Summary
The present protocol describesa comprehensive strategy for evaluating the pharmacological action and mechanism of salidroside in inhibiting MCF-7 cell proliferation and migration.
Abstract
Salidroside (Sal) contains anti-carcinogenic, anti-hypoxic, and anti-inflammatory pharmacological activities. However, its underlying anti-breast cancer mechanisms have been only incompletely elucidated. Hence, this protocol intended to decode the potential of Sal in regulating the PI3K-AKT-HIF-1α-FoxO1 pathway in the malignant proliferation of human breast cancer MCF-7 cells. First, the pharmacological activity of Sal against MCF-7 was evaluated by CCK-8 and cell scratch assays. Moreover, the resistance of MCF-7 cells was measured by migration and Matrigel invasion assays. For cell apoptosis and cycle assays, MCF-7 cells were processed in steps with annexin V-FITC/PI and cell cycle-staining detection kits for flow cytometry analyses, respectively. The levels of reactive oxygen species (ROS) and Ca2+ were examined by DCFH-DA and Fluo-4 AM immunofluorescence staining. The activities of Na+-K+-ATPase and Ca2+-ATPase were determined using the corresponding commercial kits. The protein and gene expression levels in apoptosis and the PI3K-AKT-HIF-1α-FoxO1 pathway were further determined using western blot and qRT-PCR analyses, respectively. We found that Sal treatment significantly restricted the proliferation, migration, and invasion of MCF-7 cells with dose-dependent effects. Meanwhile, Sal administration also dramatically forced MCF-7 cells to undergo apoptosis and cell cycle arrest. The immunofluorescence tests showed that Sal observably stimulated ROS and Ca2+ production in MCF-7 cells. Further data confirmed that Sal promoted the expression levels of pro-apoptotic proteins, Bax, Bim, cleaved caspase-9/7/3, and their corresponding genes. Consistently, Sal intervention prominently reduced the expression of the Bcl-2, p-PI3K/PI3K, p-AKT/AKT, mTOR, HIF-1α, and FoxO1 proteins and their corresponding genes. In conclusion, Sal can be used as a potential herb-derived compound for treating breast cancer, as it may reduce the malignant proliferation, migration, and invasion of MCF-7 cells by inhibiting the PI3K-AKT-HIF-1α-FoxO1 pathway.
Introduction
As one of the most commonly diagnosed cancers and most common malignancies, the latest statistics indicate that 2.3 million cases of breast cancer emerged around the world by 2020, accounting for 11.7% of all cancer cases1. Common symptoms of breast cancer include breast tenderness and tingling, breast lumps and pain, nipple discharge, erosion or sunken skin, and enlarged axillary lymph nodes1,2. Even more alarming, the number of new cases and the overall incidence of breast cancer continues to increase at an overwhelming rate each year, accounting for 6.9% of cancer-related deaths1. At present, breast cancer intervention still mainly involves chemotherapy, surgery, radiotherapy, and comprehensive treatment. Although treatment can effectively reduce the recurrence rate and mortality rate of patients, long-term treatment application often causes produce multidrug resistance, large-area hair loss, nausea and vomiting, and serious mental and psychological burden2,3. Notably, the potential risk of multiple organ metastases from breast cancer also forces people to seek novel herbal sources of drug therapy4,5.
Phosphoinositide 3 kinase (PI3K)-mediated signaling is implicated in the growth, proliferation, and survival of breast cancer through splicing that affects the expression of multiple genes6. As a downstream signal-sensing protein of PI3K, numerous evidence suggests that protein kinase B (AKT) could couple with the mammalian target of rapamycin (mTOR) protein to further increase breast cancer7,8,9. Moreover, the deactivation of PI3K/AKT/mTOR signaling has also been claimed to be a key component in drugs inhibiting malignant proliferation and stimulating apoptosis in breast cancer10,11,12. It is well known that extreme hypoxia in the tumor microenvironment forces a massive surge in hypoxia-inducible factor 1 alpha (HIF-1α), which further worsens the progression of breast cancer13,14,15. In parallel, AKT stimulation also leads to excessive accumulation of HIF-1α, limiting apoptosis in breast cancer samples16,17. Interestingly, the activation of PI3K-AKT-HIF-1α signaling has been confirmed to be involved in pathologic progression and metastasis in a variety of cancers, including lung cancer18, colorectal cancer19, ovarian cancer20, and prostate cancer21. In addition to being orchestrated by HIF-1α, forked head transcription factor 1 (FoxO1) overexpression is also triggered by AKT signaling stimulation, which promotes cycle arrest and the inhibition of apoptosis in breast cancer cells22,23. Together, the above solid evidence suggests that the inhibition of the cascade of PI3K-AKT-HIF-1α-FoxO1 signaling may be a potential novel target for drug therapy in breast cancer.
Salidroside (Sal) has been widely demonstrated to exert anti-cancer24,25, anti-hypoxia26,27,28,29, and immune-enhancing pharmacological activities30. It is a light brown or brown powder that is easily soluble in water, is a type of phenylethanoid glycoside, and has a chemical structure formula of C14H20O7 and a molecular weight of 300.331,32. Modern pharmacological investigations have demonstrated that Sal can promote the apoptosis of gastric cancer cells by restraining PI3K-AKT-mTOR signaling24. Further evidence also suggests that the suppression of PI3K-AKT-HIF-1α signaling by Sal treatment may contribute to the apoptosis of cancer cells by enhancing their sensitivity to chemotherapeutic agents25. Evidence also suggests that Sal restricts cell migration and invasion and causes cycle arrest by promoting apoptosis in the human breast cancer MCF-7 cells33,34. However, it remains to be seen whether Sal can regulate PI3K-AKT-HIF-1α-FoxO1 signaling and inhibit the malignant proliferation of MCF-7 cells. Therefore, this protocol aimed to explore the effects of Sal on MCF-7 cell migration, invasion, cell cycle, and apoptosis via the PI3K-AKT-HIF-1α-FoxO1 pathway. The integrated research strategies comprising conventional, low-cost, and independent experiments, such as cell migration and invasion assessments, apoptosis and cell cycle detection by flow cytometry, reactive oxygen species (ROS) and Ca2+ fluorescence determination, etc., can provide a reference for the overall design of experiments for anti-cancer research with traditional herbal medicine. The experimental process of this study is shown in Figure 1.
