The Journal of Visualized Experiments (JoVE) is a peer reviewed, PubMed-indexed video journal. Our mission is to increase the productivity of scientific research.
1Department of Radiation Oncology, Beth Israel Deaconess Medical Center, Harvard Medical School, 2Department of Medicine, Division of Geriatric Medicine and Pittsburgh Institute for Neurodegenerative Diseases, University of Pittsburgh
This article is a part of JoVE General. If you think this article would be useful for your research, please recommend JoVE to your institution's librarian.
Recommend JoVE to Your LibrarianCurrent Access Through Your IP Address
Current Access Through Your Registered Email Address
Zhang, Y., Kashyap, L., Ferguson, A. A., Fisher, A. L. The Production of C. elegans Transgenes via Recombineering with the galK Selectable Marker. J. Vis. Exp. (47), e2331, doi:10.3791/2331 (2011).
The creation of transgenic animals is widely utilized in C. elegans research including the use of GFP fusion proteins to study the regulation and expression pattern of genes of interest or generation of tandem affinity purification (TAP) tagged versions of specific genes to facilitate their purification. Typically transgenes are generated by placing a promoter upstream of a GFP reporter gene or cDNA of interest, and this often produces a representative expression pattern. However, critical elements of gene regulation, such as control elements in the 3' untranslated region or alternative promoters, could be missed by this approach. Further only a single splice variant can be usually studied by this means. In contrast, the use of worm genomic DNA carried by fosmid DNA clones likely includes most if not all elements involved in gene regulation in vivo which permits the greater ability to capture the genuine expression pattern and timing. To facilitate the generation of transgenes using fosmid DNA, we describe an E. coli based recombineering procedure to insert GFP, a TAP-tag, or other sequences of interest into any location in the gene. The procedure uses the galK gene as the selection marker for both the positive and negative selection steps in recombineering which results in obtaining the desired modification with high efficiency. Further, plasmids containing the galK gene flanked by homology arms to commonly used GFP and TAP fusion genes are available which reduce the cost of oligos by 50% when generating a GFP or TAP fusion protein. These plasmids use the R6K replication origin which precludes the need for extensive PCR product purification. Finally, we also demonstrate a technique to integrate the unc-119 marker on to the fosmid backbone which allows the fosmid to be directly injected or bombarded into worms to generate transgenic animals. This video demonstrates the procedures involved in generating a transgene via recombineering using this method.
Overview
Many transgenes used in the generation of transgenic C. elegans consist of promoter sequences and perhaps a gene cDNA cloned into one of the vectors generated by the lab of Dr. Andy Fire 1. While these transgenes are often successful with regards to producing a GFP reporter gene or expressing a cDNA in a desired pattern, these transgenes can lack the alternate promoters, enhancer elements, and 3' untranslated region (UTR) elements which play important roles in the control of gene expression in vivo 2. For example, both the daf-12 and fah-1 genes have important enhancer elements which lie outside of the proximal promoter which were missed in promoter only constructs 3,4,5. Further many transgene constructs use the unc-54 3'UTR which prevents regulation by the appropriate microRNA genes 6,7,8. Consequently, generating transgenes with large segments of worm genomic DNA would be ideal for capturing all of promoters, splice variants, and 3' UTR control elements. Recently a C. elegans fosmid library which consists of ~40 kb regions of genomic DNA and covers almost all of the genome has been constructed. The use of worm genomic DNA carried by these fosmid DNA clones results in the greater ability to capture the genuine expression pattern and timing of specific genes 2,8,9,10,11.
However, working with large regions of genomic DNA poses practical challenges such as the great difficulties in using standard molecular biology techniques 12. To overcome these limitations, techniques to modify fosmids or bacterial artificial chromosomes via homologous recombination in E. coli have been developed and are termed recombineering 12,13. Recombineering allows the seamless insertion of GFP, a tandem affinity purification (TAP)-tag, or other sequences of interest into any location in the gene carried by the C. elegans fosmid clone 2,10,14. Homologous recombination occurs between a PCR product flanked by 50 bp regions of homology to the target site and the target DNA in specially modified E. coli strains.
