Name: Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts (Video) | JoVE Journal
Uploaded: 2016-12-17T13:00:00.000+00:00
Duration: 11 min 11 s
Description: Learn to prepare rAAV9 vectors for gene overexpression and knockdown in mouse hearts using HEK293 cell transfection. This method enables cardiac gene function studies without genetically modified animal models.

ai_agent_IP

ai_agent

maintenance

instantTrialDurationMinutes

isBiopharma

enableNewMyJoveSectionDesign

educationFeatures

seoMetaApi

ai_copilot_institution_blacklist

ai_chat_institution_blacklist

freeAccessWindow

ssoRoleCapture

scheduledMaintenanceBanner

joveLabsFeatures

disable_autoplay_for_bots

extended_trial_duration

5 minutes

We thank Dr. Zaffar Haque for careful reading of the manuscript. We thank Drs. Masaharu Kataoka and Gengze Wu for discussions and help. Work in the Wang lab is supported by the American Heart Association, Muscular Dystrophy Association, and NIH (HL085635, HL116919, HL125925).

All described steps were performed under protocols approved by the Biosafety Committee and the Institutional Animal Care and Use Committee of Boston Children&#39;s Hospital. Boston Children&#39;s Hospital has pathogen-free mouse facilities with regulated light/dark cycles and climate control. Veterinary and animal care staff change cages and ensure the health of the mice. The facilities are AAALAC certified and have active Animal Welfare Assurance certification (AAALAC Accreditation Granted on 2/24/1992. Animal Welfare Assurance number: A3303-01). Mice were euthanized by CO2 delivered from a compressed gas source. Tissue samples were collected after confirming that heart rate, movement, and breathing of animals had ceased. Neonatal rodents are resistant to CO2 euthanasia and were euthanized by decapitation using sharp scissors. These methods are consistent with the recommendations of the Panel on Euthanasia of the American Veterinary Medical Association.
1. Generation of rAAV9 Constructs by Cloning a cDNA or shRNA Expression Cassette into the Plasmid Backbone
NOTE: The rAAV9 plasmid, containing the inverted terminal repeats (ITRs) of AAV2, used for gene overexpression has been modified to harbor the chicken TNNT2 promoter (rAAV9.cTNT), which enables cardiomyocyte-specific expression of transduced genes25,26,29. Unique NheI and KpnI sites have been introduced into the plasmid, downstream of the promoter. The cDNA fragments encoding the genes of interest can be cloned into the rAAV9 backbone using these two restriction sites25,26,29. Here, as an example, the rAAV9 vector for overexpression of the GFP gene in mouse hearts was generated. The resulting plasmid contains the cTNT::GFP cassette flanked by two ITR sites (Figure 1). rAAV9.U6::shRNA constructs were used for gene knockdown25. Design shRNAs using online shRNA design servers. rAAV9.U6::shRNA can be generated either by annealing and ligating DNA oligos-containing shRNA sequences into the restriction enzyme-digested rAAV9 vectors harboring the U6 promoter, or by long-range PCR and intra-molecular Gibson assembly-based &#34;seamless&#34; construction30. The resulting plasmid should contain the U6-shRNA cassette flanked by two ITR sites (Figure 2). Here, as an example, the rAAV9.U6::shRNA vector was constructed to knockdown Trbp mRNA (Trbp shRNA sequence: GCAGTGATGGATATGCATCTTCTCGAGAAGATGCATATCCATCACTCG). A scramble shRNA was used as a negative control (CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG).
<ol>
	<li>Clone the cDNA or shRNA expression cassette into the rAAV9 plasmid backbone. Transform the DNA into competent E. Coli cells25. 
	NOTE: Use stbl2 or stbl3 E. coli cells for rAAV9 DNA transformation to minimize undesired ITR recombination.</li>
	<li>Pick up the positive clone from the transformed E. Coli cells. Amplify the culture in 500 ml of Lilly-Barnett medium and extract the rAAV9 plasmid from the bacterial cells25-30. 
	NOTE: Midi/Maxi prep the rAAV9 plasmid to obtain a high amount of DNA (&#62; 100 &#181;g). Before generating the virus, always analyze the sequence integrity of the AAV plasmids by restriction digestion and agarose gel electrophoresis, as previously described (http://www.vvf.uzh.ch/cloningservice/11bpdeletion/itrintegrity.html).&#160;</li>
</ol>
2. Transfection of HEK293 Cells with rAAV9 Plasmids
