A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

Isolation of Culturable Yeasts and Molds from Soils to Investigate Fungal Population Structure

7.7K views

⸱

DOI:

10.3791/63396

⸱

May 27th, 2022

 ,  , 
1Department of Biology, McMaster University

In This Article

Summary

This protocol is an effective, speedy method of culturing yeasts and the mold Aspergillus fumigatus from large sets of soil samples in as little as 7 days. The methods can be easily modified to accommodate a range of incubation media and temperatures as needed for experiments.

Abstract

Soil is host to an incredible amount of microbial life, with each gram containing up to billions of bacterial, archaeal, and fungal cells. Multicellular fungi such as molds and unicellular fungi, broadly defined as yeasts, fulfill essential roles in soil ecosystems as decomposers of organic material and as food sources for other soil dwellers. Fungal species diversity in soil is dependent on a multitude of climatic factors such as rainfall and temperature, as well as soil properties including organic matter, pH, and moisture. Lack of adequate environmental sampling, especially in regions of Asia, Africa, South America, and Central America, hinders the characterization of soil fungal communities and the discovery of novel species.

We characterized soil fungal communities in nine countries across six continents using ~4,000 soil samples and a protocol developed in the laboratory for the isolation of yeasts and molds. This protocol begins with separate selective enrichment for yeasts and the medically relevant mold Aspergillus fumigatus, in liquid media while inhibiting bacterial growth. Resulting colonies are then transferred to solid media and further processed to obtain pure cultures, followed by downstream genetic characterization. Yeast species identity is established via sequencing of their internal transcribed spacer (ITS) region of the nuclear ribosomal RNA gene cluster, while global population structure of A. fumigatus is explored via microsatellite marker analysis.

The protocol was successfully applied to isolate and characterize soil yeast and A. fumigatus populations in Cameroon, Canada, China, Costa Rica, Iceland, Peru, New Zealand, and Saudi Arabia. These findings revealed much-needed insights on global patterns in soil yeast diversity, as well as global population structure and antifungal resistance profiles of A. fumigatus. This paper presents the method of isolating both yeasts and A. fumigatus from international soil samples.

Introduction

Fungi in soil ecosystems play essential roles in organic matter decomposition, nutrient cycling, and soil fertilization1. Both culture-independent (i.e., high-throughput sequencing) and culture-dependent approaches are widely used in the study of soil fungi2,3. While the large amount of data generated by high-throughput metabarcode sequencing is useful for elucidating broad-scale patterns in community structure and diversity, the culture-dependent approach can provide highly complementary information on the taxonomic and functional structures of fungal communities, as well as more specific profiles of individual organisms through downstream diversity and functional analyses due to the availability of pure fungal cultures.

Despite rarely exceeding thousands of cells per gram of soil, yeasts, broadly defined as unicellular fungi, are essential decomposers and food sources for other soil dwellers4,5. In fact, yeasts may be the predominant soil fungi in cold biospheres such as continental Antarctica6,7. Soil is also a primary reservoir of medically relevant yeasts that cause serious opportunistic infections in humans and other mammals8. Despite morphological similarities, yeast species are phylogenetically diverse and occur among filamentous fungi in two major phyla, Ascomycota and Basidiomycota, within the fungal kingdom9. Yeasts lack a defining DNA signature at the fungal barcoding gene, the internal transcribed spacer (ITS) region of the nuclear ribosomal RNA gene cluster10, making them indistinguishable from other fungi in metagenomics investigations and thus necessitating the use of culture-dependent methods to isolate yeast species.

