A Method to Produce Recombinant Antibodies Against Metallopeptidase

Overview

This video demonstrates a procedure for the production of recombinant antibodies against metallopeptidase. Recombinant plasmids carrying genes for the antibody, green fluorescent protein, and antibiotic resistance are transfected into epithelial cells with lipofectamine. The transfected cells are selected and cultivated to generate recombinant antibodies.

Protocol

1. Preparation of porcine aminopeptidase N (APN) protein antigen

NOTE: The pET28a (+)-APN-BL21 (DE3) strain and the APN stably expressed cells pEGFP-C1-APN-IPEC-J2 were constructed in a previous study.

1. Recover bacteria from a frozen glycerol stock and streak onto Luria-Bertani (LB) plates containing 50 µg/mL kanamycin (Km⁺) for single colony isolation.
2. Select a single colony from the freshly streaked plate, culture in 4 mL of LB medium (10 g/L tryptone, 10 g/L sodium chloride (NaCl) and 5 g/L yeast extract, pH 7.2) supplemented with Km⁺ (50 µg/mL), and leave to grow overnight (12-16 h) with agitation (178 rpm) at 37 °C.
3. Dilute the prepared bacteria at 1:100 in fresh Km⁺ LB broth and incubate at 37 °C with shaking for 2-3 h until the OD₆₀₀ reaches 0.4-0.6.
4. Add isopropyl β-d-1-thiogalactopyranoside (IPTG) to the medium to a final concentration of 0.4 mM, and incubate the cultures for an additional 10 h at 16 °C.
5. Consequently, centrifuge and harvest the bacteria using IPTG induction (10,000 × g, 4 °C 15 min).
6. Resuspend the cell pellet using 5 mL of LEW (Lysis/Equilibration/Wash) buffer (50 mM anhydrous sodium phosphate monobasic (NaH₂PO₄) and 300 mM NaCl, pH 8.0) containing 1 mg/mL lysozyme. Stir the bacterial suspension for 30 min on ice and sonicate completely (15 s pulse and 20 s off, 15 min) using an ultrasonic homogenizer.
7. Centrifuge the crude cell lysate at 4 °C and 10,000 × g for 30 min to remove cellular debris. Transfer supernatant into a pre-equilibrated column and incubate 1-2 min before gravity drainage. Repeat this step three times.
8. Wash the column using 20 mL of LEW buffer and drain using gravity. Elute the histidine-tagged APN protein using 9 mL of elution buffer (50 mM NaH₂PO₄, 300 mM NaCl and 250 mM imidazole, pH 8.0) and collect into dialysis tubing.
9. Dialyze the protein solution overnight at 4 °C in sodium carbonate-sodium bicarbonate (phosphate-buffered saline (PBS), 135 mM NaCl, 4.7 mM potassium chloride, 2 mM NaH₂PO₄, and 10 mM dodecahydrate sodium phosphate dibasic, pH 7.2) buffer.
10. Analyze using a 12.0% SDS-PAGE gel and western blotting to assess the purity of the APN protein.
    1. Load 5 µg of protein into each well of the gel and allow to run at 110 V for 1.5 h. Then, transfer protein onto a polyvinylidene fluoride (PVDF) membrane for 50 min at 15 V. Determine the concentration of the purified protein using a bicinchoninic acid (BCA) assay.

2. Animal immunization

1. Subcutaneous (s.c) inject female BALB/c mice, 6-8 weeks of age, with 50 µg of APN protein or PBS (negative control) mixed with adjuvants once every 2 weeks. Use complete Freund's adjuvant that contains the heat-killed Mycobacteria for initial immunization, and incomplete Freund's adjuvant for booster immunizations. Mix equal volumes of APN protein (or PBS) and Freund's adjuvant or incomplete Freund's adjuvant, respectively.
2. Detect antibody titers against APN in the sera of these mice by indirect enzyme-linked immunosorbent assay (ELISA) using a microtiter plate coated with 5 µg/mL APN protein diluted in 0.05 M PBS (pH 9.6).