<ol>
	<li>Prepare 1 &#181;g/&#181;l of linear polyethylenimine (PEI) solution. Dissolve PEI powder in endotoxin-free dH2O that has been heated to 70-80 &#176;C. Aftercooling down to RT, neutralize the solution to pH 7.0 with 1 M HCl. Filter sterilize (0.22 &#181;m) the solution. Aliquot the 1 &#181;g/&#181;l PEI stock solution (1,400 &#181;l/tube) and store the solution at -20 &#176;C.</li>
	<li>Culture HEK293 cells in Dulbecco&#39;s Modified Eagle Medium (DMEM) with 10% Fetal Bovine Serum (FBS) and 1% penicillin/streptomycin. Culture the cells in a 37 &#176;C incubator with 5 &#177; 0.5% carbon dioxide (CO2).</li>
	<li>At day 0, plate HEK293 cells in ten 150-mm dishes 18-20 hr before transfection by splitting &#62; 90% confluent cells in a 1:2 dilution. 
	NOTE: At day 1, the cells should reach 90% confluence.</li>
	<li>At day 1, transfect HEK293 cells with the rAAV9 plasmid (e.g., rAAV9.cTNT::GFP or rAAV6.U6::shRNA constructs), Ad-Helper plasmid, and AAV-Rep/Cap plasmid using PEI25,26,29.
	<ol>
		<li>For 10 dishes of cells at 90% confluence, mix 70 &#181;g of AAV-Rep/Cap plasmid, 70 &#181;g pf rAAV9 plasmid, and 200 &#181;g of Ad-Helper plasmid in a 50-ml centrifuge tube.</li>
		<li>If the cells are less confluent, adjust the DNA amount proportionally. For instance, if the cells are at 75% confluent, reduce the DNA amount proportionally (75/90 of the amount shown in step 2.4.1): mix 70 x 75/90 = 58.3 &#181;g of AAV-Rep/Cap plasmid, 70 x 75/90 = 58.3 &#181;g of rAAV9 plasmid, and 200 x 75/90 = 166.7 &#181;g of Ad-Helper plasmid in a 50-ml centrifuge tube.</li>
		<li>Add 49 ml of RT DMEM (without FBS) to the 50-ml tube and mix well.</li>
		<li>Add 1,360 &#181;l of PEI solution to make the PEI:DNA ratio (v/w) be 4:1. Mix well. Incubate at RT for 15 - 30 min.</li>
		<li>Add 5 ml of the mixture prepared in step 2.4.4 to each 150-mm dish (50 ml of the mixture for ten 150-mm dishes).</li>
	</ol>
	</li>
	<li>Culture the cells in a 37 &#176;C incubator with 5 &#177;0.5% CO2 for 60-72 hr.</li>
</ol>
3. Harvest of Transfected HEK293 Cells and Purification of rAAV9 Vectors
<ol>
	<li>Harvest the cells 60-72 hr after transfection. Dislodge and suspend the cells in the dishes by pipetting up and down with the culture medium. Transfer all the cell suspensions to sterile 50-ml tubes.</li>
	<li>Centrifuge the cells at 500 x g for 5 min. Resuspend the cell pellet with 5 ml of PBS in each tube and combine all the cell suspensions into one 50 ml tube.</li>
	<li>Centrifuge the cells at 500 x g for 5 min. Discard the supernatant. At this step, store the cell pellet at -80 &#176;C or immediately purify the AAV from the pellet, as described in steps 3.4-3.15.</li>
	<li>Prepare the lysis buffer: 150 mM NaCl and 20 mM Tris-HCl, pH 8.0. Filter sterilize (0.22 &#181;M). Store the buffer at 4 &#176;C.</li>
	<li>Resuspend the pellet with 10 ml of lysis buffer.</li>
	<li>Freeze the lysate at -80 &#176;C or in the dry ice/ethanol bath, then thaw it at 37 &#176;C. Vortex for 1 min. Freeze and thaw the lysate 3 times.</li>
	<li>Add MgCl2 solution to the thawed lysate (make the final concentration of MgCl2 in the lysate be 1 mM). Add the nuclease to a final concentration of 250 U/ml. Incubate at 37 &#176;C for 15 min to dissolve the DNA/protein aggregation. 
	NOTE: If the DNA/protein aggregation does not get dissolved after nuclease or endonuclease treatment, dounce homogenize the lysates 20 times.</li>
	<li>Centrifuge the sample at 4,800 x g for 20 min at 4 &#176;C. Collect the supernatant.</li>
	<li>Meanwhile, prepare the Iodixanol gradient solution:
	<ol>
		<li>Prepare the 17% of the gradient solution by mixing 5 ml of 10x PBS, 0.05 ml of 1 M MgCl2, 0.125 ml of 1 M KCl, 10 ml of 5 M NaCl, and 12.5 ml ofdensity gradient medium. Adjust the total volume to 50 ml using H2O.</li>
		<li>Prepare the 25% solution by mixing 5 ml of 10x PBS, 0.05 ml of 1 M MgCl2, 0.125 ml of 1 M KCl, 20 ml of density gradient medium, and 0.2 ml of 0.5% (w/v) Phenol Red. Adjust the total volume to 50 ml using H2O.</li>
		<li>Prepare the 40% solution by mixing 5 ml of 10x PBS, 0.05 ml of 1 M MgCl2, 0.125 ml of 1 M KCl, and 33.3 ml of density gradient medium. Adjust the total volume to 50 ml using H2O.</li>