The protocol below was implemented to characterize soil yeast communities of nine countries and identify global trends and patterns in soil yeast diversity9,11,12. Metagenomics approaches are of limited use when studying targeted groups of organisms such as yeasts2,3. Due to their phylogenetic diversity, yeasts cannot be distinguished from other fungi based on DNA sequence alone. Thus, studying yeast populations requires the continued use of culture-dependent isolation. However, culturing is often significantly more time-consuming and requires more personnel to perform the experiments. Therefore, the protocol has been optimized and streamlined for faster processing with limited personnel. The main advantage of culturing is that the yeast species identified are living yeasts and not dead ones, and thus are more likely to be true soil dwellers rather than transient cells present in the soils. It has been estimated that approximately 40% of fungal DNA in soil are either contaminants from other environments, extracellular, or come from cells that are no longer intact, causing high-throughput sequencing approaches to overestimate fungal richness by as much as 55%13. Culture-dependent isolation can readily confirm yeast species identity with the added benefit of securing pure culture to be used in downstream analyses. Indeed, pure cultures of 44 putative new yeast species were identified using this soil isolation protocol that allowed the use of a range of methods to study their taxonomic and functional properties in detail14.

The protocol below can also be used to isolate molds present within soil, such as A. fumigatus. Aspergillus fumigatus is a thermophilic and saprophytic mold with a wide, global distribution in soil15. It has been isolated from numerous clinical and non-clinical environments. Non-clinical sampling commonly includes air, organic debris (compost, saw dust, tulip bulb waste), and soil (agricultural, garden, and natural soils)16,17,18,19. Aspergillus fumigatus is a human opportunistic pathogen causing a range of infections collectively termed aspergillosis, affecting over 8 million people worldwide16,20. Approximately 300,000 people around the globe suffer from invasive aspergillosis, which is the most severe form of aspergillosis16. Depending on factors such as the patient population, site of infection, and efficacy of antifungal therapy, mortality rate can be as high as 90%. Over the past several decades, resistance to antifungal therapies has increased, requiring global surveillance efforts in both clinical and environmental populations to track these resistance genotypes21,22,23. Given its ability to grow at temperatures upward of 50 °C, this temperature can be exploited to select for A. fumigatus isolates from soil using culture-dependent methods. Aspergillus fumigatus isolates are commonly genotyped at nine highly polymorphic short tandem repeat (STR) loci, shown to have high discriminatory power between strains24. These STR genotypes can be compared to other previously surveyed populations to track the spread of A. fumigatus genotypes, including drug-resistance genes, around the world.

Below we describe a protocol for the speedy isolation of yeasts and A. fumigatus from soil samples in a culture-dependent manner. Depending on the amount of soil obtained per sample, the soil samples can be shared between the two protocols. In comparison to similar methods that isolate yeast and A. fumigatus from soil, this protocol uses 10x less soil per isolate obtained. Studies attempting to isolate A. fumigatus from soil require between 1 and 2 g of soil per isolate, whereas this protocol requires only 0.1-0.2 g of soil18,19,25. This protocol utilizes smaller plastics and containers that facilitate its high-throughput design. Therefore, a larger number of samples can be processed using less space for equipment such as incubators and roller drums. Soil samples can be fully processed to obtain isolates in as little as 7 days. This protocol has been optimized to allow processing of up to 150-200 samples per day per person.

Access restricted. Please log in or start a trial to view this content.

Protocol

NOTE: Any steps utilizing international soil samples and/or A. fumigatus spores and mycelia require working within a biosafety cabinet for level 2 organisms (BSCII).

