JoVE   
You do not have subscription access to articles in this section. Learn more about access.

  JoVE Biology

  
You do not have subscription access to articles in this section. Learn more about access.

  JoVE Neuroscience

  
You do not have subscription access to articles in this section. Learn more about access.

  JoVE Immunology and Infection

  
You do not have subscription access to articles in this section. Learn more about access.

  JoVE Clinical and Translational Medicine

  
You do not have subscription access to articles in this section. Learn more about access.

  JoVE Bioengineering

  
You do not have subscription access to articles in this section. Learn more about access.

  JoVE Applied Physics

  
You do not have subscription access to articles in this section. Learn more about access.

  JoVE Chemistry

  
You do not have subscription access to articles in this section. Learn more about access.

  JoVE Behavior

  
You do not have subscription access to articles in this section. Learn more about access.

  JoVE Environment

|   

JoVE Science Education

General Laboratory Techniques

You do not have subscription access to videos in this collection. Learn more about access.

Basic Methods in Cellular and Molecular Biology

You do not have subscription access to videos in this collection. Learn more about access.

Model Organisms I

You do not have subscription access to videos in this collection. Learn more about access.

Model Organisms II

You do not have subscription access to videos in this collection. Learn more about access.

 JoVE Biology

Endothelial Cell Co-culture Mediates Maturation of Human Embryonic Stem Cell to Pancreatic Insulin Producing Cells in a Directed Differentiation Approach

1, 1,2

1Department of Bioengineering, University of Pittsburgh, 2Department of Chemical Engineering, University of Pittsburgh

Article
    Downloads Comments Metrics

    You must be subscribed to JoVE to access this content.

    This article is a part of   JoVE Biology. If you think this article would be useful for your research, please recommend JoVE to your institution's librarian.

    Recommend JoVE to Your Librarian

    Current Access Through Your IP Address

    You do not have access to any JoVE content through your current IP address.

    IP: 54.90.127.10, User IP: 54.90.127.10, User IP Hex: 911900426

    Current Access Through Your Registered Email Address

    You aren't signed into JoVE. If your institution subscribes to JoVE, please or create an account with your institutional email address to access this content.

     

    Summary

    The current study describes a directed differentiation approach in inducing pancreatic differentiation of human embryonic stem cells. Of great significance is the finding that endothelial cell co-culture mediates maturation of human embryonic stem cell derived pancreatic progenitors into insulin expressing cells.

    Date Published: 3/27/2012, Issue 61; doi: 10.3791/3759

    Cite this Article

    Jaramillo, M., Banerjee, I. Endothelial Cell Co-culture Mediates Maturation of Human Embryonic Stem Cell to Pancreatic Insulin Producing Cells in a Directed Differentiation Approach. J. Vis. Exp. (61), e3759, doi:10.3791/3759 (2012).

    Abstract

    Embryonic stem cells (ESC) have two main characteristics: they can be indefinitely propagated in vitro in an undifferentiated state and they are pluripotent, thus having the potential to differentiate into multiple lineages. Such properties make ESCs extremely attractive for cell based therapy and regenerative treatment applications 1. However for its full potential to be realized the cells have to be differentiated into mature and functional phenotypes, which is a daunting task. A promising approach in inducing cellular differentiation is to closely mimic the path of organogenesis in the in vitro setting. Pancreatic development is known to occur in specific stages 2, starting with endoderm, which can develop into several organs, including liver and pancreas. Endoderm induction can be achieved by modulation of the nodal pathway through addition of Activin A 3 in combination with several growth factors 4-7. Definitive endoderm cells then undergo pancreatic commitment by inhibition of sonic hedgehog inhibition, which can be achieved in vitro by addition of cyclopamine 8. Pancreatic maturation is mediated by several parallel events including inhibition of notch signaling; aggregation of pancreatic progenitors into 3-dimentional clusters; induction of vascularization; to name a few. By far the most successful in vitro maturation of ESC derived pancreatic progenitor cells have been achieved through inhibition of notch signaling by DAPT supplementation 9. Although successful, this results in low yield of the mature phenotype with reduced functionality. A less studied area is the effect of endothelial cell signaling in pancreatic maturation, which is increasingly being appreciated as an important contributing factor in in-vivo pancreatic islet maturation 10,11.

