ERRATUM NOTICE
Important: There has been an erratum issued for this article. Read more …
Abstract
Staphylococcen Cassette Chromosome mec (SCC mec) typen is een zeer belangrijke moleculaire tool voor het begrijpen van de epidemiologie en klonale stam verwantschap van methicilline-resistente Staphylococcus aureus (MRSA), met name de opkomende uitbraken van de gemeenschap-geassocieerde MRSA (CA-MRSA) die zich op een wereldwijde basis. Traditionele PCR typering's classificeren SCC mec door targeting en identificeerbaar is mec en ccr gen complexe vormen, maar vereisen het gebruik van veel primer sets en meerdere afzonderlijke PCR experimenten. We ontwierpen en publiceerde een eenvoudige multiplex PCR-test voor het snel-screening van grote SCC mec types en subtypes I tot V, en later bijgewerkt als beschikbaar werd nieuwe sequentie-informatie. Deze eenvoudige test richt zich op individuele SCC mec types in een enkele reactie, is het gemakkelijk te interpreteren en is uitgebreid wereldwijd gebruikt. Vanwege de verfijnde nature van de test en het grote aantal primers in de reactie, is de kans op problemen tijdens de aanpassing van deze assay aan elk laboratorium. Om het proces van de oprichting van een MRSA SCC mec test te vergemakkelijken, hier laten we zien hoe het opzetten van onze multiplex PCR-test, en bespreken een aantal van de essenti
Introduction
Methicilline-resistente Staphylococcus aureus (MRSA) is overgenomen en ge
Subscription Required. Please recommend JoVE to your librarian.
Protocol
Deze procedures moeten worden uitgevoerd in een gecertificeerde bioveiligheidsniveau 2 laboratorium. Geschikte persoonlijke beschermingsmiddelen zoals handschoenen en witte jassen moeten worden gebruikt op alle tijden.
1. Monstervoorbereiding
- Verse overnight plaat culturen van MRSA zijn vereist. Op de dag voor PCR gedaan moet worden, selecteert u een enkele kolonie van MRSA met een steriele cultuur stok en bereiden een zware streep van de bacteri
Subscription Required. Please recommend JoVE to your librarian.
Materials
Name | Company | Catalog Number | Comments |
Tryptic Soy Agar | Fisher (BD) | CA90002-700 (236920) | |
Sterile distilled water | Life Technologies | 10977-015 | |
Platinum Taq: including 10x PCR buffer and 50 mM MgCl2 | Life Technologies | 10966-034 | |
100 mM dNTP | Life Technologies | 10297-018 | |
Tris base | Sigma-Aldrich | T6066 | |
Boric acid | Sigma-Aldrich | B7901 | |
EDTA | Life Technologies | 15576-028 | |
Agarose | Life Technologies | 16500-500 | |
Glycerol | Life Technologies | 15514-011 | |
Bromophenol blue | Sigma-Aldrich | B8026 | |
1Kb+ DNA ladder | Life Technologies | 10787-026 | |
Ethidium bromide | Sigma-Aldrich | E7637 | |
1.5ml Microcentrifuge tubes | VWR (Axygen Scientific) | 10011-700 | |
Culture sticks | VWR | CA10805-018 | |
PCR tubes | Diamed | AD0210-FCN (new #: DIATEC420-1250) | |
Centrifuge | Eppendorf | 5417c | |
Heat block | VWR | 13259-030 / 13259-286 | |
Thermalcycler | Applied Biosystems (2720) | 4359659 | |
Horizontal, submersible gel electrophoresis chamber with gel mold | BioRad | 170-4469 | |
Power supply | BioRad | 164-5050 | |
Rocker shaker | VWR | 40000-300 | |
Molecular Imager Gel Doc System | BioRad | 1708170 |
References
- IWG-SCC. Classification of staphylococcal cassette chromosome mec (SCCmec): guidelines for reporting novel SCCmec elements. Antimicrobial Agents and Chemotherapy. 53 (12), 4961-4967 (2009).