1. Isolation of yeast from soil

  1. Preparation of antibacterial and antifungal solutions
    1. Suspend chloramphenicol powder in 70% ethanol to prepare a 50 g/L stock solution. Sterilize by syringe filtration and store at 4 °C.
      ​NOTE: This antibiotic will prevent the growth of most bacteria during soil yeast isolation. As chloramphenicol-resistant bacteria may still grow, colony morphology must be carefully taken into consideration when distinguishing yeasts from bacteria. Additional antibiotics may be added to media when working with soil suspected of containing antibiotic-resistant bacterial strains. Bacterial contamination in chloramphenicol-supplemented media was not an issue encountered when isolating yeasts from environmental soils.
    2. Suspend benomyl powder in DMSO to prepare a 5 g/L stock solution. Sterilize by syringe filtration and store at 4 °C.
      NOTE: This selective antifungal drug prevents the growth of most filamentous fungi without affecting yeast growth during soil yeast isolation26,27.
  2. Preparation of culture media and sterile equipment
    1. To prepare YEPD (Yeast Extract-Peptone-Dextrose) broth, add 10 g of Yeast Extract, 20 g of peptone, and 20 g of dextrose to 1 L of double-distilled water. Stir until well-mixed and autoclave for 40 min at 121 °C. Store at room temperature until use.
    2. YEPD solid agar medium
      1. Mix 10 g of yeast extract, 20 g of peptone, 20 g of dextrose, and 20 g of agar in 1 L of water. Stir well to mix and autoclave for 40 min at 121 °C.
      2. Once sufficiently cooled, add 1 mL of chloramphenicol and benomyl from stock solutions to bring the final concentrations of the two antimicrobials to 50 mg/L and 5 mg/L, respectively.
      3. Mix well by stirring and pour into 10 cm diameter Petri dishes. Leave at room temperature overnight to set and store at 4 °C until use.
        NOTE: From 1 L of YEPD, approximately 40 plates can be poured.
    3. Sterilize wooden plain-tipped applicator sticks and reusable cell spreaders by autoclaving and store at room temperature.
  3. Incubation of soil in liquid broth
    1. Prepare a set of sterile 13 mL culture tubes by labeling them with soil sample ID.
    2. Using a serological pipette, add 5 mL of YEPD broth supplemented with chloramphenicol and benomyl into each tube.
    3. Working in a BSCII, transfer ~0.1 g of soil into the appropriate culture tube using a sterile, wooden plain-tipped applicator.
      NOTE: Use a fresh applicator for each soil sample and discard immediately upon use to avoid cross-contamination between samples.
    4. Cap the tube securely to the first stop to prevent spillage but still allow air exchange during incubation. Incubate the culture tubes in a roller drum for 24 h at a temperature deemed optimum for maximizing yeast growth.
      NOTE: The incubation temperature should be decided based on the mean annual temperature of the soil samples' country of origin. For example, when isolating soil yeasts from Iceland, the culture tubes were incubated at 14 °C, whereas soils from Saudi Arabia were incubated at 30 °C. Due to slower yeast growth at lower temperatures, incubation time might have to be extended for up to 72 h.
  4. Transfer the supernatant to the solid medium.
    1. Using the set of YEPD + chloramphenicol + benomyl agar plates prepared in Step 1.2, label them with the soil sample ID.
    2. Remove the culture tubes prepared in Step 1.3 from the roller drum. Working in a BSCII, briefly vortex the tube to draw soil particles and cells that may have settled at the bottom back into suspension.
    3. Using a micropipette, transfer 100 µL of the supernatant onto a plate. Use a sterile, reusable cell spreader to spread the liquid thoroughly and evenly over the agar surface.
      NOTE: Working in sets of 10 samples can significantly speed up this process. Pipette the supernatant onto 10 plates first and then perform spreading. Use a fresh spreader for each sample to avoid cross-contamination between samples.
    4. Stack the plates in plastic bags, seal, and incubate upside down for 2-3 days at the same temperature used previously for liquid broth incubation until microbial growth is visible.
  5. Detection of yeasts and streaking for single colonies
    1. After allowing for sufficient incubation time (typically 2-3 days, but may take longer at lower temperatures), inspect the plates in a BSCII for any yeast growth. Look for creamy, round, matte-like yeasts that are easily distinguished from bacterial and mold colonies.
      NOTE: Some yeasts produce colored pigments and may appear black/brown, yellow, or red, but their overall colony texture and shape would be similar to non-pigmented yeasts.
    2. Select one yeast-like colony from each plate for further processing.
      NOTE: If more than one type of morphology is observed on a single plate, select one representative colony for each morphological type.
    3. Using sterile, wooden plain-tipped applicator sticks, transfer each selected colony onto a fresh YEPD + chloramphenicol + benomyl plate and streak for single colonies. Perform three separate streaks.
      1. Streak back and forth over a third of the plate using an applicator stick. Begin the second and third streak by streaking the applicator across the preceding streak once. Use a new applicator stick for every streak.
        NOTE: Use one plate per isolate. Discard applicators immediately upon use to avoid cross-contamination between samples.
    4. Stack the plates in plastic bags, seal, and incubate upside down for 2-3 days at the same temperature used previously until single colonies become visible.
  6. Identification of yeast species via ITS sequencing
    1. Select a well-separated, single colony per soil isolate and subculture onto a fresh YEPD + chloramphenicol + benomyl plate to obtain more cells. Incubate for 2-3 days at the same temperature used previously.
    2. Harvest the freshly grown cells and suspend them in -80 °C freezer tubes containing 1 mL of sterilized 30% glycerol in double-distilled water to create cell suspensions. Maintain these suspensions at -80 °C as stock solutions.
    3. Use fresh cells to perform colony PCR (polymerase chain reaction) with primers ITS1 (5' TCCGTAGGTGAACCTGCGG 3') and ITS4 (5' TCCTCCGCTTATTGATATGC 3') to amplify the fungal barcoding gene, ITS9. Use the following thermocycling conditions: an initial denaturation step at 95 °C for 10 min followed by 35 cycles of (i) 95 °C for 30 s, (ii) 55 °C for 30 s, and (iii) 72 °C for 1 min.
      NOTE: Colony PCR has a high success rate and a faster turnaround time than DNA extraction followed by PCR.
    4. If colony PCR repeatedly fails for a strain, extract DNA using the protocol of choice and perform ITS PCR using extracted genomic DNA as template (use same thermocycling conditions as above).
      NOTE: A relatively inexpensive chloroform-based DNA extraction is recommended28.
    5. Perform Sanger sequencing to determine the DNA sequence of the amplified ITS region for each strain.
    6. Compare the obtained ITS sequence of the yeast strains to sequences deposited in public databases such as NCBI GenBank and UNITE to establish species identity.