3. Hybridoma technology to produce monoclonal antibodies against APN

1. Intraperitoneally (i.p.) inject 100 µg of APN protein into the selected mice for a final antigen boost.
2. Three days later, euthanize the mice using pentobarbital sodium (50 mg/kg, v/v, intraperitoneal) and cervical dislocation.
3. Collect spleens, and wash with Dulbecco's Modified Eagle Medium (DMEM) twice to remove blood and fat cells. Filter the spleen-cell suspension using a 200-mesh copper grid to remove tissue debris, and harvest spleen cells using centrifugation (1500 × g, 10 min) to remove the membrane of the spleen.
4. Seed mouse myeloma SP2/0 cells in a 25 cm² flask containing 5 mL of DMEM supplemented with 6% fetal bovine serum (FBS) and culture at 37 °C, 6% carbon dioxide (CO₂) atmosphere to maintain cell viability. After 5-6 days of culture, the cells reach 80%-90% confluence post-resuscitation and are in growth log phase. Under the microscope, the cells are round, bright, and clear.
5. One day before hybridization, collect macrophages from peritoneal cavities of the mice according to a previously published method.
6. Seed peritoneal macrophages at a density of 0.1-0.2 × 10⁵/mL in 96-well plates, each well containing 100 µL of hypoxanthine-aminopterin-thymidine (HAT) medium (DMEM supplemented with 10% FBS and 1x HAT Supplement), and incubate at 37 °C, 6 % CO₂ humidified atmosphere overnight.
7. For hybridization, gently aspirate SP2/0 cells with a pipette from 8-10 bottles and suspend in 10 mL of serum-free DMEM medium. Wash cells with fresh DMEM, centrifuge (1500 × g, 10 min) twice, and then re-suspend in 10 mL of DMEM.
8. Mix the quantified spleen cells with SP2/0 cells at a ratio of 10:1 and transfer into 50 mL tubes. Centrifuge (1500 × g, 10 min) and discard the supernatant. Collect the cell pellets at the bottom of the tubes and tap with palm to loosen the pellets prior to hybridization.
9. Add 1 mL of polyethylene glycol 1500 (PEG 1500), pre-warmed to 37 °C, dropwise using a dropper to the loosened cell pellet over the time period of 45 s while gently rotating the bottom of the tube.
10. Slowly add 1 mL of DMEM pre-warmed to 37 °C to the above mixture over the period of 90 s, followed by another 30 mL of fresh DMEM. Place the fusion tube into a 37 °C water bath for 30 min.
11. After incubation in the warm bath, harvest the cells and re-suspend in HAT medium. Then culture in a 96-well plate inoculated with peritoneal macrophages.
12. Five days later, add 100 µL of fresh HAT medium to each well, and incubate the plate for an additional 5 days, after which replace the medium with HT medium (DMEM supplemented with 10% FBS and 1x HT Supplement).
13. Use a microtiter plate coated with 5 µg/mL APN protein diluted in 0.05 M PBS (pH 9.6) to analyze monoclonal antibodies in the hybridoma supernatant using ELISA assay.
    1. When the medium in the wells of the 96-well plate turns yellow (due to cell growth and metabolite release, pH in the medium decreases to 6.8, and phenol red turns from fuchsia to yellow) or cell clusters are observed, acquire 100 µL supernatant from the selected wells and add to the wells of the coated ELISA plate. Use a microplate reader to measure the optical density 450 (OD450) values.
    2. Use the polyclonal antibodies against APN and non-infected mouse serum as positive and negative control, respectively, and use PBS as blank control. In this study, OD450 ratio of sample to negative control (P/N) ≥ 2.1 was recognized as positive selection standard.
14. After three consecutive positive selection rounds, select the hybridoma showing increased serology response against the APN protein for a limited dilution assay.
    1. Prepare peritoneal macrophages and seed in 96-well plates as described previously.
    2. Suspend hybridoma cells in HT medium at an average of 0.5-2 cells per well and culture in a 37 °C, 6% CO₂ incubator. Repeat this step three or four times until the positive rate indicated by ELISA immunoassay reaches 100%.
15. Under the pressure of continuous freezing and thawing, select the positive hybridoma cells able to stably secrete anti-APN antibodies and proliferate normally.
    1. Administer a single i.p. injection of 0.3 mL of pristane to each mouse (8-10 weeks). At 10 days after receiving pristine, inject each mouse with 2-5 x 10⁵ hybridoma cells in 0.5 mL of PBS (pH 7.2).
    2. Carefully collect peritoneal fluid from the peritoneal cavity of these mice 8 to 10 days after the injection.
    3. Harvest the supernatants by centrifugation at 5,000 × g for 15 min and purify antibodies in the supernatants using 33% saturated ammonium sulfate [(NH₄)₂SO₄] precipitation and protein A agarose.

