up to approx. 2-fold), antioxidants of ASAFR (by 2 to 4-fold) and GSH were detected.
Related JoVE Video
[Intrinsic section and its interception model for temporal pulse of THz-TDS].
Guang Pu Xue Yu Guang Pu Fen Xi
PUBLISHED: 07-12-2013
Show Abstract
Hide Abstract
Using THz-TDS to detect the THz temporal pulse and calculate the absorption spectrum of the sample is the main access to qualitative and quantitative analysis. The shape and the amplitude of the THz absorption spectra are not only related to the sample, but also closely related to the length of the chosen THz pulse in the calculation, which was discovered in our experiments. It is the main cause of this problem that the flaky sample reflects the THz wave many times, which will give rise to the Fabry-Perot effect. So the sample-probing temporal signal is divided into the intrinsic section with the samples information directly, low SNR noise section, and unwanted Fabry-Perot reflections section with the overlapped information. Based on THz pulse generation mechanism and the relationship between the pulse amplitude and the attenuate process, a model of intercepting the intrinsic section in terahertz time-domain pulse was proposed and was proved reliable and stable by the results from experiments performed with amino acids: glutamine(Gln), histidine(His), and cystine(Cys).
Related JoVE Video
[Clinical characteristics of CD56(+) patients with acute monocytic leukemia and their prognostic significance].
Zhongguo Shi Yan Xue Ye Xue Za Zhi
PUBLISHED: 07-03-2013
Show Abstract
Hide Abstract
This study was aimed to investigate the clinical features of CD56(+) patients with acute monocytic leukemia (AML-M5) and their prognositic significance. The data of 76 newly-diagnosed patients from our hospital were analyzed retrospetively. Patients were divided into two groups: CD56(+) group (21 patients) and CD56(-) group (55 patients). The clinical features, CR rate, relapse rate, the duration of CR, and survival time of patients between the two groups were compared. The results indicated that the CD56(+) antigen was observed in 21 patients (27.6%), their median age was 51.5 years and with a range 16 - 70 years. Of the 21 CD56(+) patients, the high WBC count was found in 57.1% CD56(+) patients (12/21), but it only in 15% CD56(-) patients (P < 0.05). The extramedullary infiltrantion was seen in 13 CD56(+) patients, and accounted for 62% (13/21), meanwhile this infiltrantion was found in 18 CD56(-) patients (18/55) and accounted for 33% (P < 0.05). All cases immunophenotypically highly expressed CD13, CD33, CD64, CD11b, cMPO, CD38, in which only the expression frequency of CD11b was positively related with CD56 (r = 0.59, P < 0.05). The CR rate in CD56(+) group accounted for 60.0%, and had no significant difference in comparision with that in CD56(-) group. In CD56(+) group the relapse rate was 75% (P = 0.042), the mean duration of CR was 5.5 months (95%CI, 3.1 - 8.6, P = 0.002), the median overall survival time was 10.1 months (95%CI, 2.3 - 16.3, P = 0.001). and all these had statistical significance as compared with that in CD56(-) group. It is concluded that CD56(+) AML-M5 patients always complicate with high WBC count and extramedullary infiltration, their CR rate and duration of CR are lower and shorter respectively, their relaps rate and prognosis are high and poor respectively.
Related JoVE Video
[Progress in molecular mechanisms of HBV reverse transcription].
Bing Du Xue Bao
PUBLISHED: 06-14-2013
Show Abstract
Hide Abstract
HBV infections leads to severe public health problems around the world, especially in China. Improved understanding of the molecular mechanisms of HBV reverse transcription is fundamental for optimization of treatment and solution to drug-resistance. Recently, the main structural basis involved in the process of HBV reverse transcription and the cis-elements were revealed by means of biochemistry and genetics. The entire process of reverse transcription is completed mainly through the first template switch mediated by the P- epsilon structure; the second template switch mediated by 5E/3E and M structure; and the third template switch mediated by 5 r / 3 r structure. The important structure and the cis-elements involved in this process are the focus of this review, at the same time, an overview of the progress in relevent studies is demonstrated to show the whole picture of the HBV reverse process.