We have recently described a two-stage procedure for the modification of C. elegans fosmids by recombineering which involves inserting the galK gene at the desired location and then replacing this gene with the desired sequence 2. The galK gene serves as an effective selection marker for both steps in the process as it can be selected for and against via the use of selective growth medium 15. In the first stage of fosmid modification, the galK gene is inserted via homologous recombination at the desired location, and the correctly modified fosmids identified by positive selection for the ability to utilize galactose as a carbon source 2,15. In the second stage, the galK gene is replaced by the desired sequence, and the correctly modified fosmids are identified through negative selection against the galK gene through use of the toxic galactose derivative deoxygalactose which kills galK+ bacteria 2,15. An advantage of the galK is the ability of a single gene to be used for the positive and negative selection steps, instead of other markers which have separate genes for each step, and results in obtaining the desired modification with high efficiency 2,15.
To facilitate the application of this technique to C. elegans research, we made several changes to the available resources. First, the GFP and TAP tags are commonly used to generate worm transgenes, so we built in 50 bp regions of homology to each of these tags into the pMOD4 galK-G and pMOD4 galK-GT plasmids which serve as the source of the galK gene 2. These regions allow a single set of oligos to be used for both stages of the fosmid modification which saves the need to order a second set of somewhat expensive oligos. Second, these plasmids use the R6K replication origin which precludes the need for digesting the parent plasmid or extensive PCR product purification as the parent plasmid is not able to replicate in the bacteria used for recombineering, and can only replicate in special strains such as EC100 2,16 (Table 1 and Table 2). Finally, a common way of generating transgenic C. elegans is through the use of biolistic bombardment followed by selection for transgenic worms via the rescue of the unc-119 mutation 17. To make the fosmids compatible with bombardment, we developed the pLoxP unc-119 plasmid which can be used to integrate the unc-119 marker on to the fosmid backbone 2.
I. Oligo Design
With recombineering the desired sequences can be inserted at any site within the gene. Common sites are at the 5' end or 3' end depending on functional domains, splice variants, or post-translational modifications such as cleavage by proteases. The pMOD4 GFP plasmid created by our lab can be used to insert a FLAG-tagged GFP at any site as the plasmid includes an initiator codon and lacks a 3' stop codon (Figure 1). In contrast, the TAP tag has specific versions for 5' and 3' fusions due to TEV cleavage used during purification 18,19.
II. Transfer Fosmid to SW016 Bacteria
The fosmids from the C. elegans fosmid library are provided in the EPI300 bacterial strain (F-mcrA Δ(mrr-hsdRMS-mcrBC) φ80dlacZΔM15 ΔlacX74 recA1 endA1 araD139 Δ(ara, leu)7697 galU galK λ- rpsL nupG trfA tonA) (Epicentre Biotechnologies, Madison, WI) which allows the fosmid expression to be increased above a single copy per cell to improve DNA yields during purification (Table 2). For recombineering, the fosmid will need to be transferred to the SW106 bacterial strain (mcrA Δ(mrr-hsdRMS-mcrBC) ΔlacX74 deoR endA1 araD139 Δ(ara, leu) 7697 rpsL recA1 nupG φ80dlacZΔM15 [λc1857 (cro-bioA)<>Tet] (cro-bioA)<>araC-PBAD Cre ΔgalK) (NCI-Frederick) strain which carries the λred homologous recombination genes under the control of a temperature sensitive λ repressor and an arabinose inducible cre recombinase (Table 2) 15.
III. Insertion of galK Gene by Recombineering
In the first stage of fosmid modification, the galK gene is inserted into the fosmid by homologous recombination, and the correctly modified fosmids are selected for by growth on minimal media containing galactose as the sole carbon source (Figure 2A). The SW106 bacteria grow slowly on the minimal media and 3-5 days are required to see colonies.
| 100 mL | 10X MOPS minimal media |
| 5 mL | 0.2 mg/ml d-biotin (sterile filtered) |
| 4.5 mL | 10 mg/ml L-leucine (1%, heated, then cooled down and sterile filtered) |
| 10 mL | 20% galactose (autoclaved) |
| 1 mL | 12.5 mg/ml Chloramphenicol in EtOH |
| 2.55 mL | 20% NH4Cl |
| 10 mL | 0.132 M dibasic potassium phosphate |
IV. Replacement of galK with Tag Sequences by Recombineering
In this stage the galK gene is replaced by the desired tag sequences and the correctly modified fosmids are selected for by selection against the galK gene by the toxic galactose analog deoxygalactose (DOG) (Figure 2B).
| 100 mL | 10X MOPS minimal media |
| 5 mL | 0.2 mg/ml d-biotin (sterile filtered) |
| 4.5 mL | 10 mg/ml L-leucine (1%, heated, then cooled down and sterile filtered) |
| 10 mL | 20% deoxygalactose (sterile filtered) |
| 10 mL | 20% glycerol (autoclaved) |
| 1 mL | 12.5 mg/ml Chloramphenicol in EtOH |
| 2.55 mL | 20% NH4Cl |
| 10 mL | 0.132 M dibasic potassium phosphate |
V. Addition of unc-119 Gene by cre-loxP Recombination
A common means of generating transgenic animals with the modified fosmids is through the use of biolistic bombardment. This technique uses DNA-coated gold particles to introduce fosmid DNA into C. elegans. Transgenic animals are usually identified via rescue of the unc-119 mutant with an unc-119 transgene. In this step, the unc-119 gene is added to the fosmid backbone in cis by cre-loxP recombination with the pLoxP unc-119 plasmid (Figure 2C).