2. Isolation of Aspergillus fumigatus from soil

  1. Prepare 1 mL of sterile Sabouraud dextrose broth (SDB) supplemented with the antibiotic chloramphenicol per soil sample.
    1. Add 10 g of peptone and 20 g of dextrose to 1 L of distilled water. Autoclave at 121 °C for 40 min.
    2. Allow the SDB to cool to ~50 °C, add 1 mL of 50 g/L chloramphenicol to bring the concentration to 50 mg/L.
      NOTE: Chloramphenicol is prepared the same as described above for yeast isolation. Aside from inhibiting bacterial growth, chloramphenicol also prevents the production of gas from bacteria that will cause the tubes to open during the incubation step detailed in Step 2.2.
    3. Aseptically aliquot 1 mL of SDB into a 1.5 mL microcentrifuge tube per soil sample using a mechanical pipette.
  2. Add soil to 1.5 mL microcentrifuge tubes.
    1. Lay bench coat or absorbent padding inside a BSCII to aid in the disposal of spilt soil.
    2. Using autoclaved applicator sticks, transfer approximately 0.1 g of soil into a 1.5 mL microcentrifuge tube containing 1 mL of SBD. Close the tube and vortex. Incubate the suspended soil at 50 °C for 3 days.
      NOTE: Shaking during incubation is not required.
  3. Mycelial harvest of soil-inoculated broth
    1. Prepare malt extract agar (MEA) plates.
      1. Per liter of MEA: add 20 g of malt extract, 20 g of dextrose, 6 g of peptone, and 15 g of agar to 1 L of distilled water. Autoclave at 121 °C for 40 min.
      2. Allow the MEA to cool to ~50 °C, then add 1 mL of 50 g/L chloramphenicol to bring to a final concentration of 50 mg/L.
    2. Transfer the mycelia from the soil-inoculated broth onto MEA plates.
      1. Identify soil inoculums that have visible mycelial growth at the SDB to air boundary.
      2. Use sterilized wooden plain-tipped applicator sticks to transfer the mycelia to the center of a MEA plate. Incubate the MEA plates at 37 °C for 3 days.
  4. Selection of mycelia with A. fumigatus morphological properties.
    1. Identify mold colonies that have characteristic A. fumigatus morphological properties (green suede like growth).
    2. Working in a BSCII, use sterilized wooden plain-tipped applicator sticks or an inoculation loop to harvest conidia/mycelia by scraping the surface once. Transfer the spores/mycelia to the center of a MEA plate by streaking onto the agar for single colonies. Incubate at 37 °C for 2 days.
      NOTE: As multiple A. fumigatus strains and/or other fungi may be present on the plate, it is important to streak for single colonies. The single-colony streaking protocol in Step 1.5.3 in the yeast isolation protocol can be used.
    3. Using a sterile applicator stick or inoculation loop, subculture a single colony generated in Step 2.4.1.2 onto MEA by streaking the colony once. Spread the harvested spores into the center of the plate. Incubate at 37 °C for 2 days.
  5. Harvesting of A. fumigatus spores/mycelia for culture storage
    1. Prepare a sterile 30% glycerol solution (for a 100 mL solution, add 30 mL of 100% glycerol mixed with 70 mL of double-distilled water, sterilized at 121 °C for 40 min).
    2. Working in a BSCII, use a p1000 pipette to aspirate 1 mL of the 30% glycerol solution. Dispense the 1 mL of glycerol solution onto the A. fumigatus colony to harvest spores/mycelia.
      1. Due to the hydrophobicity of A. fumigatus spores/mycelia, use the pipette tip to scratch a densely sporulated region of the plate.
        NOTE: When glycerol is dispensed in the scratch, the glycerol would adhere to the scratch area rather than rolling over the agar.
      2. Slowly dispense the glycerol onto the scratch area to dislodge the spores and suspend them in the glycerol solution.
      3. Once fully dispensed, lightly tip the plate and aspirate the glycerol spore/mycelia suspension.
        NOTE: Approximately 750 to 800 µL will be aspirated.
      4. Transfer the aspirate to a sterile freezer tube and store at -80 °C. If required, create working stock by repeating steps 2.5.2.1 to 2.5.2.4.
  6. Phenotypic identification of A. fumigatus strains
    1. Using the spore stock created from step 2.5.2, create a 100x dilution in water.