- Ito, T., Hiramatsu, K., Tomasz, A., de Lencastre, H., Perreten, V., Holden, M., et al. Guidelines for Reporting Novel mecA Gene Homologues. Antimicrobial Agents and Chemotherapy. 56 (10), 4997-4999 (2012).
- Okuma, K., Iwakawa, K., Turnidge, J. D., Grubb, W. B., Bell, J. M., O'Brien, F. G., et al. Dissemination of new methicillin-resistant Staphylococcus aureus clones in the community. Journal of Clinical Microbiology. 40 (11), 4289-4294 (2002).
- Kondo, Y., Ito, T., Ma, X. X., Watanabe, S., Kreiswirth, B. N., Etienne, J., et al. Combination of multiplex PCRs for staphylococcal cassette chromosome mec type assignment: rapid identification system for mec, ccr, and major differences in junkyard regions. Antimicrobial Agents and Chemotherapy. 51 (1), 264-274 (2007).
- Oliveira, D. C., de Lencastre, H. Multiplex PCR strategy for rapid identification of structural types and variants of the mec element in methicillin-resistant Staphylococcus aureus. Antimicrobial Agents and Chemotherapy. 46 (7), 2155-2161 (2002).
- Milheirico, C., Oliveira, D. C., de Lencastre, H. Update to the multiplex PCR strategy for assignment of mec element types in Staphylococcus aureus. Antimicrobial Agents and Chemotherapy. 51 (9), 3374-3377 (2007).
- Milheirico, C., Oliveira, D. C., de Lencastre, H. Multiplex PCR strategy for subtyping the staphylococcal cassette chromosome mec type IV in methicillin-resistant Staphylococcus aureus: 'SCCmec IV multiplex'. Journal of Antimicrobial Chemotherapy. 60 (1), 42-48 (2007).
- Zhang, K., McClure, J. A., Elsayed, S., Louie, T., Conly, J. M. Novel multiplex PCR assay for characterization and concomitant subtyping of staphylococcal cassette chromosome mec types I to V in methicillin-resistant Staphylococcus aureus. Journal of Clinical Microbiology. 43 (10), 5026-5033 (2005).
- Zhang, K., McClure, J. A., Conly, J. M. Enhanced multiplex PCR assay for typing of staphylococcal cassette chromosome mec types I to V in methicillin-resistant Staphylococcus aureus. Molecular and Cellular Probes. 26 (5), 218-221 (2012).
- de Lamballerie, X., Zandotti, C., Vignoli, C., Bollet, C., de Micco, P. A one-step microbial DNA extraction method using "Chelex 100" suitable for gene amplification. Research in Microbiology. 143 (8), 785-790 (1992).
- Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. Agarose gel electrophoresis for the separation of DNA fragments. J. Vis. Exp. (62), e3923 (2012).
- McClure, J. A., Conly, J. M., Elsayed, S., Zhang, K. Multiplex PCR assay to facilitate identification of the recently described Staphylococcal cassette chromosome mec type VIII. Molecular and Cellular Probes. 24 (4), 229-232 (2010).
- Zhang, K., McClure, J. A., Elsayed, S., Conly, J. M. Novel staphylococcal cassette chromosome mec type, tentatively designated type VIII, harboring class A mec and type 4 ccr gene complexes in a Canadian epidemic strain of methicillin-resistant Staphylococcus aureus. Antimicrobial Agents and Chemotherapy. 53 (2), 531-540 (2009).
Erratum
Formal Correction: Erratum: Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus
Posted by JoVE Editors on 03/19/2019.
Citeable Link.
An erratum was issued for: Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus. There was a typo in Table 1.
In Table 1, the Oligonucleotide sequence for Type III-F5 was updated from:
TTCTCATTGATGCTGAAGCC
To:
GAAACTAGTTATTTCCAACGG