Related JoVE Video
Induction of COX-2 expression by Helicobacter pylori is mediated by activation of epidermal growth factor receptor in gastric epithelial cells.
Am. J. Physiol. Gastrointest. Liver Physiol.
PUBLISHED: 05-16-2013
Show Abstract
Hide Abstract
Chronic infection of the gastric mucosa by Helicobacter pylori is associated with an increased risk of developing gastric cancer; however, the vast majority of infected individuals never develop this disease. One H. pylori virulence factor that increases gastric cancer risk is the cag pathogenicity island, which encodes a bacterial type IV secretion system. Cyclooxygenase-2 (COX-2) expression is induced by proinflammatory stimuli, leading to increased prostaglandin E? (PGE?) secretion by gastric epithelial cells. COX-2 expression is increased in gastric tissue from H. pylori-infected persons. H. pylori also activates the epidermal growth factor receptor (EGFR) in gastric epithelial cells. We now demonstrate that H. pylori-induced activation of COX-2 in gastric cells is dependent upon EGFR activation, and that a functional cag type IV secretion system and direct bacterial contact are necessary for full induction of COX-2 by gastric epithelial cells. PGE? secretion is increased in cells infected with H. pylori, and this induction is dependent on a functional EGFR. Increased apoptosis in response to H. pylori occurs in cells treated with a COX-2 inhibitor, as well as COX-2-/- cells, indicating that COX-2 expression promotes cell survival. In vivo, COX-2 induction by H. pylori is significantly reduced in mice deficient for EGFR activation compared with wild-type mice with a fully functional receptor. Collectively, these findings indicate that aberrant activation of the EGFR-COX-2 axis may lower the threshold for carcinogenesis associated with chronic H. pylori infection.
Related JoVE Video
Enhanced transparent conductive properties of graphene/carbon nano-composite films.
J Nanosci Nanotechnol
PUBLISHED: 05-08-2013
Show Abstract
Hide Abstract
Transparent conductive graphene/carbon nano-composite films are produced based on graphene oxide (GO) sheets and phenolic resins that are layer-by-layer deposited on a quartz substrate using a spin coating technique. The graphene/carbon nano-composite films with high graphitization degree and high crystallization exhibit exceptionally high electrical conductivity and transparency after thermal reduction. A remarkable sheet resistance of 1.98 komega/square at 81.3% transparency in the wavelength of 550 nm is obtained, which significantly outperforms that (3.29 komega/square at 81.7% transparency) of the film produced from pure GO sheets after thermal reduction.
Related JoVE Video
XAV939, a tankyrase 1 inhibitior, promotes cell apoptosis in neuroblastoma cell lines by inhibiting Wnt/?-catenin signaling pathway.
J. Exp. Clin. Cancer Res.
PUBLISHED: 05-04-2013
Show Abstract
Hide Abstract
Neuroblastoma (NB) is the most common extracranial solid tumor in childhood. The present treatment including surgery, chemotherapy and radiation, which have only 40% long-term cure rates, and usually cause tumor recurrence. Thus, looking for new effective and less toxic therapies has important significance. XAV939 is a small molecule inhibitor of tankyrase 1(TNKS1). The objective of this study is to investigate the effect of XAV939 on the proliferation and apoptosis of NB cell lines, and the related mechanism.
Related JoVE Video
[Correlation of chromosome karyotype with dyshaematopoiesis and reticulin in myelodysplastic syndrome].