      1. Aspirate 10 µL of the mycelial and spore stocks and dispense in 990 µL of water. Vortex the suspension.
    2. Dispense 10 µL of the diluted spore suspension onto a standard microscope slide.
    3. OPTIONAL: Stain the mycelial and spore suspension with methylene blue.
      1. To stain with methylene blue, fix the conidia and conidiophores to the slide by passing the slide over a Bunsen burner until dry.
      2. Apply methylene blue for 1-2 min and wash off with water.
      3. Dry the slide with blotting paper.
    4. Using a compound microscope at 400x magnification, view the suspension and locate conidiophores. Compare the observed conidiophore morphology with A. fumigatus conidiophore morphology.
  7. Molecular identification of A. fumigatus strains
    1. Extract DNA from each isolate following common fungal DNA extraction protocols.
    2. Using primers specific to the Aspergillus β-tubulin genes (β-tub1 and β-tub4), run PCR and obtain the sequence for the amplified products, following protocols described by Alcazar-Fuoli et al.17.
      1. Compare the obtained sequences to sequences deposited in public databases such as NCBI GenBank using BLAST.
      2. Confirm the strain sequences are a top match to A. fumigatus sequences in the database.
    3. Alternative to step 2.7.2, run a multiplex PCR reaction targeting the A. fumigatus mating types MAT1-1 and MAT1-229.
      1. Use the following three primer sequences in the multiplex PCR reaction: AFM1: 5'-CCTTGACGCGATGGGGTGG-3'; AFM2: 5′-CGCTCCTCATCAGAACAACTCG-3′; AFM3: 5′-CGGAAATCTGATGTCGCCACG-3′.
      2. Use the following thermocycler parameters: 5 min at 95 °C, 35 cycles of 30 s at 95 °C, 30 s at 60 °C, and 1 min at 72 °C before a final 5 min at 72 °C.
      3. Run gel electrophoresis to identify the products; look for 834 bp MAT-1 or 438 bp MAT1-2. Use A. fumigatus strains that have confirmed mating type amplification as positive and negative controls.
  8. Microsatellite genotyping of A. fumigatus strains through fragment analysis
    NOTE: Although the steps listed below broadly cover genotyping A. fumigatus at nine microsatellite (STR) loci, only a few important considerations have been highlighted. For details on A. fumigatus STR genotyping, refer to De Valk et al.24,30.
    1. Prepare three PCR multiplex master mixes using the STRAf primers previously described by De Valk et al.24.
      1. Fluorescently label forward primers to determine fragment size through capillary electrophoresis. Ensure that the concentration of the forward primers is half (0.5 μM) that of the reverse primers (1 μM) within the master mix.
        NOTE: For the best results, use fluorescent labels that have absorbance wavelengths that match those of the chosen dye standard used during capillary electrophoresis
      2. Use hot start polymerase for best results.
      3. Use a DNA concentration of 0.1 ng per reaction.
    2. Run the multiplex PCR for each strain using the following PCR program: 95 °C for 10 min, 40 cycles of 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 60 s, followed by 72 °C for 10 min and a hold at 4 °C.
    3. Check for amplified products through gel electrophoresis.
    4. Dilute the products to the desired level (typically ~50x) as recommended by fragment analyses specialists and run capillary electrophoresis. Perform three runs for each strain, with each run covering three multiplexed reactions with three different fluorescent probes.
    5. To determine the correct fragment size for each of the nine STR loci, use software capable of fragment analysis.
      1. Retrieve the raw data obtained from capillary electrophoresis. Score the fragment sizes based on the largest peak using the fragment analysis software (e.g., Osiris).
      2. Convert the fragment sizes to repeat numbers for each of the nine loci. Use the fragment sizes of the repeat numbers of the reference strain Af293 as previously described by De Valk et al.24.
        NOTE: Slight variations in fragment sizes may occur between different capillary electrophoresis platforms. Thus, it is important to include a common reference strain (and an internal ladder) with known fragment size for each of the nine loci for genotyping strains.