    The current study explores such effect of endothelial cell signaling in maturation of human ESC derived pancreatic progenitor cells into insulin producing islet-like cells. We report a multi-stage directed differentiation protocol where the human ESCs are first induced towards endoderm by Activin A along with inhibition of PI3K pathway. Pancreatic specification of endoderm cells is achieved by inhibition of sonic hedgehog signaling by Cyclopamine along with retinoid induction by addition of Retinoic Acid. The final stage of maturation is induced by endothelial cell signaling achieved by a co-culture configuration. While several endothelial cells have been tested in the co-culture, herein we present our data with rat heart microvascular endothelial Cells (RHMVEC), primarily for the ease of analysis.

    Protocol

    1. Cell Maintenance

    1. H1 hESC (WiCell) were maintained on hESC qualified matrigel coated wells with mTeSR1 media, with media change every day. Wells were coated by dilute matrigel solution, prepared by adding 300 μl of hESC matrigel in 25 ml of DMEM:F12. 1 ml of this matrigel solution was added to each well of a six well plate, or 400 μl added to each well of a 12 well plate and allowed to coat for 1 hour at room temperature. Cells were mechanically passaged at a split ratio of 1:4 by scraping colonies once they reached between 1 and 1.5mm in diameter.
    2. RHMVEC (VEC technologies) was maintained in MCDB-131 media with media change every other day. Cells were split by trypsinization once 80% confluence was reached at a split ratio of 1:3. Endothelial cells between passages 3 and 7 were used for this study.

    2. Preparation of Stock Solutions

    1. Activin A was reconstituted at 50 μg/mL in sterile PBS containing 0.1% bovine serum albumin. The solution was aliquoted and stored at -20 °C.
    2. EGF was reconstituted at 500 μg/mL in sterile 10 mM Acetic Acid. The solution was aliquoted and stored at -20 °C.
    3. Insulin was reconstituted at 10 mg/ml by adding acidified H2O (pH ≤2), prepared by addition of 0.1 ml glacial acetic acid to 10 ml of water.
    4. DAPT was reconstituted in DMSO at 18 mg/ml. It was further diluted to 300 μM concentration in DMEM:F12, aliquoted and stored at -20 °C.
    5. KAAD-Cyclopamine was reconstituted in DMSO at 5mg/ml. It was further diluted to 2 μM concentration in DMEM:F12, aliquoted and stored at -20 °C.
    6. All-trans retinoic acid was reconstituted at 2.7 mg/ml in 95% ethanol. It was further diluted to 2mM concentration in DMEM:F12, aliquoted and stored at -80 °C.

    3. Definitive Endoderm (DE) and Pancreatic Progenitor (PP) Induction

    1. Once hESC colonies reached between 1 and 1.5mm in diameter, DE induction was performed by adding DMEM:F12 supplemented with B27, 0.2% BSA, 100 ng/ml Activin A and 1 μM Wortmannin for 4 days (Day 0-Day 4) with media change every day.
    2. After DE induction was complete, pancreatic progenitor induction was induced by changing the media to DMEM:F12 supplemented with B27, 0.2% BSA and KAAD-Cyclopamine at 0.2 μM concentration for 24 hours (Day 4-Day 5).
    3. After 24 hours media was changed to DMEM:F12 supplemented with B27, 0.2% BSA, KAAD-Cyclopamine at 0.2 μM concentration and all-trans retinoic acid at 2 μM concentration for 3 days with media change every day (Day 5-Day 8).