Zhongguo Shi Yan Xue Ye Xue Za Zhi
PUBLISHED: 05-01-2013
Show Abstract
Hide Abstract
This study was purposed to explore the correlation of chromosome karyotype with dyshaematopoiesis and reticulin in myelodysplastic syndrome (MDS). The data of 202 MDS patients diagnosed and treated in the First Affiliated Hospital of Zhengzhou University were retrospectively analyzed in term of chromosome karyotype, dyshaematopoiesis and reticulin detection results. The chromosome karyotypes were categorized according to the International Prognostic Scoring System (IPSS). The results showed that there was a positive correlation between chromosome karyotype grading and number of lineages with dyshaematopoiesis (r = 0.443, P < 0.05). The detected rates of multilineage dyshaematopoiesis in patients with good, intermediate and poor chromosome karyotypes were 44.4%, 71.4% and 96.3% respectively. There was a positive correlation between chromosome karyotype grading and reticulin grading (r = 0.451, P < 0.05). The positive rates of reticulin in patients with good grading, intermediate and poor chromosome karyotypes were 36.8%, 64.3% and 92.6% respectively. The detected rate of multilineage dyshaematopoiesis, number of lineages with dyshaematopoiesis, the positive rate of reticulin and reticulin grade in patients with poor karyotypes were higher than those in patients with intermediate or good chromosome karyotypes (separately P < 0.01). The above data in patients with intermediate chromosome karyotypes were higher than those in patients with good chromosome karyotypes (separately P < 0.01). It is concluded that the chromosome karyotype grading positively correlates with the number of lineages with dyshaematopoiesis and reticulin grading. When the chromosome karyotype changed from good to poor, the detected rate of multilineage dyshaematopoiesis, number of lineages with dyshaematopoiesis, positive rate of reticulin and reticulin grading became higher and higher.
Related JoVE Video
[Dynamically monitoring minimal residual disease in acute leukemia after complete remission by multiparameter flow cytometry and its relation with prognosis].
Zhongguo Shi Yan Xue Ye Xue Za Zhi
PUBLISHED: 05-01-2013
Show Abstract
Hide Abstract
This study was purposed to investigate the dynamically monitoring minimal residual disease (MRD) by flow cytometry (FCM) in patients with acute leukemia (AL) after complete remission and its relation with prognosis. From October 2010 to May 2012, 58 cases of AL (including 45 cases of AML and 13 cases of ALL) were regularly monitored for MRD in bone marrow by FCM and their bone marrow morphology was observed by light microscopy at the same time which continued to relapse or to follow-up deadline in the Department of Hematology, the First Affiliated Hospital of Zhengzhou University. Through average follow-up for 9 months (3 - 21 months), the average MRD level of patients with CR was got. And the prognostic value of MRD level at different time points in AL patients after CR was analysed and summarized. MRD ? 1% was defined as positive, otherwise, as negative. The results showed that the maximum and minimum MRD levels of 45 AML patients were 9.57% and 0.01% respectively, the average was 0.67%; the maximum and minimum MRD levels of 13 cases of ALL patients were 7.9% and 0.0016% respectively, the average was 0.99%. Among 44 cases after induction therapy, the relapse rate of MRD(+) group was 53.3% (8/15), the relapse rate of MRD(-) group was 10.3% (3/29), and the relapse rate of MRD(+) group was higher than that of MRD(-) group (?(2) = 7.58, P = 0.006). Among 58 cases after the first consolidatory therapy, the relapse rate of MRD(+) group was 62.5% (5/8), the relapse rate of MRD(-) group was 16.0% (8/50), and the relapse rate of MRD(+) group was higher than that of MRD(-) group (?(2) = 6.11, P = 0.013). It is concluded that MRD detected by FCM has a large range (10(-6) - 10(-2)), which can not be used as a single indicator of complete remission. When MRD ? 1% after induction therapy and the first consolidatory therapy, the relapse rate significantly increases, MRD can be used as a sensitive indicator for prognosis.
Related JoVE Video
Chemopreventive effects of berberine on intestinal tumor development in Apcmin/+ mice.