VI. Large Scale Fosmid Preparation
To facilitate obtaining the larger quantities of fosmid DNA needed for bombardment, in this step the fosmid is transferred to the EPI300 bacteria. This strain has the ability to increase the fosmid copy number to increase yields during DNA preparation.
VII. Bombardment
VIII. Representative Results
The modification of fosmids via recombineering robust and success rates of >90% in the negative selection step are routinely observed 2. This protocol also takes ~2 weeks to complete which makes the preparation of transgenes fairly rapid. The protocol has also been tried by other labs with success 20.
| Oligo | Sequence |
| C-term TAP F | ATGGAAAAGAGAAGATGGAAAAAG |
| C-term TAP R | GGTTGACTTCCCCGC |
| FLAG-GFP F | ATGGATTACAAGGACGATGACGATAAGATGAG |
| FLAG-GFP R | CAAAGCTTGTGGGCTTTTGTATAG |
| N-term TAP F | ATGGCAGGCCTTGCGC |
| N-term TAP R | AAGTGCCCCGGAGGATGAGATTTTCT |
| galK F | CCTGTTGACAATTAATCATCGGCA |
| galK R | TCAGCACTGTCCTGCTCCT |
| unc-119 F | CAAATCCGTGACCTCGACAC |
| unc-119 R | CACAGTTGTTTCTCGAATTTGG |
Table 1. Oligonucleotides used for PCR.
| Plasmids | Source | Available at |
| Fosmid clone | Geneservice Ltd. | Geneservice |
| pGalK | 15 | NCI-Frederick |
| pMOD4-RT-G | 2 | Addgene |
| pMOD4-galK-G | ||
| pMOD4-galK-GT | ||
| pLoxP- unc-119 | ||
| pMOD4-GFP | ||
| Bacteria | ||
| SW106 | 15 | NCI-Frederick |
| EPI300 | Epicentre Biotechnologies | Epicentre |
| EC100D pir-116 | ||
Table 2. Strain and vector availability.

Figure 1.
Diagram of pMOD4-galK-G, and pMOD4-galK-GT, pMOD4 GFP, pLoxP-unc-119
The pMOD4-galk-G plasmid consists of the galK cassette (black) flanked by 50 nucleotide regions identical to the 5' and 3' ends of FLAG(Brown)-GFP (green) while pMOD4-galK-GT consists of the galK cassette flanked by both the FLAG-GFP homology regions and 50 nucleotide regions identical to the 5' and 3' ends of N-terminal and C-terminal TAP (blue and orange, respectively). pMOD4-FLAG -GFP consists of the full GFP cassette with a 5' FLAG tag and pLoxP unc-119 consists of the unc-119 genomic sequence (purple) in a plasmid containing a loxP site. All plasmids utilize the R6K-based pMOD4 (red) backbone which is unable to replicate in SW106.
Figure 2.
Overview of galK recombineering process
Figure 2A -2C Separate figures showing the steps and time involved in recombineering using the galK cassette. These are the same figures that are merged in figure 2d, but provided separately for clarity and ease of reading. A fosmid of interest is first modified in a two-step procedure involving the insertion of the galK cassette flanked by 50 bp regions of homology to FLAG-GFP or TAP (Figure 2A) followed by replacement of this cassette by FLAG-GFP or TAP ( Figure 2B). Later the unc-119 marker for use in generating transgenic animals is inserted into the LoxP site on the fosmid backbone (Figure 2C).
Figure 2D shows a merged figure of galK recombineering procedure.
Outline of galK recombineering procedure as described in the above including time required for each step from merging Figure 2A-2C.

Figure 2a. The galk insertion in galk recombineering.

Figure 2b. The TAG (GFP /TAP) insertion in galk recombineering.

Figure 2c. The addition of unc-119.

Figure 2d. The merged overview of galk recombineering.
Subscription Required. Please recommend JoVE to your librarian.