Access restricted. Please log in or start a trial to view this content.

Results

Yeast isolation from soil
The above yeast isolation protocol was implemented to culture yeasts from soil samples originating from 53 locations in nine countries9,12. In total, 1,473 yeast strains were isolated from 3,826 soil samples. Given the different climatic conditions of the nine originating countries, the best incubation temperature for each country was determined based on its mean annual temperature (Table 1). Given t...

Access restricted. Please log in or start a trial to view this content.

Discussion

The protocol developed for isolating yeasts and A. fumigatus from soil is a fast and efficient method for high-throughput soil processing and fungal isolation. The protocol only requires a small amount of soil (0.1-0.2 g) per sample, allowing for more sites to be sampled with similar effort. The quick turnaround time ensures that results can be obtained within a short timeframe and allows time for troubleshooting and repeating experiments if necessary. This protocol can be easily replicated across many laborator...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors have no conflicts of interest to declare.

Acknowledgements

This research was supported by grants from the Natural Sciences and Engineering Research Council of Canada (Grant No. ALLRP 570780-2021) and McMaster University.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
1.5 mL microcentrifuge tubeSarstedt Inc72.690.001
Benomyl powder Toronto Research ChemicalsB161380
Chloramphenicol powder Sigma-AldrichSKU: C0378-5G
DextroseSigma-AldrichSKU: D9434-500G
Fragment Analysis SoftwareNCBI's Osirishttps://www.ncbi.nlm.nih.gov/osiris/
ITS sequence databaseNCBI GenBank https://www.ncbi.nlm.nih.gov/genbank/
ITS sequence databaseUNITE https://unite.ut.ee/
PeptoneSigma-AldrichSKU: P5905-500G
Reusable cell spreaders Fisher Scientific08-100-12
Sterile 10 cm diameter Petri dishes Sarstedt Inc83.3902
Sterile 13 mL culture tubes Sarstedt Inc62.515.006
Wooden plain-tipped applicator sticks Fisher Scientific23-400-112
Yeast extractSigma-AldrichSKU: Y1625-250G