    4. Pancreatic Maturation

    1. After PP induction, all groups were changed to maturation media composed of DMEM:F12 supplemented with B27, 0.2% BSA, 10 mM Nicotinamide, 25 μg/ml insulin, 30 nM Na2SeO3 and 50 μg/ml transferrin for 2 days with media change every day (Day 8-Day 10).
    2. After 2 days in maturation media, the final maturation step is carried out in parallel using several different conditions for comparison. Differentiation was induced under the following conditions: (i) using notch inhibitor DAPT (ii) using co-culture media only, without endothelial cells as control and (iii) using contact co-culture with RHMVEC cells. Cells were maintained in DAPT or co-culture media for a week (Day 10-Day 17) with media change every day.
      1. DAPT media was prepared by supplementing the maturation media with 30 μM DAPT. Cells in this groups were first exposed to complete MCDB131 for 24 hours and then exposed to DAPT media for 6 days (Day 11-Day 17).
      2. Co-culture media was prepared by supplementing MCDB-131 media with B27, 0.2% BSA, 10 mM Nicotinamide, 10 ng/ml EGF, 1 μg/ml hydrocortisone, 10 mg EndoGro, 90 μg/ml heparin. For media control condition the differentiating cells were exposed to MCDB-131 complete medium for 24 hours (Day 10-Day 11) after which the media was changed to co-culture media for 6 days (Day 11-Day 17) (no endothelial cells).
      3. For contact co-culture condition, one million RHMVEC was added to the differentiating cells in complete MCDB-131 media (VEC technologies) for 24 hours (Day 10-Day 11) to allow attachment. After 24 hours media was changed to co-culture media for 6 days (Day 11-Day 17) with media change every day.

    5. qRT-PCR Analysis

    1. At the end of each stage of differentiation (endoderm; pancreatic progenitor; mature islet) were lysed and RNA was extracted using NucleoSpin RNA II extraction kit according to manufacturer's instructions.
    2. RNA quality was analyzed by checking RNA absorbance at 260 nm and 280 nm, followed by RNA quantification using a SmartSpec Plus spectrophotometer.
    3. Reverse transcription was performed using ImProm II reverse transcription kit according to manufacturer's instructions. All reactions were performed with 100 ng of RNA.
    4. qRT-PCR was performed using the Mx3005P QPCR system (Agilent) and Brilliant II SYBR Green QPCR master mix according to manufacturer's instructions. The primers used are listed on table 1. The initialization step was performed at 50 °C for 2 minutes followed by 95 °C for 10 minutes. 50 amplification cycles were performed as follows: 95 °C for 30 seconds, 54 °C for 30 seconds and 72 °C for 1 minute.
    5. Fold change of target mRNA expression over undifferentiated cells was calculated from CT values using the following formulas:
      ΔCT(Markeri)= CT(Markeri) - CT (GAPDH)
      Δ ΔCT(Markeri)= ΔCT(Markeri)(Sample)- ΔCT(Markeri)(Undifferentiated cells)
      Relative expression (Markeri)= 2-ΔΔCT(markeri)

    6. Immunocytochemistry

    1. At the end of each stage of differentiation (endoderm; pancreatic progenitor; mature islet) cells were fixed in 4% formaldehyde for 15 minutes at room temperature.
    2. Fixed cells were permeabilized using 0.25% Triton X-100 (TX) for 15 minutes.
    3. Non-specific staining was blocked by incubation in 10% donkey serum in 0.05% TX for 30 minutes.
    4. Primary antibody incubation was performed overnight at 4 °C in blocking buffer at the recommended antibody dilution (see table 1).
    5. Cells were washed with 0.05% TX three times for 5 minutes.
    6. Secondary antibody incubation was performed for one hour at room temperature in the dark with appropriate antibodies diluted in blocking buffer.
    7. Cells were washed with 0.05% TX three times for 5 minutes.
    8. Nuclear staining was performed by incubation with Hoescht stain at 1:1000 dilution in PBS for 5 minutes followed by 3 washes with PBS.
    9. Fixed and stained cells were imaged using Olympus IX81 inverted microscope and Metamorph imaging software.

    7. Representative Results

    Addition of Activin A and Wortmannin to undifferentiated hESC for 4 days induces definitive endoderm as confirmed by qRT-PCR analysis for DE markers Sox17, Cxcr4, and Foxa2 and immunostaining for Sox17 as illustrated in Figure 2. Differentiation to pancreatic progenitor cells after addition of cyclopamine and retinoic acid was confirmed by qRT-PCR of pancreatic progenitor markers and Immunostaining for Pdx1 as illustrated in Figure 3.

    At the final stage of differentiation, contact co-culture with RHMVEC cells strongly induced upregulation of insulin expression in the hESC derived pancreatic progenitor cells. The efficiency of co-culture mediated differentiation was analyzed by comparing with control condition using DAPT. DAPT was used as a positive control since it is currently one of the most widely used methods to achieve pancreatic maturation. Since the co-culture was performed in a modified media supplemented by factors supportive of endothelial cells, additional control was performed with the media in absence of endothelial cells to verify the effect of media on differentiation. Details of this analysis are presented in Figure 4.