The generation of transgenes from fosmids offers the benefit of retaining all of the native promoter elements, splice variants, and 3' UTR regulatory elements. This can lead to the construction of a transgene which is more reflective of the native expression pattern, or the construction of a functional transgene when other approaches fail 5. The resulting transgenes can carry a variety of epitope tags including GFP or a TAP tag.
The construction of transgenes involved three steps which are all carried out in the SW106 bacterial stain 15. First, the galK gene is integrated into the desired site in the fosmid to be modified through recombineering with a PCR product carrying galK flanked by homology arms complementary to the target fosmid. An improvement we developed is the integration of homology regions for either FLAG-GFP or a TAP tag into the galK cassette allowing a single set of oligos to be used for the first and second steps of fosmid modification and lowering the cost of oligos. A further simplification is the use of an R6K-based vector, which is unable to replicate in the SW106 bacterial strain and eliminates the need to digest the parent vector. Second, the galK cassette is replaced with tags such as GFP or TAP which are then fused with the gene of interest on the fosmid. This step is very robust and many correctly modified fosmids are routinely obtained. Finally, the unc-119 selectable marker for the generation of transgenic worms is added to the fosmid. This creates a marker in cis and directly linked to the modified fosmid. The unc-119 selectable marker is widely and compatible with both microinjection and biolistic bombardment 17,21. Bombardment is particularly useful as significant numbers of transgenic lines can be generated by a single trial and even inexperienced personnel can create transgenic animals.
A key aspect of this protocol is the use of a shaking water bath incubator for the heat shock steps during the preparation of SW106 competent cells. We found that use of an air incubator was unable to heat the bacterial culture to 42°C even after 30 minutes in the shaker (not shown). We also tried immersing the bacteria in a water bath with suboptimal results (not shown). A shaking water bath can be purchased used from a number of companies if not already available in the lab.
Beyond the insertion of GFP or epitope tags, we have also started to use this technique for site-specific mutagenesis of worm genes carried on fosmids (A. Ferguson and A. Fisher, unpublished). This was accomplished via the use of a single-stranded oligo containing the change flanked by 50 bp upstream and downstream of the site to replace the galK gene. The combination of fosmid mutagenesis coupled with the use of a gene knockout mutant could allow the in vivo function of particular gene isoforms, domains, or specific amino acids to be determined. Further our protocol removes the galK marker at the end so it is possible to perform additional rounds of modification to insert additional epitope tags or perform mutagenesis on a tagged construct.
Finally, it is likely that some of these reagents can be used in the construction of modified BACs or fosmids by labs not using worms. The pMOD4 galK-G and pMOD4 galK-GT genes still retain the entire galK gene so previously published oligos can still be used to amplify the galK gene 15. This will still retain the benefits of using the R6K replication origin with regards to not needing to digest the parent plasmid or carefully purify the PCR product.
Subscription Required. Please recommend JoVE to your librarian.
No conflicts of interest declared.
The authors would like to thank Lindsey Nash for help with developing the technique. This work was funded by NIH grant AG028977 to A.L.F., a pilot project grant from the University of Pittsburgh OAIC (AG024827), and seed funds from the University of Pittsburgh.
| Name | Company | Catalog Number | Comments |
| FosmidMAX kit | Epicentre Biotechnologies | FMAX046 | |
| GoTaq | Promega Corp. | M7122 | |
| MOPS Media | TEKnova, Inc. | M2120 | |
| 0.132 M Potassium phosphate solution | TEKnova, Inc. | M2102 | |
| D-galactose | Sigma-Aldrich | G0750 | |
| 2-deoxygalactose | Sigma-Aldrich | D4407 | |
| Biotin | Sigma-Aldrich | B4639 | |
| Leucine | Sigma-Aldrich | L8000 | |
| NH4Cl | Sigma-Aldrich | A9434 | |
| Phusion DNA polymerase | New England Biolabs | F-530S | |
| MacConkey agar base | BD Biosciences | 281810 | |
| Arabinose | Sigma-Aldrich | A3131 | |
| Chloramphenicol | Sigma-Aldrich | C1919 | |
| Sodium phosphate dibasic | Sigma-Aldrich | S5136 | |
| Potassium phosphate monobasic | Sigma-Aldrich | P5655 | |
| Sodium chloride | Sigma-Aldrich | S5886 | |
| Glycerol | Sigma-Aldrich | G2025 | |
| Bacto Agar | BD Biosciences | 214010 |
1
ReplyPosted by: SamSeptember 23, 2011, 1:31 PM