References

  1. Frac, M., Hannula, S. E., Belka, M., Jȩdryczka, M. Fungal biodiversity and their role in soil health. Frontiers in Microbiology. 9, 707(2018).
  2. Tedersoo, L., et al. Global diversity and geography of soil fungi. Science. 346 (6213), 1256688(2014).
  3. Egidi, E., et al. A few Ascomycota taxa dominate soil fungal communities worldwide. Nature Communications. 10 (1), 1-9 (2019).
  4. Yurkov, A. M. Yeasts of the soil - obscure but precious. Yeast. 35 (5), 369-378 (2018).
  5. Botha, A. The importance and ecology of yeasts in soil. Soil Biology and Biochemistry. 43 (1), 1-8 (2011).
  6. Connell, L., et al. Diversity of soil yeasts isolated from South Victoria Land, Antarctica. Microbial Ecology. 56 (3), 448-459 (2008).
  7. Vishniac, H. S. A multivariate analysis of soil yeasts isolated from a latitudinal gradient. Microbial Ecology. 52 (1), 90-103 (2006).
  8. Kurtzman, C., Fell, J. W., Boekhout, T. The Yeasts: A Taxonomic Study. , Elsevier. (2011).
  9. Samarasinghe, H., et al. Global patterns in culturable soil yeast diversity. iScience. 24 (10), 103098(2021).
  10. Xu, J. Fungal DNA barcoding. Genome. 59 (11), 913-932 (2016).
  11. Samarasinghe, H., Aljohani, R., Jimenez, C., Xu, J. Fantastic yeasts and where to find them: the discovery of a predominantly clonal Cryptococcus deneoformans population in Saudi Arabian soils. FEMS Microbiology Ecology. 95 (9), 122(2019).
  12. Aljohani, R., Samarasinghe, H., Ashu, T., Xu, J. Diversity and relationships among strains of culturable yeasts in agricultural soils in Cameroon. Scientific Reports. 8 (1), 1-11 (2018).
  13. Carini, P., et al. Relic DNA is abundant in soil and obscures estimates of soil microbial diversity. Nature Microbiology. 2 (3), 1-6 (2016).
  14. Xu, J. Fungal species concepts in the genomics era. Genome. 63 (9), 459-468 (2020).
  15. Brakhage, A. A., Langfelder, K. Menacing mold: The molecular biology of Aspergillus fumigatus. Annual Review of Microbiology. 56 (1), 433-455 (2002).
  16. Bongomin, F., Gago, S., Oladele, R., Denning, D. Global and multi-national prevalence of fungal diseases-Estimate precision. Journal of Fungi. 3 (4), 57(2017).
  17. Alcazar-Fuoli, L., Mellado, E., Alastruey-Izquierdo, A., Cuenca-Estrella, M., Rodriguez-Tudela, J. L. Aspergillus section Fumigati: Antifungal susceptibility patterns and sequence-based identification. Antimicrobial Agents and Chemotherapy. 52 (4), 1244-1251 (2008).
  18. Rocchi, S., Godeau, C., Scherer, E., Reboux, G., Millon, L. One year later: The effect of changing azole-treated bulbs for organic tulips bulbs in hospital environment on the azole-resistant Aspergillus fumigatus rate. Medical Mycology. 59 (7), 741-743 (2021).
  19. Chowdhary, A., et al. Clonal expansion and emergence of environmental multiple-triazole-resistant Aspergillus fumigatus strains carrying the TR34/L98H mutations in the cyp51A gene in India. PLoS ONE. 7 (12), 52871(2012).
  20. Kwon-Chung, K. J., Sugui, J. A. Aspergillus fumigatus-what makes the species a ubiquitous human fungal pathogen. PLoS pathogens. 9 (12), 1003743(2013).
  21. Sewell, T. R., et al. Nonrandom distribution of azole resistance across the global population of Aspergillus fumigatus. mBio. 10 (3), 00392(2019).