4. Characterization of monoclonal antibodies (mAbs) against APN protein

1. Determine the immunoglobulin subtype of the collected mAbs using an SBA Clonotyping System-HRP. Use SDS-PAGE and western blotting to assess mAb purity and specificity.
2. Analyze mAb epitope specificity against the APN protein using ELISA. Additivity value (AV) is the ratio of OD_{mAbs (a+b)} to (OD_mAbs-a+OD_mAbs-b), which is used to evaluate whether mAbs recognize the same antigenic site; OD_mAbs-a and OD_mAbs-b represent the OD450 values of different monoclonal antibodies against APN alone, and OD_{mAbs (a+b)} represent the OD450 values of a 1:1 mixture of two mAbs against APN.
   1. Assess each sample at least four replicates and repeat the whole experiment at least three times.

5. Expression of rAbs against APN

1. Extract total RNA from the above-mentioned hybridoma cells and spleens of APN-immunized mice (e.g., TRIzol). Synthesize complementary DNA (cDNA) using a cDNA synthesis kit per manufacturer's instructions.
2. Amplify variable regions of mAbs using nested polymerase chain reaction (PCR) and determine heavy chain (VH) and light chain (VL) sequences using sequencing. Analyze the genes encoding VH and VL using the IMGT mouse genome analysis tool (http://www.imgt.org/about/immunoinformatics.php).
3. Combine the VH and VL genes with leader sequences and sequentially subclone them into the pET28a (+) and pIRES2-ZsGreen1 vectors, respectively, using seamless cloning technology to allow for scarless DNA fragment insertion. The specific primers are listed in Table 1.
4. Grow the pET28a (+)-rAbs-APN-BL21-transformed bacteria in the presence of 0.4 mM IPTG in orbital shakers at 37 °C for 10 h. Then induce, purify, and assess for the expression of the rAbs protein using routine protein purification.
5. Seed 100 µL 0.5 x 10⁵ CHO cells per well into a 96-well plate and incubate at 37 °C in a 6% CO₂ atmosphere for 18-24 h. When the cells reach 80-90% confluence, dilute the pIRES2-ZsGreen1-rAbs-APN plasmid with Opti-MEM to a final concentration of 0.1 µg/µL, and incubate 5 min at room temperature before using for transfection.
6. Gently mix 50 µL of diluted pIRES2-ZsGreen1-rAbs-APN plasmid with 1 µL of Lipofectamine 2000 and 49 µL of Opti-MEM and incubate the mixture for an additional 20 min at room temperature. Add 100 µL of mixture to each well of a 96-well plate containing CHO cells and incubate at 37 °C in 6% CO₂ atmosphere for 4-6 h.
7. At 4-6 h post-transfection, replace the medium with DMEM-F12 medium supplemented with 10% FBS, and incubate the plate for another 48 h. Then, add 400 µg/mL G418 to each well to select the stably transfected cells.
8. After 10 days of selection using DMEM-F12 medium supplemented with 10% FBS and 400 µg/mL G418, sort the cells (3.0 × 10⁷ cells/mL) by fluorescence-activated cell sorting. Approximately 10-15% of the cell population were positive.
9. Serially dilute harvested positive cells, seed at an average of 0.5-2 cells per well in a 96-well plate, and culture in a 37 °C, 6% CO₂ incubator. Maintain the stably transfected pIRES2-ZsGreen1-rAbs-APN-CHO cells using selection with G418 (200 µg/mL).
10. FBS concentration in the above-described cell-culture medium decreases gradually from 10% to 0% during the logarithmic growth phase over the time period of 3 weeks. Then, adapt the adherent CHO cells to suspension growth in a serum-free medium.
11. Culture the seeded pIRES2-ZsGreen1-rAbs-APN-CHO cells in the logarithmic growth phase in serum-free medium at a density of 0.8-1.0 × 10⁵ cells/mL in shake flasks at 80-110 rpm shaking speed and 37°C, 6% CO₂.
12. Collect the cell suspension every 12 h to determine changes in cell viability and vitality using a cell counting kit (e.g., CCK-8) per manufacturer's instructions.
13. Antibody expression reaches peak levels when cell viability decreased to 80% and cell density reaches 1.0-2.0 × 10⁶ cells/mL. Harvest cell supernatants using centrifugation, filter using a 0.22 µm polytetrafluoroethylene membrane filter, and purify using protein A agarose.
14. Confirm production of APN-specific antibodies using indirect immunofluorescence assays (IFA).
15. Determine antibody titers and binding affinities using ELISA assay as described previously. Calculate the equilibrium dissociation constant (K_D value) of the antibodies with a four-parameter logistic equation using software.