Subscription Required. Please recommend JoVE to your librarian.
Protocol
The MCF-7 cells used for the present study were obtained from a commercial source (see the Table of Materials).
1. Cell culture
- Culture the MCF-7 cells in a humidified 5% CO2 atmosphere at 37 °C with DMEM containing 10% FBS and 1% penicillin (10,000 U/mL)/streptomycin (10,000 µg/mL) (see the Table of Materials).
NOTE: The cells covering 90% of the bottom of the dish were employed for the experiment and assigned into the following groups: control group, doxorubicin hydrochloride group (DXR, 5 µM), and Sal groups (20 µM, 40 µM, and 80 µM), or control group, LY294002 (10 µM, an inhibitor of PI3K) group, Sal (80 µM) group, and LY294002 (10 µM) + Sal (80 µM) group (see the Table of Materials).
2. Cell viability assay
NOTE: For details on this procedure, please refer to a previous report27.
- Seed MCF-7 cells with a density of 8 x 104 cells/well in 96-well plates, and incubate with Sal (10 µM, 20 µM, 40 µM, 80 µM, 160 µM, and 320 µM) for 24 h or Sal (20, 40, 80 µM) for 12 h/24 h/36 h/48 h overnight until the cells are adherent.
- After treatment, co-incubate the MCF-7 cells with 10 µL/well of CCK-8 solution (see the Table of Materials) for 2 h. Then, measure the optical density at 450 nm (OD450) with an automatic microplate reader.
3. Cell migration and invasion
NOTE: For details on this procedure, please refer to a previous report35.
- Incubate 2 mL of 5 x 106 cells/mL cells seeded in 6-well plates to cover 90% of the bottom of the dish.
- Perform a linear scratch wound along the center of the cell monolayer with a sterile pipette tip. Acquire images using an optical microscope at 0 h, 24 h, and 48 h.
- Use Image J software to measure the width of the scratch wounds.
- For the transwell assay, suspend MCF-7 cells with no serum medium, and seed in the upper transwell chamber pre-coated with or without Matrigel (see the Table of Materials).
- In the bottom of the transwell chamber, use DMEM complete medium as a chemical inducer. After 24 h, remove the cells in the upper chamber, and fix the remaining invasive and migrant cells in methanol35.
- Stain the MCF-7 cells with crystal violet solution (see the Table of Materials). Capture the images using an optical microscope.
4. Activity evaluation of Na+-K+-ATPase and Ca2+-Mg2+-ATPase
- Use a bicinchoninic acid (BCA) kit to measure the protein concentration in lysed MCF-7 cells, following the manufacturer's instructions (see the Table of Materials).
- Add samples of the lysed cells in their corresponding groups into the 96-well plates. After that, add the working solution to further incubate at 37 °C for 5 min. Finally, measure the values of OD636 with a multifunctional microplate reader.
5. Flow cytometry analysis of apoptosis and the cell cycle
NOTE: For details on this procedure, please refer to a previous report31.
- Digest the cells, and harvest to resuspend in phosphate-buffered saline (PBS) for a 20 min staining with annexin V-FITC and propidium iodide (PI) (see the Table of Materials), and then determine the number of apoptotic cells using a flow cytometer.
- Mix the resuspended sample solution with PI solution for a 30 min incubation, followed by detecting with a flow cytometer.
6. DCFH-DA and Fluo-4 AM fluorescence staining
NOTE: For details on this procedure, please refer to a previous report29.
- Incubate the MCF-7 cells for 20 min with a 10 µM DCFH-DA fluorescence probe (see the Table of Materials) at 37 °C. After thoroughly removing the surplus DCFH-DA by washing three times with PBS, test the fluorescence intensity at excitation and emission wavelengths of 488 nm and 525 nm, respectively, using a fluorescence microscope.
- Incubate the MCF-7 cells with a 5 µM Fluo-4 AM fluorescent probe solution (see the Table of Materials) for 45 min at 37 °C. After washing with PBS three times, determine the fluorescence intensity values at excitation and emission wavelengths of 488 nm and 516 nm, respectively, using a fluorescence microscope.
7. Western blot
- Add 2 mL of 5 x 106 cells/mL cell suspensions containing different drugs into 6-well plates, and culture in a 37 °C, 5% CO2 incubator for 24 h.
NOTE: The groups for the western blot analysis were set as follows: control group, LY294002 (10 µM) group, Sal (80 µM) group, and LY294002 (10 µM) + Sal (80 µM) group (see the Table of Materials). - Collect the cells and supernatant, and centrifuge at 560 × g at 4 °C for 3 min. Discard the supernatant, and wash twice with pre-cooled PBS. After each wash, centrifuge the cells at 560 × g at 4 °C for 3 min.
- Add 50 µL lysis buffer to the cell sample from step 7.2 for a 15 min ice bath. Centrifuge at 8550 × g at 4 °C for 10 min to collect the supernatant protein sample.
- After detecting the protein concentration using a BCA method, mix the protein sample in step 7.3 with loading buffer in a ratio of 4:1, denature at 100 °C for 10 min in a metal bath, and cool to room temperature.
- Add 20 µg of the protein sample from step 7.4, separate the proteins with different molecular weights35using 10% SDS-PAGE (see the Table of Materials), and then transfer to 0.22 µm PVDF membranes. After blockage with 5% BSA, incubate the membranes with the corresponding primary antibodies overnight at 4 °C.