  22. Ashu, E. E., Hagen, F., Chowdhary, A., Meis, J. F., Xu, J. Global population genetic analysis of Aspergillus fumigatus. mSphere. 2 (1), 00019(2017).
  23. Heo, S. T., et al. Changes in in vitro ausceptibility patterns of Aspergillus to triazoles and correlation with aspergillosis outcome in a tertiary care cancer center, 1999-2015. Clinical Infectious Diseases. 65 (2), 216-225 (2017).
  24. de Valk, H. A., et al. Use of a novel panel of nine short tandem repeats for exact and high-resolution fingerprinting of Aspergillus fumigatus isolates. Journal of Clinical Microbiology. 43 (8), 4112-4120 (2005).
  25. Yurkov, A. M., Kemler, M., Begerow, D. Assessment of yeast diversity in soils under different management regimes. Fungal Ecology. 5 (1), 24-35 (2012).
  26. Calhelha, R. C., Andrade, J. V., Ferreira, I. C., Estevinho, L. M. Toxicity effects of fungicide residues on the wine-producing process. Food Microbiology. 23 (4), 393-398 (2006).
  27. Thomas, J. H., Neff, N. F., Botstein, D. Isolation and characterization of mutations in the Β-tubulin gene of Saccharomyces cerevisiae. Genetics. 111 (4), 715-734 (1985).
  28. Xu, J., Ramos, A. R., Vilgalys, R., Mitchell, T. G. Clonal and spontaneous origins of fluconazole resistance in Candida albicans. Journal of Clinical Microbiology. 38 (3), 1214(2000).
  29. Paoletti, M., et al. Evidence for sexuality in the opportunistic fungal pathogen Aspergillus fumigatus. Current Biology. 15 (13), 1242-1248 (2005).
  30. De Valk, H. A., Meis, J. F. G. M., De Pauw, B. E., Donnelly, P. J., Klaassen, C. H. W. Comparison of two highly discriminatory molecular fingerprinting assays for analysis of multiple Aspergillus fumigatus isolates from patients with invasive aspergillosis. Journal of Clinical Microbiology. 45 (5), 1415-1419 (2007).
  31. Bates, D., Mächler, M., Bolker, B. M., Walker, S. C. Fitting linear mixed-effects models using lme4. Journal of Statistical Software. 67 (1), 1-48 (2015).
  32. Camacho, C., Madden, T., Tao, T., Agarwala, R., Morgulis, A. BLAST ® Command Line Applications User Manual. National Center for Biotechnology Information. , 1-95 (2022).
  33. Ashu, E. E., Korfanty, G. A., Xu, J. Evidence of unique genetic diversity in Aspergillus fumigatus isolates from Cameroon. Mycoses. 60 (11), 739-748 (2017).
  34. Korfanty, G. A., Dixon, M., Jia, H., Yoell, H., Xu, J. Genetic diversity and dispersal of Aspergillus fumigatus in Arctic soils. Genes. 13 (1), 19(2021).
  35. Snelders, E., et al. Possible environmental origin of resistance of Aspergillus fumigatus to medical triazoles. Applied and Environmental Microbiology. 75 (12), 4053-4057 (2009).
  36. Wang, H. -C., et al. mechanisms and genetic relatedness of the human pathogenic fungus Aspergillus fumigatus exhibiting resistance to medical azoles in the environment of Taiwan. Environmental Microbiology. 20 (1), 270-280 (2018).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Explore More Articles

Soil Fungal DiversityYeast IsolationMold IsolationAspergillus FumigatusSoil Microbial CommunitiesInternal Transcribed SpacerMicrosatellite Marker AnalysisSelective EnrichmentPure Culture IsolationAntifungal Resistance
Isolation of Culturable Yeasts and Molds from Soils to Investigate Fungal Population Structure
Contact Us
Recommend to Library

Privacy

Terms of Use

Policies

Copyright © 2026 MyJoVE Corporation. All rights reserved.