Table 1. The specific primers used in this study.

Primer	Sequence (5'-3')
VH-VL-F	CCGGGTGGGCCGGATAGACMGATGGGGCTG
VH-VL-R	CCGGCCACATAGGCCCCACTTGACATTGATGT
pET28a (+)-F	TCCACCAGTCATGCTAGCCATAACAACGGTCGTGATTCGA
pET28a (+)-R	CTGGTGCCGCGCGGCAGCCAGTGGGATACCCGTATTACCC
pIRES2-ZsGreen1-F	CGACGGTACCGCGGGCCCGGTAACAACGGTCGTGATTCGA
pIRES2-ZsGreen1-R	GGGGGGGAGGGAGAGGGGCGGTGGGATACCCGTATTACCC

Materials

Name	Company	Catalog Number	Comments
Complete Freund's adjuvant	Sigma-Aldrich	F5881	Animal immunization
DAPI	Beyotime  Biotechnology	C1002	Nuclear counterstain
DMEM	Gibco	11965092	Cell culture
DMEM-F12	Gibco	12634010	Cell culture
Dylight 549-conjugated goat anti-mouse IgG secondary antibody	Abbkine	A23310	Indirect immunofluorescence analysis
Enhanced Cell Counting Kit-8	Beyotime  Biotechnology	C0042	Measurement of cell viability and vitality
Fetal bovine serum	Gibco	10091	Cell culture
Geneticin™ Selective Antibiotic	Gibco	11811098	Selective antibiotic
HAT Supplement (50X)	Gibco	21060017	Cell selection
HT Supplement (100X)	Gibco	11067030	Cell selection
Incomplete Freund's adjuvant	Sigma-Aldrich	F5506	Animal immunization
Isopropyl β-d-1-thiogalactopyranoside	Sigma-Aldrich	I5502	Protein expression
Kanamycin	Beyotime  Biotechnology	ST102	Bactericidal antibiotic
Leica TCS SP8 STED confocal microscope	Leica Microsystems	SP8 STED	Fluorescence imaging
Lipofectamine® 2000 Reagent	Thermofisher	11668019	Transfection
LSRFortessa™ fluorescence-activated cell sorting	BD	FACS LSRFortessa	Flow cytometry
Microplate reader	BioTek	BOX 998	ELISA analysis
Micro spectrophotometer	Thermo Fisher	Nano Drop one	Nucleic acid concentration detection
NaCl	Sinopharm Chemical Reagent	10019308	Culture broth
(NH4)2SO4	Sinopharm Chemical Reagent	10002917	Culture broth
Opti-MEM	Gibco	31985088	Cell culture
Polyethylene glycol 1500	Roche Diagnostics	10783641001	Cell fusion
PrimeScript™ 1st strand cDNA Synthesis Kit	Takara Bio	RR047	qPCR
Protein A agarose	Beyotime  Biotechnology	P2006	Antibody protein purification
Protino® Ni+-TED 2000 Packed Columns	MACHEREY-NAGEL	745120.5	Protein purification
SBA Clonotyping System-HRP	Southern Biotech	May-00	Isotyping of mouse monoclonal antibodies
Seamless Cloning Kit	Beyotime  Biotechnology	D7010S	Construction of plasmids
Shake flasks	Beyotime  Biotechnology	E3285	Cell culture
Sodium carbonate-sodium bicarbonate buffer	Beyotime  Biotechnology	C0221A	Cell culture
Trans-Blot SD Semi-Dry Transfer Cell	Bio-rad	170-3940	Western blot
Tryptone	Oxoid	LP0042	Culture broth
Ultrasonic Homogenizer	Ningbo Xinzhi Biotechnology	JY92-IIN	Sample homogenization
Yeast extract	Oxoid	LP0021	Culture broth
96-well microplate	Corning	3599	Cell culture