NOTE: The dilute concentration of the following primary antibodies is 1:1,000: cleaved caspase-9/7/3 (CC-9/7/3), Bim, Bax, Bcl-2, p-PI3K/PI3K, p-AKT/AKT, mTOR, HIF-1α, FoxO1, and β-actin (see the Table of Materials). - The next day, incubate the membranes with goat anti-rabbit IgG secondary antibody for 2 h at 37 °C. Develop the membranes using an ECL chemiluminescent solution, and capture images using a contactless quantitative western blot imaging system (see the Table of Materials).
8. qRT-PCR
- Perform centrifugation to collect MCF-7 cells at 560 x g at 4 °C for 3 min, and add 500 µL buffer RL1 into 5 × 106 cells. Blow and mix repeatedly with a pipette until no cell masses are visible.
NOTE: Buffer RL1 is one of the components in the total RNA isolation kit (see the Table of Materials). - Transfer the cell homogenates in step 8.1 to the DNA-cleaning column embedded in the collection tube, and centrifuge at 8,550 × g at 4 °C for 2 min. Remove the DNA-cleaning column, and keep the supernatant in the collection tube.
NOTE: The DNA-cleaning column and the collection tube are two of the components in the total RNA isolation kit (see the Table of Materials). - Add 800 µL buffer RL2 to 500 µL of the supernatant from step 8.2, and mix gently.
NOTE: Buffer RL2 is one of the components in the total RNA isolation kit (see the Table of Materials). Add 120 mL of anhydrous ethanol to 60 mL of buffer RL2 before use. - Transfer 700 µL of the mixture from step 8.3 into the RNA-only column embedded in the collection tube, and centrifuge at 8,550 × g at 4 °C for 1 min. Discard the waste liquid in the collection tube.
NOTE: The RNA-only column is one of the components in the total RNA isolation kit (see the Table of Materials). - Repeat step 8.4 to process the remaining mixture from step 8.3.
- Add 500 µL of buffer RW1 to the RNA-only column, and centrifuge at 8,550 × g at 4 °C for 1 min. Discard the waste liquid in the collection tube.
NOTE: Buffer RW1 is one of the components in the total RNA isolation kit (see the Table of Materials). - Add 700 µL of buffer RW2 to the RNA-only column, and centrifuge at 8,550 × g at 4 ◦C for 1 min. Discard the waste liquid in the collection tube. Repeat step 8.7 once.
NOTE: Buffer RW2 is one of the components in the total RNA isolation kit (see the Table of Materials). - Place the RNA-only column back into the collection tube, and centrifuge at 8550 × g at 4 °C for 2 min to remove the remaining buffer RW2.
- Transfer the RNA-only column to a new collection tube, and drip 100 µL of RNase-free ddH2O preheated at 65 °C into the center of the membrane for the RNA-only column. Place at 25 °C for 2 min, and collect the RNA solution by centrifugation at 8,550 × g at 4 °C for 1 min.
NOTE: RNase-free ddH2O is one of the components in the total RNA isolation kit (see the Table of Materials). - Add 4 µL of 5x reaction buffer, 1 µL of oligo (dT)18 primer, 1 µL of random hexamer primer, 1 µL of gene-specific primer (see Table 1), 1 µL of enzyme mix, and 5 µg of the RNA solution from step 8.9 into a 100 µL 8-tube strip. Supplement the reaction system with RNase-free water to 20 µL.
- Set the reaction conditions of the system as follows: (1): 95 °C, 30 s, 1 cycle; (2): 95 °C, 5 s, 50 cycles, 60 °C, 34 s; (3): 95 °C, 5 s, 1 cycle, 65 °C, 60 s, 97 °C, 1 s; and (4): 42 °C, 30 s, 1 cycle. Execute the qRT-PCR procedure.
NOTE: The relative expression levels of the target genes were quantitatively analyzed by the 2−ΔΔCT method36,37. The primer information of each gene used for the qRT-PCR analysis is listed in Table 1.
9. Statistical analysis
- Express the data as the mean ± standard deviation of three independent experiments.
- Analyze the comparisons between multiple groups using graphing and analysis software (see the Table of Materials) with a one-way analysis of variance (ANOVA) followed by a Tukey's test. In this work, P < 0.05 was defined as statistically significant.
Subscription Required. Please recommend JoVE to your librarian.
Representative Results
Effects of Sal on inhibiting excess proliferation and delaying wound healing in MCF-7 cells
To probe the potential of Sal against breast cancer, we first tested its anticancer properties using cell proliferation toxicity and scratch assays of the human breast cancer MCF-7 cell line. These cells were co-incubated with a concentration series of Sal (5-320 µM) for 24 h, and the cell proliferation was evaluated using a CCK-8 assay. A dose-dependent inhibitory effect of Sal on cell proliferation was observed, with a 50% decline in cell vitality at 40 µM (Figure 2A). Sal concentrations of 20 µM, 40 µM, and 80 µM were then selected for the subsequent time points and wound healing evaluation. The results in Figure 2B show that Sal could inhibit the vitality of MCF-7 cells over time, with a 50% decrease in MCF-7 cell vitality after 24 h of co-incubation. Figure 2C-R shows the inhibitory effect of Sal treatment on the wound healing of MCF-7 cells, as determined by the wound scratch assay. Further cell scratch tests also confirmed that 24 h of culture with Sal (20 µM, 40 µM, and 80 µM) sharply hindered the process of wound healing (Figure 2C,D).
Suppression of malignant migration and invasion of MCF-7 cells by Sal
The migration of large numbers of tumor cells and the tendency to invade paracancer tissues are recognized as typical features of malignant tumors. The effects of Sal on the migration and invasion of MCF-7 cells were further tested using a transwell system coated with or without extracellular matrix gel. Sal treatment significantly reduced the undesirable migration (Figure 3A-F) and invasion (Figure 3G-L) of MCF-7 cells. As shown in Figure 3A, treatment with Sal surprisingly neutralized the migration of MCF-7 cells. Almost unanimously, the malicious invasion process of MCF-7 cells was effectively shut down after incubation with Sal (Figure 3B). The above data fully confirmed the advantages of Sal in inhibiting breast cancer.