    Figure 1.
    Figure 1. Multi-stage protocol for differentiation of hESC into insulin expressing cells.

    Figure 2.
    Figure 2. Definitive endoderm induction of human embryonic stem cells. A) qRT-PCR analysis of representative DE markers in hESC cells exposed to Activin A and Wortmannin for 4 days. Results are normalized with respect to undifferentiated hESC. B) Sox17 staining (Green) and DAPI (blue) show nuclear expression of Sox17. Scale bar: 50 μm.

    Figure 3.
    Figure 3. Pancreatic progenitor induction of the embryonic stem cell derived endoderm cells. A) qRT-PCR analysis of early pancreatic markers in hESC derived endoderm cells exposed to cyclopamine and retinoic acid for 4 days after DE induction. Results normalized with respect to undifferentiated hESC. B) Pdx1 staining (violet) and DAPI (blue) show nuclear expression of Pdx1. Scale bar: 50 μm.

    Figure 4.
    Figure 4. Pancreatic maturation stage A) qRT-PCR analysis of pancreatic hormones in hESC after pancreatic maturation using DAPT, contact co-culture or co-culture media (control). Results normalized with respect to undifferentiated hESC. p values obtained by student t-test. B) Co-culture with Dil-Ac-LDL labeled RHMVEC (Red) show regions where ECs attach to the plate if there are empty spaces (top), other RHMVEC can be found in direct contact with the differentiating ESC(bottom). C) C-peptide (Green) staining for cells differentiated using co-culture method. Scale bar: 12.5 μm (Top) and 50 μm (Bottom) D) Immunostaining of RHMVEC demonstrates no insulin expression in the RHMVEC.

    Marker Primer1 (5' TO 3') Primer2 (5' TO 3') Ref
    SOX17 CTCTGCCTCCTCCACGAA CAGAATCCAGACCTGCACAA 12
    CXCR4 CACCGCATCTGGAGAACCA GCCCATTTCCTCGGTGTAGTT 4
    FOXA2 GGAGCGGTGAAGATGGAA TACGTGTTCATGCCGTTCAT 12
    PDX1 AAGTCTACCAAAGCTCACGCG GTAGGCGCCGCCTGC 4
    PTF1 CATAGAGAACGAAACCACCCTTTGAG GCACGGAGTTTCCTGGACAGAGTTC 12
    HLXB9 CACCGCGGGCATGATC ACTTCCCCAGGAGGTTCGA 4
    HNF6 TGTGGAAGTGGCTGCAGGA TGTGAAGACCAACCTGGGCT 5
    PAX6 CGAATTCTGCAGGTGTCCAA ACAGACCCCCTCGGACAGTAAT 5
    NKX6.1 AGACCCACTTTTTCCGGACA CCAACGAATAGGCCAAACGA 5
    ISL1 GATCTATGTCACCTCGCAAGG TACAACCACCATTTCACTG 12
    GLUCAGON AGGCAGACCCACTCAGTGA AACAATGGCGACCTCTTCTG 4
    INSULIN AAGAGGCCATCAAGCAGATCA CAGGAGGCGCATCCACA 12

    Table 1. Primers used for qPCR reactions.

    Subscription Required. Please recommend JoVE to your librarian.

    Discussion

    During pancreatic development, differentiating pancreatic cells are in close proximity with endothelial cells from the aorta; furthermore, pancreatic islets are densely vascularized to promote rapid exchange of blood glucose and islet hormones. Given these facts, it is not surprising that endothelial cells play an important role in the process of pancreatic organogenesis. While the importance of endothelial cells during pancreatic development is increasingly being appreciated, its role in in vitro differentiation of embryonic cells is less investigated. In our earlier report we established the positive role of endothelial cells on pancreatic maturation of mouse embryonic stem cells 13. In the current study we investigate the effect of endothelial cell signaling on differentiating human embryonic stem cells.

