Materials
Name | Company | Catalog Number | Comments |
Reagent/Material | |||
Custom oligonucleotides | Eurogentec | It is necessary to obtain these at high purity e.g. with PAGE purification. | |
5'FLO | fluoresescein-5' GAACTATGGCTCTC GAGTGCTAGGACATGTCTGA CTACGTACAAGTCACC - 3' |
||
bubble | 5'- GGTGACTTGTACGT AGTCAGACATGTCCTAGCAC TCGAGAGCCATAGTTC-3' |
||
40% 19:1 Acrylamide solution | Severn Biotech | 20-2400-05 | CAUTION: potent neurotoxin so gloves should be worn at all times |
His-Trap columns (1 ml) | GE Healthcare | 17-5247-01 | |
All other reagents | any reputable supplier | Molecular biology grade is necessary (DNase-free); microfuge tubes similarly should be DNase- and RNase-free | |
Equipment | |||
Hoefer SE400 gel apparatus | Hoefer | SE400-15-1.5 | |
FLA-3000 (phosphor and fluorescence imager) | Fuji | ||
Image Reader V2.02 | FujiFilm | ||
Image Gauge V3.3 | FujiFilm |
References
- Mason, P. A., Cox, L. S. The role of DNA exonucleases in protecting genome stability and their impact on ageing. Age (Dordr. 34, 1317-1340 (2012).
- Payne, M., Hickson, I. D. Genomic instability and cancer: lessons from analysis of Bloom's syndrome). Biochem. Soc. Trans. 37, 553-559 (2009).
- Yu, C. E., Oshima, J., Fu, Y. H., Wijsman, E. M., Hisama, F., Alisch, R., Matthews, S., Nakura, J., Miki, T., Ouais, S., et al. Positional cloning of the Werner's syndrome gene. Science. 272, 258-262 (1996).
- Huang, S., Li, B., Gray, M. D., Oshima, J., Mian, I. S., Campisi, J. The premature ageing syndrome protein, WRN, is a 3'-->5' exonuclease. Nat. Genet. 20, 114-116 (1998).
- Goto, M.
Syndrome-causing mutations in Werner syndrome. Biosci. Trends. 2, 147-150 (2008). - Perry, J. J., Yannone, S. M., Holden, L. G., Hitomi, C., Asaithamby, A., Han, S., Cooper, P. K., Chen, D. J., Tainer, J. A. WRN exonuclease structure and molecular mechanism imply an editing role in DNA end processing. Nat. Struct. Mol. Biol. 13, 414-422 (2006).
- Opresko, P. L., Laine, J. P., Brosh, R. M., Seidman, M. M., Bohr, V. A. Coordinate action of the helicase and 3' to 5' exonuclease of Werner syndrome protein. J. Biol. Chem. 276, 44677-44687 (2001).
- Plchova, H., Hartung, F., Puchta, H. Biochemical characterization of an exonuclease from Arabidopsis thaliana reveals similarities to the DNA exonuclease of the human Werner syndrome protein. J. Biol. Chem. 278, 44128-44138 (2003).
- Hartung, F., Plchova, H., Puchta, H. Molecular characterisation of RecQ homologues in Arabidopsis thaliana. Nucleic Acids Res. 28, 4275-4282 (2000).
- Saunders, R. D., Boubriak, I., Clancy, D. J., Cox, L. S. Identification and characterization of a Drosophila ortholog of WRN exonuclease that is required to maintain genome integrity. Aging Cell. 7, 418-425 (2008).
- Cox, L. S., Boubriak, I. DNA Instability in Premature Aging, in DNA Damage Repair, Repair Mechanisms and Aging. Thomas, A.E., Eds. Nova Science Publishers. , 1-34 (2010).
- Cox, L. S., Clancy, D. J., Boubriak, I., Saunders, R. D. Modeling Werner Syndrome in Drosophila melanogaster: hyper-recombination in flies lacking WRN-like exonuclease. Ann. N.Y. Acad. Sci. 1119, 274-288 (2007).
- Boubriak, I., Mason, P. A., Clancy, D. J., Dockray, J., Saunders, R. D., Cox, L. S. DmWRNexo is a 3'-5' exonuclease: phenotypic and biochemical characterization of mutants of the Drosophila orthologue of human WRN exonuclease. Biogerontology. 10, 267-277 (2009).
- Mason, P. A., Boubriak, I., Robbins, T., Lasala, R., Saunders, R., Cox, L. S. The Drosophila orthologue of progeroid human WRN exonuclease, DmWRNexo, cleaves replication substrates but is inhibited by uracil or abasic sites : Analysis of DmWRNexo activity in vitro. Age (Dordr). , (2012).
- Machwe, A., Xiao, L., Orren, D. K. Length-dependent degradation of single-stranded 3' ends by the Werner syndrome protein (WRN): implications for spatial orientation and coordinated 3' to 5' movement of its ATPase/helicase and exonuclease domains. BMC Mol. Biol. 7, 6 (2006).
- Mangerich, A., Veith, S., Popp, O., Fahrer, J., Martello, R., Bohr, V. A., Burkle, A. Quantitative analysis of WRN exonuclease activity by isotope dilution mass spectrometry. Mech. Ageing Dev. 133, 575-579 (2012).
- Xue, Y., Ratcliff, G. C., Wang, H., Davis-Searles, P. R., Gray, M. D., Erie, D. A., Redinbo, M. R. A minimal exonuclease domain of WRN forms a hexamer on DNA and possesses both 3'- 5' exonuclease and 5'-protruding strand endonuclease activities. Biochemistry. 41, 2901-2912 (2002).
- Machwe, A., Ganunis, R., Bohr, V. A., Orren, D. K. Selective blockage of the 3'-->5' exonuclease activity of WRN protein by certain oxidative modifications and bulky lesions in DNA. Nucleic Acids Res. 28, 2762-2770 (2000).