Effects of Sal in promoting apoptosis and enhancing cycle arrest in MCF-7 cells
The immortalization and periodic reproduction of cancer cells provide opportunities for cancer to worsen and spread. As a matter of course, the promotion of apoptosis and cycle suppression has also become accepted strategies for preventing cancer. The results of flow cytometry suggested that Sal treatment increased the number of MCF-7 cells in the early and late apoptotic stages (Figure 4A). Meanwhile, compared with the control group, Sal treatment also sharply increased the number of cells in the G0/G1 phase, while reducing the proportion of S phase cells (Figure 4B). The promotion of apoptosis and cycle arrest may serve as the possible pharmacological action of Sal against breast cancer.
Effect of Sal on stimulating intracellular ROS and Ca2+ overproduction in MCF-7 cells
The continuous stimulation of intracellular ROS and Ca2+ production can effectively inhibit the growth of tumor cells. Figure 5A-E shows the ROS content assessed by DCFH-DA immunofluorescence staining. The quantitative results for ROS are shown in Figure 5F. Fluo-4 AM immunofluorescence staining was employed to detect the Ca2+ concentration (Figure 5G-K). Figure 5L shows the quantitative results for Ca2+. The DCFH-DA results showed that Sal significantly enhanced ROS fluorescence signals compared with the control group (Figure 5A). Consistently, Sal intervention also distinctly elevated Ca2+ production, evidenced by the highlighted Fluo-4 AM fluorescence signal (Figure 5B). These results collectively indicated that ROS and Ca2+ signals might be partly involved in the anti-breast cancer activity of Sal.
Effect of Sal in inducing apoptosis in the mitochondrial pathway of MCF-7 cells
There is abundant evidence that apoptosis induced by mitochondrial dysfunction determines the ultimate fate of many tumor cells. In determining whether Sal mediates mitochondrial function regulation and apoptosis-promoting effects in MCF-7 cells, it was first demonstrated that Sal restricted the enzyme vitalities of Na+-K+-ATPase (Figure 6A) and Ca2+-ATPase (Figure 6B), thus indicating its potential role in promoting mitochondrial dysfunction. Subsequently, western blot and qRT-PCR data showed that Sal treatment promoted the protein and gene expression of the pro-apoptotic factors CC-9 (Figure 6C,D,G), CC-7 (Figure 6C,E,H), CC-3 (Figure 6C,F,I), Bim (Figure 6C,J,M), and Bax (Figure 6C,L,O), while it inhibited the protein and gene expression of anti-apoptotic Bcl-2 (Figure 6C,K,N). These data partially demonstrate that mitochondrial dysfunction in MCF-7 cells coupled with apoptosis may be involved in the mechanism of action of Sal against breast cancer.
Effect of Sal on the suppression of the PI3K-AKT-HIF-1α-FoxO1 pathway in MCF-7 cells
The PI3K-AKT-HIF-1α-FoxO1 pathway, as a crucial signal transduction pathway regulating tumor growth, is involved in the pathologic progression and deterioration of breast cancer. The western blot results showed that Sal treatment prominently limited the ratios of p-PI3K/PI3K (Figure 7A,B) and p-AKT/AKT (Figure 7A,C). Meanwhile, the protein expression of mTOR (Figure 7A,D), HIF-1α (Figure 7A,E), and FoxO1 (Figure 7A,F) was also notably suppressed by Sal treatment. Further qRT-PCR analysis also demonstrated that Sal administration reduced the gene expression levels of PI3K (Figure 7G), AKT (Figure 7H), mTOR (Figure 7I), HIF-1α (Figure 7J), and FoxO1 (Figure 7K). In conclusion, the inhibition of the activation of PI3K-AKT-HIF-1α-FoxO1 pathway may be a potential molecular mechanism of Sal against breast cancer.
Figure 1: Schematic illustration of the action of Sal against the breast cancer MCF-7 cell line. Please click here to view a larger version of this figure.
Figure 2: MCF-7 cell proliferation toxicity and wound healing properties of Sal. (A) and (B) show dose-time effects of Sal treatment on MCF-7 cell activity. (C-R) Inhibitory effect of Sal treatment on wound healing in MCF-7 cells, as determined by the wound scratch assay. The data above are illustrated as the mean ± SD, n = 3.##p < 0.01 vs. the control group. Scale bars: 200 µm. Please click here to view a larger version of this figure.
Figure 3: Suppression of the malignant migration and invasion of MCF-7 cells by Sal treatment. Sal treatment significantly reduces the undesirable (A-F) migration and (G-L) invasion of MCF-7 cells. The data above are illustrated as the mean ± SD, n = 3.<#p < 0.05 and ##p < 0.01 vs. the control group. Scale bars: 200 µm. Please click here to view a larger version of this figure.
Figure 4: Promotion of apoptosis and suppression of the cell cycle by Sal. The (A) apoptotic promotion and (B) cellcycle arrest effects of Sal on MCF-7 cells, as detected by flow cytometry. The data above are illustrated as the mean ± SD, n = 3.#p < 0.05 and ##p < 0.01 vs. the control group. Please click here to view a larger version of this figure.
Figure 5: Surge of ROS and Ca2+ in MCF-7 cells caused by Sal treatment. (A-E) The ROS content was assessed by DCFH-DA immunofluorescence staining. (F) Quantitative results for ROS. (G-K) Fluo-4 AM immunofluorescence staining was employed to detect the Ca2+ concentration. (L) Quantitative results for Ca2+. The data above are illustrated as the mean ± SD, n = 3.#p < 0.05 and ##p < 0.01 vs. the control group. Scale bars: 200 µm. Please click here to view a larger version of this figure.