    Multiple endothelial cells were used in this protocol, all of which resulted in similar overall effect although with variations in efficiency of differentiation. In the current report we present the effect of co-culturing hESC derived pancreatic progenitor cells with rat heart microvascular endothelial cells (RHMVEC). Endothelial cells can be conveniently visualized by AC-LDL staining, which is specific to only endothelial cells. Co-culture of the differentiating ESCs with pre-stained endothelial cells showed that while most of the endothelial cells were viable in culture for extended period of time, the RHMEV gradually disappear after 4 days and could no longer be detected after 6 days of maturation. Absence of the RHMVEC simplifies analysis by eliminating the need for sorting, hence was chosen for optimization of the co-culture protocol.

    While the present study clearly indicates the positive effect of endothelial cells in inducing pancreatic maturation, the exact mechanism of such induction is still unknown and being currently investigated in our laboratory. A few plausible mechanisms could be (i) the effect of cell-secreted molecules (ii) endothelial cell mediated inhibition of notch signaling (iii) the role of extracellular matrix secreted by the endothelial cells. While the first category does not require cell-cell contact, such contact is mandatory for the second and third category. Hence we performed some preliminary analysis using different co-culture configurations: (i) contact co-culture (ii) transwell co-culture and (iii) conditioned media culture. It was observed that contact co-culture resulted in maximum differentiation, as judged by insulin expression; followed by transwell co-culture; while conditioned media culture resulted in minimal effect on insulin expression (data not shown). These analyses indicate that while cell-cell contact is important, there might be some short lived secreted molecules which are important as well.

    Subscription Required. Please recommend JoVE to your librarian.

    Disclosures

    We have nothing to disclose.

    Acknowledgements

    We acknowledge support from NIH New Innovator Award DP2 116520 and ORAU Ralph Powe Junior Faculty Enhancement Award.

    Materials

    Name Company Catalog Number Comments
    mTeSR1 (with supplement) Stem Cell Technologies 5850
    hESC qualified matrigel BD Biosciences 354277
    DMEM:F12 Invitrogen 11330-032
    MCDB-131 Invitrogen 10372019
    MCDB-131 (Complete) VEC Technologies MCDB-131
    B27 Supplement Invitrogen 17504044
    Activin A R&D Systems 338-AC 100ng/ml
    Wortmannin Invitrogen W3144 1μM
    KAAD-Cyclopamie Sigma-Aldrich C4116 0.2μM
    All-Trans Retinoic Acid Sigma-Aldrich R2625 2μM
    DAPT Sigma-Aldrich D5942 30μM
    Nicotinamide Sigma-Aldrich N0636 10 mM
    Sodium Selenite Sigma-Aldrich S5261 30 nM
    Insulin Sigma-Aldrich I1882 25 μg/ml
    Transferrin Sigma-Aldrich T8158 50 μg/ml
    EGF R&D Systems 236-EG 10ng/ml
    EndoGro VEC Technologies ENDOGRO 10mg
    Heparin Sigma-Aldrich H3149 90μg/ml
    Hydrocortisone Sigma-Aldrich H0888 1μg/ml
    NucleoSpin RNA II Macherey-Nagel 740955
    ImProm II reverse transcription System Promega Corp. A3800
    Brilliant II SYBR Green QPCR master mix Stratagene, Agilent Technologies 600548
    Sox17 goat polyclonal IgG Santa Cruz Biotechnology, Inc. sc-17355 1/500
    PDX1 goat polyclonal IgG Santa Cruz Biotechnology, Inc. sc-14662 1/500
    C-Peptide Rabbit polyclonal Cell Signaling Technology 4593 1/500
    Alexa Fluor 488 donkey anti-rabbit IgG Invitrogen A-21206 1/1000
    Alexa Fluor 647 donkey anti-goat IgG Invitrogen A-21447 1/1000
    Table 2. Reagents and Kits