BMC Gastroenterol
PUBLISHED: 04-22-2013
Show Abstract
Hide Abstract
Berberine, an isoquinoline alkaloid, has shown inhibitory effects on growth of several tumor cell lines in vitro. The aim of this study was to investigate chemopreventive effects of berberine on intestinal tumor development in Apcmin/+ mice.
Related JoVE Video
Immunotherapy with Cytokine-Induced Killer Cells as an Adjuvant Treatment for Advanced Gastric Carcinoma: A Retrospective Study of 165 Patients.
Cancer Biother. Radiopharm.
PUBLISHED: 03-18-2013
Show Abstract
Hide Abstract
Abstract Background: Cytokine-induced killer (CIK) cells have demonstrated antitumor effects in vitro and in vivo. The purpose of this study was to evaluate the effect of CIK cell treatment as an adjuvant immunotherapy on the prognosis of gastric carcinoma in patients after surgery. Methods: The patients with stage II-III gastric carcinoma after gastrectomy, including 53 patients receiving autologous CIK cell treatment combined with chemotherapy (CIK group) and 112 patients in the corresponding period receiving chemotherapy alone (control group), were retrospectively studied. The patients in the CIK group were matched to those in the control group regarding the sex and age of patients, tumor site, histological type, pathological grade, tumor size, clinical stage, and chemotherapy plan. Progression-free survival (PFS) and overall survival (OS) were evaluated. Results: The 5-year OS rate in the CIK group was significantly improved compared to that in the control group (56.6% vs. 26.8%, p=0.014). The 5-year PFS rate in the CIK group was also significantly improved compared to that in the control group (49.1% vs. 24.1%, p=0.026). The median PFS (36.0 months) and OS (96.0 months) in the CIK group were significantly prolonged than those in the control group (23.0 months for median PFS and 32.0 months for median OS, p=0.028 and p=0.003). No serious side effect was observed in the CIK group. Conclusions: This study suggests that immunotherapy with CIK cells may serve as an adjuvant treatment to prolong the survival of patients with stage II-III gastric carcinoma.
Related JoVE Video
[Expression of ILK and PKB/Akt in acute leukemia and its significance].
Zhongguo Shi Yan Xue Ye Xue Za Zhi
PUBLISHED: 03-15-2013
Show Abstract
Hide Abstract
The aim of this study was to investigate the expression of integrin linked kinase (ILK) and protein kinase B (PKB/Akt) in acute leukemia (AL), explore the possible effects of ILK/Akt pathway on AL pathogenesis. The expression level of ILK mRNA and Akt mRNA in different types and stages of AL bone marrow mononuclear cells was detected by reverse transcription polymerase chain reaction (RT-PCR). The results showed that the expression of ILK and Akt in do nove AL group was higher than that in AL-CR group and normal control group (P < 0.05), while there was no statistically difference between de nove AL and relapsed AL groups (P > 0.05). The expression of ILK positively correlates with Akt expression in de nove AL group (P < 0.05). It is concluded that the expression of ILK and Akt mRNA is abnormally higher in AL, ILK/Akt pathway may be involved in the pathogenesis and progression of AL and may be a potential therapeutic target for AL.
Related JoVE Video
New quantitative trait loci for carotid atherosclerosis identified in an intercross derived from apolipoprotein E-deficient mouse strains.