Figure 6: Effect ofSal treatment on inducing mitochondrial dysfunction coupled with apoptosis in MCF-7 cells. The reduced enzyme activities of (A) Na+-K+-ATPase and (B) Ca2+-ATPase. (C) Representative protein expression bandsand their corresponding statistical results for (D) CC-9, (E) CC-7, (F) CC-3, (J) Bim, (K) Bcl-2, and (L) Bax proteins and for the (G) caspase-9, (H) caspase-7, (I) caspase-3, (M) Bim, (N) Bcl-2, and (O) Bax genes. The data above are illustrated as the mean ± SD, n = 3.#p < 0.05 and ##p < 0.01 vs. the control group. Please click here to view a larger version of this figure.
Figure 7: Suppression of the PI3K-AKT-HIF-1α-FoxO1 pathway by Sal treatment. (A) Representative protein bands detected by western blot analysis. Sal reduced the protein expression of (B) p-PI3K/PI3K, (C) p-AKT/AKT, (D) mTOR, (E) HIF-1α, and (F) FoxO1. Sal subdued gene expression levels of (G) PI3K, (H) AKT, (I) mTOR, (J) HIF-1α, and (K) FoxO1. The data above are illustrated as the mean ± SD, n = 3. ##p < 0.01 vs. the control group. Please click here to view a larger version of this figure.
Figure 8: Stimulation of ROS and Ca2+ production in MCF-7 cells by Sal, accompanied by the inhibition of PI3K signal transduction. With the involvement of mTOR, the phosphorylation of AKT was further reduced after Sal administration. Consequently, the downregulated expression of HIF-1α and FoxO1 blocked the periodic malignant proliferation of MCF-7 cells. Meanwhile, the enhanced apoptosis of MCF-7 cells suggested the anti-breast cancer potential of Sal. Please click here to view a larger version of this figure.
| Gene | GenBank accession no. | Primer sequence (5'-3') | Length (bp) | |
| Caspase-9 | NM_001229 | F, GACCAGAGATTCGCAAACCAGAGG | 92 | |
| R, AAGAGCACCGACATCACCAAATCC | ||||
| Caspase-7 | F, AGTGACAGGTATGGGCGTTC | 164 | ||
| R, CGGCATTTGTATGGTCCTCTT | ||||
| Caspase-3 | NM_001354777 | F, CCAAAGATCATACATGGAAGCG | 185 | |
| R, CTGAATGTTTCCCTGAGGTTTG | ||||
| Bim | NM_001204106 | F, AAGGTAATCCTGAAGGCAATCA | 130 | |
| R, CTCATAAAGATGAAAAGCGGGG | ||||
| Bcl-2 | NM_000633 | F, GACTTCGCCGAGATGTCCAG | 129 | |
| R, GAACTCAAAGAAGGCCACAATC | ||||
| Bax | NM_001291428 | F, CGAACTGGACAGTAACATGGAG | 157 | |
| R, CAGTTTGCTGGCAAAGTAGAAA | ||||
| β-actin | NM_031144 | F, AATCTGGCACCACACCTTCTACAA | 172 | |
| R, GGATAGCACAGCCTGGATAGCAA | ||||
| F, forward; R, reverse. | ||||
Table 1: Primers used for the reverse transcription-quantitative polymerase chain reaction.
Subscription Required. Please recommend JoVE to your librarian.
Discussion
Breast cancer affects individuals of all ages and causes incalculable physical and mental burden and great economic pressure1. Breast cancer, with its increasing morbidity and mortality each year, has also attracted worldwide attention in terms of seeking effective herbal-based compound therapies beyond conventional treatments4,5. Promisingly, a large body of evidence has revealed the anti-cancer effects of Sal24,25,38. Unfortunately, the role of Sal in breast cancer and the underlying molecular mechanisms still remain largely unknown. This study highlights the significant inhibitory effects of Sal on the proliferation, migration, and invasion of the human breast cancer MCF-7 cell line. Subsequently, we revealed the potential of Sal in irritating apoptosis and cycle arrest of MCF-7 cells. Meanwhile, these data also showed that Sal administration increased the levels of ROS and Ca2+. Further exploration of the molecular mechanisms demonstrated the apoptosis-promoting action of Sal in breast cancer treatment and the effect of Sal on the PI3K-AKT-HIF-1α-Foxo1 pathway.
Malignant and uncontrolled proliferation can accelerate the development of breast cancer and increase the risk of lymphatic39 and brain metastases40. Currently, available chemotherapeutic drugs on the market have gradually appeared, but these have the issue of low sensitivity for treating breast cancer, thus forcing people to seek more potent compounds or novel drug combinations2,3. The data in this work first demonstrated that Sal treatment limited the malignant proliferation of MCF-7 cells. Subsequent cell scratch assays further confirmed that 12 h and 24-h Sal incubation reduced the convergence rate of MCF-7 cells. Tests for the tumor cell migration and invasion ability are regarded as sensitive indicators for screening anti-tumor drugs24,25. The data in this work suggested that Sal strongly reduced the process of MCF-7 cell migration and invasion, in line with previous findings33,34. The uncontrolled cell cycle of tumor cells determines the fate of cell immortality24. Therefore, apoptosis promotion and cell cycle interruption have become recognized and accepted indices for evaluating the anticancer potential of compounds25. In this work, flow cytometry analysis indicated that Sal treatment signally increased apoptosis in MCF-7 cells, as evidenced by an increased proportion of early and late apoptotic cells. Moreover, the ratio of G0/G1 cells was increased, and the S phase of the MCF-7 cell cycle was disturbed, indicating the cell cycle-blocking effects of Sal on breast cancer cells.