    References

    1. De Vos, J., Assou, S., Tondeur, S., Dijon, M., & Hamamah, S. Les cellules souches embryonnaires humaines : de la transgression de l'embryon humain á la médecine régénératrice de demain. Gynécologie Obstétrique & Fertilité. 37, 620-626 (2009).
    2. Murtaugh, L.C. & Melton, D.A. Genes, Signals, and Lineages in Pancreas Development. Annual Review of Cell and Developmental Biology. 19, 71-89 (2003).
    3. Kubo, A., Shinozaki, K., Shannon, J.M., Kouskoff, V., Kennedy, M., Woo, S., Fehling, H.J., & Keller, G. Development of definitive endoderm from embryonic stem cells in culture. Development. 131, 1651-1662 (2004).
    4. D'Amour, K.A., Bang, A.G., Eliazer, S., Kelly, O.G., Agulnick, A.D., Smart, N.G., Moorman, M.A., Kroon, E., Carpenter, M.K., & Baetge, E.E. Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells. Nat. Biotech. 24, 1392-1401 (2006).
    5. Zhang, D., Jiang, W., Liu, M., Sui, X., Yin, X., Chen, S., Shi, Y., & Deng, H. Highly efficient differentiation of human ES cells and iPS cells into mature pancreatic insulin-producing cells. Cell Res. 19, 429-438 (2009).
    6. Basma, H., Soto-Gutiérrez, A., Yannam, G.R., Liu, L., Ito, R., Yamamoto, T., Ellis, E., Carson, S.D., Sato, S., Chen, Y., Muirhead, D., Navarro-Álvarez, N., Wong, R.J., Roy-Chowdhury, J., Platt, J.L., Mercer, D.F., Miller, J.D., Strom, S.C., Kobayashi, N., & Fox, I.J. Differentiation and Transplantation of Human Embryonic Stem Cell-Derived Hepatocytes. Gastroenterology. 136, 990-999, e994 (2009).
    7. Phillips, B.W., Hentze, H., Rust, W.L., Chen, Q.-P., Chipperfield, H., Tan, E.-K., Abraham, S., Sadasivam, A., Soong, P.L., Wang, S.T., Lim, R., Sun, W., Colman, A., & Dunn, N.R. Directed Differentiation of Human Embryonic Stem Cells into the Pancreatic Endocrine Lineage. Stem Cells and Development. 16, 561-578 (2007).
    8. Kim, S.K. & Melton, D.A. Pancreas development is promoted by cyclopamine, a Hedgehog signaling inhibitor. Proceedings of the National Academy of Sciences. 95, 13036-13041 (1998).
    9. Docherty, K. Growth and development of the islets of Langerhans: implications for the treatment of diabetes mellitus. Current Opinion in Pharmacology. 1, 641-649 (2001).
    10. Nikolova, G., Jabs, N., Konstantinova, I., Domogatskaya, A., Tryggvason, K., Sorokin, L., Fässler, R., Gu, G., Gerber, H.-P., Ferrara, N., Melton, D.A., & Lammert, E. The Vascular Basement Membrane: A Niche for Insulin Gene Expression and [beta]> Cell Proliferation. Developmental Cell. 10, 397-405 (2006).
    11. Yoshitomi, H. & Zaret, K.S. Endothelial cell interactions initiate dorsal pancreas development by selectively inducing the transcription factor Ptf1a. Development. 131, 807-817 (2004).
    12. Osafune, K., Caron, L., Borowiak, M., Martinez, R.J., Fitz-Gerald, C.S., Sato, Y., Cowan, C.A., Chien, K.R., & Melton, D.A. Marked differences in differentiation propensity among human embryonic stem cell lines. Nat. Biotech. 26, 313-315 (2008).
    13. Banerjee, I., Sharma N., & Yarmush M. Impact of co-culture on pancreatic differentiation of embryonic stem cells. J. Tissue Eng. Regen. Med. 5 (4), 313-23 (2010).

    Comments

    2 Comments

    good
    Reply

    Posted by: Zhongchun S.July 20, 2012, 2:15 AM

    Dear Maria Jaramillo

    I am a student of the licencientura in biotechnology in the Universidad Argentina de la Empresa.
    I am currently studying the cell cultures, researching on the internet I find interesting the abstract, I would like to know if it is possible for me to send the paper by email please.
    thanks and greetings


    Ana Clara López Novo
    Matter cell cultures
    Department of biotechnology and food technology
    Faculty of engineering and Sciences
    Universidad Argentina de la Empresa
    Lima 717 (C1073AAO)
    Ciudad Autónoma de Buenos Aires
    Email: anaclaralopeznovo@gmail.com
    Reply

    Posted by: Ana L.May 6, 2013, 10:24 PM

    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Metrics

    Waiting
    simple hit counter