Physiol. Genomics
PUBLISHED: 03-05-2013
Show Abstract
Hide Abstract
Carotid atherosclerosis is the primary cause of ischemic stroke. To identify genetic factors contributing to carotid atherosclerosis, we performed quantitative trait locus (QTL) analysis using female mice derived from an intercross between C57BL/6J (B6) and BALB/cJ (BALB) apolipoprotein E (Apoe(-/-)) mice. We started 266 F(2) mice on a Western diet at 6 wk of age and fed them the diet for 12 wk. Atherosclerotic lesions in the left carotid bifurcation and plasma lipid levels were measured. We genotyped 130 microsatellite markers across the entire genome. Three significant QTLs, Cath1 on chromosome (Chr) 12, Cath2 on Chr5, and Cath3 on Chr13, and four suggestive QTLs on Chr6, Chr9, Chr17, and Chr18 were identified for carotid lesions. The Chr6 locus replicated a suggestive QTL and was named Cath4. Six QTLs for HDL, three QTLs for non-HDL cholesterol, and three QTLs for triglyceride were found. Of these, a significant QTL for non-HDL on Chr1 at 60.3 cM, named Nhdl13, and a suggestive QTL for HDL on ChrX were new. A significant locus for HDL (Hdlq5) was overlapping with a suggestive locus for carotid lesions on Chr9. A significant correlation between carotid lesion sizes and HDL cholesterol levels was observed in the F(2) population (R = -0.153, P = 0.0133). Thus, we have identified several new QTLs for carotid atherosclerosis and the locus on Chr9 may exert effect through interactions with HDL.
Related JoVE Video
[Mechanism study on intestinal motility of reconstruction procedures after total gastrectomy].
Zhonghua Wei Chang Wai Ke Za Zhi
PUBLISHED: 03-01-2013
Show Abstract
Hide Abstract
To investigate the mechanism of reconstruction procedures affecting intestinal motility after total gastrectomy.
Related JoVE Video
Myeloid-derived suppressor cells suppress antitumor immune responses through IDO expression and correlate with lymph node metastasis in patients with breast cancer.
J. Immunol.
PUBLISHED: 02-25-2013
Show Abstract
Hide Abstract
Myeloid-derived suppressor cells (MDSCs) represent heterogeneous immunosuppressive cells in multiple cancer types and display potent immunosuppressive activity on T cells. We have shown the increased expression of IDO in breast cancer. Because IDO plays a pivotal role in immune tolerance via suppressing T cell function, the aim of this study was to investigate the expression of IDO in MDSCs in breast cancer and its role in MDSC-mediated inhibition of immune surveillance. The proportion of MDSCs with the phenotype of CD45(+)CD13(+)CD33(+)CD14(-)CD15(-) significantly increased in primary cancer tissues and patients peripheral blood. IDO expression was significantly upregulated in MDSCs isolated from fresh breast cancer tissues (fresh MDSCs [fMDSCs]), which correlated with increased infiltration of Foxp3(+) regulatory T cells in tumors and lymph node metastasis in patients. fMDSCs inhibited IL-2 and anti-CD3/CD28 mAb-induced T cell amplification and Th1 polarization but stimulated apoptosis in T cells in an IDO-dependent manner. CD33(+) progenitors isolated from healthy donors umbilical cord blood were cocultured with breast cancer cell line MDA-MB-231 cells to induce MDSCs. IDO expression was upregulated in induced MDSCs, which required phosphorylation of STAT3, but not STAT1. IDO was required for induced MDSCs immunosuppressive activity on T cells, which was blocked by IDO inhibitor 1-methyl-L-tryptophan or STAT3 antagonist JSI-124. Consistently, increased STAT3 phosphorylation level was found in fMDSCs. Together, our findings suggest that STAT3-dependent IDO expression mediates immunosuppressive effects of MDSCs in breast cancer. Thus, inhibition of MDSC-induced T cell suppression by blocking IDO may represent a previously unrecognized mechanism underlying immunotherapy for breast cancer.
Related JoVE Video

What is Visualize?

JoVE Visualize is a tool created to match the last 5 years of PubMed publications to methods in JoVE's video library.

How does it work?

We use abstracts found on PubMed and match them to JoVE videos to create a list of 10 to 30 related methods videos.

Video X seems to be unrelated to Abstract Y...

In developing our video relationships, we compare around 5 million PubMed articles to our library of over 4,500 methods videos. In some cases the language used in the PubMed abstracts makes matching that content to a JoVE video difficult. In other cases, there happens not to be any content in our video library that is relevant to the topic of a given abstract. In these cases, our algorithms are trying their best to display videos with relevant content, which can sometimes result in matched videos with only a slight relation.