The mild hypoxic breast cancer cell microenvironment is associated with limitations in ROS and Ca2+ production; thus, excessive ROS and Ca2+ accumulation can induce apoptotic events in breast cancer cells41. The immunofluorescence results in this work proved that Sal intervention greatly stimulated ROS and Ca2+ production, which may further induce the apoptosis of MCF-7 cells. Emerging evidence has revealed that elevated levels of the pro-apoptotic proteins Bax and Bim, as well as reduced levels of the anti-apoptotic protein Bcl-2, can temporarily and forcibly open the passage of material in and out of the mitochondrial membrane, thus triggering programmed apoptosis of tumor cells42. In this study, the co-incubation of Sal with MCF-7 cells significantly increased Bax and Bim while decreasing the protein and gene expression of Bcl-2, thus suggesting its potential pharmacological effects on promoting apoptosis in breast cancer cells. These data also suggested that Sal distinctly induced the expression of CC-9, CC-7, and CC-3 proteins, which are key downstream indicators of the mitochondrial apoptosis pathway, and their corresponding genes. The above data partly suggest that the proapoptotic effect of Sal on breast cancer might be related to the activation of mitochondrial apoptosis.
Molecular mechanism studies have confirmed that the phosphorylation of PI3K can further induce AKT phosphorylation and accelerate the growth of breast cancer cells6,7. In the meantime, the large accumulation of mTOR also contributes to the deterioration of breast cancer by participating in the AKT phosphorylation process8,9. On the one hand, phosphorylated AKT directly stimulates FoxO1 expression to promote the breast cancer cell cycle and slow down apoptosis22,23. In parallel, activated AKT indirectly activates HIF-1α expression to yield FoxO1, resulting in breast cancer progression and metastasis16,17. Consequently, the inhibition of the activation of PI3K-AKT-HIF-1α-Foxo1 pathway may be a novel strategy for breast cancer treatment. With the intervention of the PI3K inhibitor LY294002, the data demonstrated that Sal observably suppressed the phosphorylation of PI3K. In conjunction with the downregulation of mTOR protein expression, Sal also lowered the expression levels of phosphorylated AKT. As a result, HIF-1α and FoxO1 protein expression were likewise vastly diminished after Sal treatment. Similarly, the qRT-PCR results conformably revealed that Sal treatment extensively lessened the gene levels of PI3K, AKT, HIF-1α, and FoxO1, contributing to the promotion of cycle arrest and apoptosis of MCF-7 cells (Figure 8). Collectively, the obtained data suggest that Sal could be a potential active compound of natural herbal origin with action against breast cancer. The promotion of MCF-7 cell apoptosis and cell cycle inhibition by Sal treatment greatly weakened the migration and invasion ability of breast cancer cells. Notably, the molecular mechanism of action of Sal against breast cancer may be related to the inhibition of the PI3K-AKT-HIF-1α-Foxo1 pathway. Overall, this protocol integrating multiple experimental methods provides a certain reference value for the research and development of anti-breast cancer drugs.
In this study, there is no direct evidence of the molecular mechanism of Sal against breast cancer. PI3K knockout mice, breast cancer cell lines with high or low expression of the PI3K protein, and local surface plasmon resonance techniques are the next steps that could be used to confirm the direct molecular targets of Sal for the prevention and treatment of breast cancer29,31.
Subscription Required. Please recommend JoVE to your librarian.
Disclosures
The authors have nothing to disclose.
Acknowledgments
This work was supported by the Health Commission of Sichuan Province (120025).
Materials
| Name | Company | Catalog Number | Comments |
| 1% penicillin/streptomycin | HyClone | SV30010 | |
| AKT antibody | ImmunoWay Biotechnology Company | YT0185 | |
| Annexin V-FITC/PI kit | MultiSciences Biotech Co., Ltd. | AP101 | |
| Automatic microplate reader | Molecular Devices | SpectraMax iD5 | |
| Bax antibody | Cell Signaling Technology, Inc. | #5023 | |
| BCA kit | Biosharp Life Sciences | BL521A | |
| Bcl-2 antibody | Cell Signaling Technology, Inc. | #15071 | |
| Bim antibody | Cell Signaling Technology, Inc. | #2933 | |
| Ca2+–ATPase assay kit | Nanjing Jiancheng Bioengineering Institute | A070-4-2 | |
| Cell counting kit-8 | Biosharp Life Sciences | BS350B | |
| Cell cycle staining kit | MultiSciences Biotech Co., Ltd. | CCS012 | |
| cleaved caspase-3 | Cell Signaling Technology, Inc. | #9661 | |
| cleaved caspase-7 | Cell Signaling Technology, Inc. | #8438 | |
| cleaved caspase-9 | Cell Signaling Technology, Inc. | #20750 | |
| Crystal violet solution | Beyotime Biotechnology | C0121 | |
| DMEM high glucose culture medium | Servicebio Technology Co., Ltd. | G4510 | |
| Doxorubicin hydrochloride | MedChemExpress | HY-15142 | |
| ECL chemiluminescent solution | Biosharp Life Sciences | BL520B | |
| Fetal bovine serum | Procell Life Science & Technology Co., Ltd. | 164210 | |
| Flow cytometer | BD | FACSCanto  |
|
| Fluo-4 AM | Beyotime Biotechnology | S1060 | |
| FoxO1 antibody | ImmunoWay Biotechnology Company | YT1758 | |
| Goat anti-rabbit IgG secondary antibody | MultiSciences Biotech Co., Ltd. | 70-GAR0072 | |
| GraphPad Prism software | La Jolla | Version 6.0 | |
| HIF-1α antibody | Affinity Biosciences | BF8002 | |
| Human breast cancer cell line MCF-7 | Procell Life Science & Technology Co., Ltd. | CL-0149 | |
| Loading buffer | Biosharp Life Sciences | BL502B | |
| LY294002 | MedChemExpress | HY-10108 | |
| Matrigel | Thermo | 356234 | |
| mTOR antibody | Servicebio Technology Co., Ltd. | GB11405 | |
| Na+–K+–ATPase assay kit | Nanjing Jiancheng Bioengineering Institute | A070-2-2 | |
| Optical microscope | Olympus | IX71PH | |
| p-AKT antibody | ImmunoWay Biotechnology Company | YP0006 | |
| PI3K antibody | Servicebio Technology Co., Ltd. | GB11525 | |
| p-PI3K antibody | Affinity Biosciences | AF3241 | |
| Quantitative western blot imaging system | Touch Image Pro | eBlot | |
| Reverse transcription first strand cDNA synthesis kit | Servicebio Technology Co., Ltd. | G3330-100 | |
| ROS assay kit | Beyotime Biotechnology | S0033S | DCFH-DA fluorescence probe is included here |
| Salidroside | Chengdu Herbpurify Co., Ltd. | H-040 | |
| SDS-PAGE kit | Servicebio Technology Co., Ltd. | G2003-50T | |
| Total RNA isolation kit | Foregene | RE-03014 | |
| Trypsin | HyClone | SH30042.01 | |
| β-actin | Affinity Biosciences | AF7018 |
References
- Sung, H., et al. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA. 71 (3), 209-249 (2021).
