يهدف هذا البروتوكول إلى عزل mRNAs الريبوسومية المترجمة الخاصة بنوع الخلية باستخدام نموذج الماوس NuTRAP.
Method Article
Access restricted. Please log in or start a trial to view this content.
Access restricted. Please log in or start a trial to view this content.
Access restricted. Please log in or start a trial to view this content.
Access restricted. Please log in or start a trial to view this content.
Access restricted. Please log in or start a trial to view this content.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| Actb< / em> | eurofins | qPCR بادئات | ATGGAGGGGAATACAGCCC / TTCTTTTTGCAGCTCCTTCGTT (برايمر أمامي / برايمر عكسي) |
| Bioanalyzer | Agilent | 2100 Bioanalyzer Instrument | |
| cOmplete Mini خالي من EDTA مثبط البروتياز كوكتيل | ميليبور | 11836170001 | |
| cycloheximide | Millipore | 239764-100MG | |
| Cyp11a1< / em> | eurofins | qPCR بادئات | CTGCCTCCAGACTTCTTTCG / TTCTTGAAGGGCAGCTTGTT (برايمر أمامي / برايمر عكسي) |
| dNTP | Thermo Fisher Scientific | R0191 | |
| DTT ، Dithiothreitol | Thermo Fisher Scientific | P2325 | |
| DynaMag-2 مغناطيس | Thermo Fisher Scientific | 12321D | |
| أنابيب فالكون 15 مل | VWR | 89039-666 | |
| GFP الأجسام المضادة | Abcam | ab290 | |
| مجموعة المطحنة الزجاجية | DWK Life Sciences | 357542 | |
| الهيبارين | BEANTOWN CHEMICAL | 139975-250MG | |
| em>Hsd3b< / em> | eurofins | qPCR بادئات | GACAGGAGCAGGGGTTTGTG / CACTGGGCATCCAGAATGTCTC (التمهيدي الأمامي / التمهيدي العكسي) |
| KCl | Biosciences | R005 | |
| MgCl 2< / sub> | Biosciences | R004 | |
| أنابيب الطرد المركزي الدقيقة 2 مل | Thermo Fisher Scientific | 02-707-354 | |
| Mouse Clariom S Assay Microarrays | Thermo Fisher Scientific | Microarray service | |
| NP-40 | Millipore | 492018-50 Ml | |
| oligo (dT) 20 | Invitrogen | 18418020 | |
| PicoPure RNA Isolation | Kit Thermo Fisher Scientific | KIT0204 | |
| Protein G Dynabead | Thermo Fisher Scientific | 10003D | |
| RNase خالية | خلايا الزراعة | المائية NUPW-0500 | |
| RNaseOUT مثبط ريبونوكلياز المؤتلف | الحراري فيشر Scientific | 10777019 | |
| Sox9< / em> | eurofins | qPCR الاشعال | TGAAGAACGGACAAGCGGAG / CTGAGATTGCCCAGAGTGCT (التمهيدي الأمامي / التمهيدي العكسي |
| Superscript IV النسخ العكسي | Invitrogen | 18090050 | |
| SYBR Green PCR Master Mix | Thermo Fisher Scientific | 4309155 | |
| Sycp3< / em> | eurofins | qPCR primers | GAATGTGTTGCAGCAGTGGGA / GAACTGCTCGTGTGTGTGTGTGTGTTTGGTA (برايمر أمامي / برايمر عكسي) |
| تريس | ألفا إيسار | J62848 |
Access restricted. Please log in or start a trial to view this content.
Request permission to reuse the text or figures of this JoVE article
Request Permission