- Franzoi, M. A., et al. Evidence-based approaches for the management of side-effects of adjuvant endocrine therapy in patients with breast cancer. Lancet Oncology. 22 (7), e303-313 (2021).
- Prionas, N. D., Stephens, S. J., Blitzblau, R. C. Early-stage breast cancer: Tailored external beam fractionation approaches for treatment of the whole or partial breast. Seminars in Radiation Oncology. 32 (3), 245-253 (2022).
- Wei, W. C., et al. Diterpenoid vinigrol specifically activates ATF4/DDIT3-mediated PERK arm of unfolded protein response to drive non-apoptotic death of breast cancer cells. Pharmacological Research. 182, 106285 (2022).
- Zhu, Y., et al. Apoptosis induction, a sharp edge of berberine to exert anti-cancer effects, focus on breast, lung, and liver cancer. Frontiers in Pharmacology. 13, 803717 (2022).
- Ladewig, E., et al. The oncogenic PI3K-induced transcriptomic landscape reveals key functions in splicing and gene expression regulation. Cancer Research. 82 (12), 2269-2280 (2022).
- Lu, Z. N., Song, J., Sun, T. H., Sun, G. UBE2C affects breast cancer proliferation through the AKT/mTOR signaling pathway. Chinese Medical Journal. 134 (20), 2465-2474 (2021).
- Weng, H. C., et al. The combination of a novel GLUT1 inhibitor and cisplatin synergistically inhibits breast cancer cell growth by enhancing the DNA damaging effect and modulating the Akt/mTOR and MAPK signaling pathways. Frontiers in Pharmacology. 13, 879748 (2022).
- Silveira Rabelo, A. C., et al. Calotropis procera induced caspase dependent apoptosis and impaired Akt/mTOR signaling in 4T1 breast cancer cells. Anti-Cancer Agents in Medicinal Chemistry. 22 (18), 3136-3147 (2022).
- Tohkayomatee, R., Reabroi, S., Tungmunnithum, D., Parichatikanond, W., Pinthong, D. Andrographolide exhibits anticancer activity against breast cancer cells (MCF-7 and MDA-MB-231 cells) through suppressing cell proliferation and inducing cell apoptosis via inactivation of ER-α receptor and PI3K/AKT/mTOR signaling. Molecules. 27 (11), 3544 (2022).
- Jin, X. Y., et al. TPI1 activates the PI3K/AKT/mTOR signaling pathway to induce breast cancer progression by stabilizing CDCA5. Journal of Translational Medicine. 20 (1), 191 (2022).
- Li, Z. W., et al. Atractylodin induces oxidative stress-mediated apoptosis and autophagy in human breast cancer MCF-7 cells through inhibition of the P13K/Akt/mTOR pathway. Journal of Biochemical and Molecular Toxicology. 36 (8), 23081 (2022).
- Chen, F., et al. Extracellular vesicle-packaged HIF-1α-stabilizing lncRNA from tumour-associated macrophages regulates aerobic glycolysis of breast cancer cells. Nature Cell Biology. 21 (4), 498-510 (2019).
- You, D., et al. Mitochondrial malic enzyme 2 promotes breast cancer metastasis via stabilizing HIF-1α under hypoxia. Chinese Journal of Cancer Research. 33 (3), 308-322 (2021).
- La Camera, G., et al. Adipocyte-derived extracellular vesicles promote breast cancer cell malignancy through HIF-1α activity. Cancer Letters. 521, 155-168 (2021).
- Jeong, Y. J., et al. Ascofuranone suppresses EGF-induced HIF-1α protein synthesis by inhibition of the Akt/mTOR/p70S6K pathway in MDA-MB-231 breast cancer cells. Toxicology and Applied Pharmacology. 273 (3), 542-550 (2013).
- Zhang, T., et al. Targeting the ROS/PI3K/AKT/HIF-1α/HK2 axis of breast cancer cells: Combined administration of polydatin and 2-deoxy-d-glucose. Journal of Cellular and Molecular Medicine. 23 (5), 3711-3723 (2019).
- Han, N. N., et al. HIF-1α induced NID1 expression promotes pulmonary metastases via the PI3K-AKT pathway in salivary gland adenoid cystic carcinoma. Oral Oncology. 131, 105940 (2022).
- Sun, L. T., Zhang, L. Y., Shan, F. Y., Shen, M. H., Ruan, S. M. Jiedu Sangen decoction inhibits chemoresistance to 5-fluorouracil of colorectal cancer cells by suppressing glycolysis via PI3K/AKT/HIF-1α signaling pathway. Chinese Journal of Natural Medicines. 19 (2), 143-152 (2021).
- Gao, T., et al. SIK2 promotes reprogramming of glucose metabolism through PI3K/AKT/HIF-1α pathway and Drp1-mediated mitochondrial fission in ovarian cancer. Cancer Letters. 469, 89-101 (2020).
- Zhu, W. H., et al. Dihydroartemisinin suppresses glycolysis of LNCaP cells by inhibiting PI3K/AKT pathway and downregulating HIF-1α expression. Life Sciences. 233, 116730 (2019).
- Sajadimajd, S., Yazdanparast, R. Differential behaviors of trastuzumab-sensitive and -resistant SKBR3 cells treated with menadione reveal the involvement of Notch1/Akt/FOXO1 signaling elements. Molecular and Cellular Biochemistry. 408 (1-2), 89-102 (2015).
- Sajadimajd, S., Yazdanparast, R., Akram, S. Involvement of Numb-mediated HIF-1α inhibition in anti-proliferative effect of PNA-antimiR-182 in trastuzumab-sensitive and -resistant SKBR3 cells. Tumor Biology. 37 (4), 5413-5426 (2016).
- Rong, L., et al. Salidroside induces apoptosis and protective autophagy in human gastric cancer AGS cells through the PI3K/Akt/mTOR pathway. Biomedicine & Pharmacotherapy. 122, 109726 (2020).
- Zeng, Q., et al. Salidroside promotes sensitization to doxorubicin in human cancer cells by affecting the PI3K/Akt/HIF signal pathway and inhibiting the expression of tumor-resistance-related proteins. Journal of Natural Products. 85 (1), 196-204 (2022).
- Wang, X. B., et al. Rhodiola crenulata attenuates apoptosis and mitochondrial energy metabolism disorder in rats with hypobaric hypoxia-induced brain injury by regulating the HIF-1α/microRNA210/ISCU1/2 (COX10) signaling pathway. Journal of Ethnopharmacology. 241, 111801 (2019).
- Tang, Y., et al. Salidroside attenuates CoCl2-simulated hypoxia injury in PC12 cells partly by mitochondrial protection. European Journal of Pharmacology. 912, 174617 (2021).
- Jiang, S. N., et al. Salidroside attenuates high altitude hypobaric hypoxia-induced brain injury in mice via inhibiting NF-κB/NLRP3 pathway. European Journal of Pharmacology. 925, 175015 (2022).
- Wang, X. B., et al. Salidroside, a phenyl ethanol glycoside from Rhodiola crenulata, orchestrates hypoxic mitochondrial dynamics homeostasis by stimulating Sirt1/p53/Drp1 signaling. Journal of Ethnopharmacology. 293, 115278 (2022).
- Vasileva, L. V., et al. Antidepressant-like effect of salidroside and curcumin on the immunoreactivity of rats subjected to a chronic mild stress model. Food and Chemical Toxicology. 121, 604-611 (2018).
- Hou, Y., et al. Salidroside intensifies mitochondrial function of CoCl2-damaged HT22 cells by stimulating PI3K-AKT-MAPK signaling pathway. Phytomedicine. 109, 154568 (2023).
- Fan, F. F., et al. Salidroside as a potential neuroprotective agent for ischemic stroke: A review of sources, pharmacokinetics, mechanism and safety. Biomedicine & Pharmacotherapy. 129, 110458 (2020).
- Hu, X. L., Zhang, X. Q., Qiu, S. F., Yu, D. H., Lin, S. X. Salidroside induces cell-cycle arrest and apoptosis in human breast cancer cells. Biochemical and Biophysical Research Communications. 398 (1), 62-67 (2010).
- Zhao, G., Shi, A. P., Fan, Z. M., Du, Y. Salidroside inhibits the growth of human breast cancer in vitro and in vivo. Oncology Reports. 33 (5), 2553-2560 (2015).
- Bai, J. R., et al. The enhanced mitochondrial dysfunction by cantleyoside confines inflammatory response and promotes apoptosis of human HFLS-RA cell line via AMPK/Sirt 1/NF-κB pathway activation. Biomedicine & Pharmacotherapy. 149, 112847 (2022).
- Hou, Y., et al. Longzhibu disease and its therapeutic effects by traditional Tibetan medicine: Ershi-wei Chenxiang pills. Journal of Ethnopharmacology. 249, 112426 (2020).
- Yang, L., et al. Dengzhan Xixin injection derived from a traditional Chinese herb Erigeron breviscapus ameliorates cerebral ischemia/reperfusion injury in rats via modulation of mitophagy and mitochondrial apoptosis. Journal of Ethnopharmacology. 288, 114988 (2022).
- Cui, L. J., et al. Salidroside promotes apoptosis of human HCT116 colon cancer cells by regulating Wnt/β-catenin signaling pathway. Pharmacological Research - Modern Chinese Medicine. 3, 100088 (2022).
- Wu, S. L., et al. Genome-wide 5-Hydroxymethylcytosine profiling analysis identifies MAP7D1 as a novel regulator of lymph node metastasis in breast cancer. Genomics Proteomics & Bioinformatics. 19 (1), 64-79 (2021).
- Du, J. W., et al. Targeted NIRF/MR dual-mode imaging of breast cancer brain metastasis using BRBP1-functionalized ultra-small iron oxide nanoparticles. Materials Science & Engineering C-Materials for Biological Applications. 116, 111188 (2020).
- Wang, S. F., et al. Mitochondrial stress adaptation promotes resistance to aromatase inhibitor in human breast cancer cells via ROS/calcium up-regulated amphiregulin-estrogen receptor loop signaling. Cancer Letters. 523, 82-99 (2021).
- Zuo, Y., et al. Activation of mitochondrial-associated apoptosis signaling pathway and inhibition of PI3K/Akt/mTOR signaling pathway by voacamine suppress breast cancer progression. Phytomedicine. 99, 154015 (2022).