		<li>Prepare the 60% solution by mixing 0.05 ml of 1 M MgCl2, 0.125 ml of 1 M KCl, 50 ml of density gradient medium, and 0.1 ml of 0.5% (w/v) Phenol Red.</li>
	</ol>
	</li>
	<li>With a needle and syringe, load the Iodixanol gradient solution into the polypropylene tube in the order of 5 ml of 17%, 5 ml of 25%, 5 ml of 40% and 5 ml of 60%, starting from the bottom. Load all the lysate obtained from step 3.8 (14-16 ml) on top of the gradient. The gradient, listed from the bottom to top, is 60%, 40%, 25%, 17%, and the lysate layer. Fill the tube with lysis buffer and cover it with the cork.</li>
	<li>Centrifuge at 185,000 x g for 90 min at 16 &#176;C.</li>
	<li>Harvest the viral fraction (40% layer) with a syringe. Insert the needle (21 gauge) into the intersection between the 40% and 60% fractions, only aspirating the 40% layer. 
	NOTE: Avoid aspirating ANY of the 25% layer.</li>
	<li>Mix the viral fraction with sterilized polyoxyethylene-polyoxypropylene block copolymer PBS solution (10% polyoxyethylene-polyoxypropylene block copolymer stock 1:10,000 diluted in PBS) up to a total volume of 15 ml. Load the mixture into the filter tube (cut-off MW = 100 kD). Centrifuge at 2,000 x g for 30 min at 4 &#176;C.</li>
	<li>Discard the solution at the bottom. Refill the filter tube with polyoxyethylene-polyoxypropylene block copolymer PBS solution to a total volume of 15 ml. Centrifuge at 2,000 x g for 20 min at 4 &#176;C. Repeat this step two more times. Collect the purified rAAV9 virus (the fraction above the filter).</li>
	<li>Transfer the purified rAAV9 in the filter tube to 1.7-mL tubes. Aliquot the purified rAAV9 (100 - 400 &#181;l/tube, depending on the volume and titer of the AAV) and store the virus at -80 &#176;C. 
	NOTE: Avoid repeated freeze-thaws.</li>
</ol>
4. Measurement of the Titer of rAAV9
<ol>
	<li>Prepare standard DNA samples.
	<ol>
		<li>Design specific and efficient PCR primers for rAAV9 vectors and optimize the PCR condition. 
		NOTE: The primers used in this study are &#34;Forward: TCGGGATAAAAGCAGTCTGG; Reverse: TCGGACGGAGATACGTGAGT&#34;. The PCR reaction was performed with the following conditions: initial denaturing at 95 &#176;C for 3 min; 35 cycles of 95 &#176;C for 20 sec, 60 &#176;C for 15 sec, and 72 &#176;C for 10 sec; and the final extension at 72 &#176;C for 10 min. However, the optimized primers and PCR conditions are plasmid-specific, as the inset sequence in the rAAV9 vector may affect the specificity and efficiency of PCR31.</li>
		<li>Perform the PCR reaction with the conditions shown in step 4.1.1. Purify the PCR product with a gel extraction kit.</li>
		<li>Measure the concentration of purified DNA using a spectrophotometer. Calculate the concentration in DNA molecular numbers based on the molecular weight/length of the PCR product.
		<ol>
			<li>Calculate the molecular concentration using the following equation: molecular concentration (DNA molecules or fragments/ml) = 6.23 x 1023 mol-1 x Con. x 10-6/MW. Note: (6.23 x 1023 mol-1 is Avagadro&#39;s Number; Con.: DNA concentration in &#181;g/ml; MW.: molecular weight in g/mol). For instance, if the obtained concentration of the PCR product is 100 &#181;g/ml and its length is 200 bp, the molecular weight of the double-stranded DNA is 2 x 200 x 310 = 124,000 (the average molecular weight of each nucleotide in the single-stranded DNA is about 310 g/mol). The molecular concentration (DNA molecules/ml) = 6.23 X 1023 mol-1 x 100 &#181;g/ml x 10-6 /124,000 g/mol = 5.18 x 1014 DNA molecules/ml.</li>
			<li>Perform a dilution series of the DNA fragment and prepare the standard samples, with concentrations of 1013 molecules/ml, 1012 molecules/ml, 1011 molecules/ml, 1010 molecules/ml, 109 molecules/ml, 108 molecules/ml, and 107 molecules/ml. Use 1 &#181;l of solution for each standard sample for the quantitative PCR (qPCR, in step 4.6).</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Mix 5 &#181;l of purified rAAV9 solution with 5 &#181;l of 10x DNAse buffer, 1 &#181;l of DNAse (10,000 U/ml), and 39 &#181;l of ddH2O. The total volume should be 50 &#181;l.</li>
	<li>Incubate the vial at 37 &#176;C for 30 min to remove residual unpackaged plasmid DNA.</li>
	<li>Inactivate the DNAse at 95 &#176;C for 10 min. Cool down the solution, add 44 &#181;l of H2O, 5 &#181;l of 10x DNAse buffer, and 1 &#181;l of Proteinase K stock (10 mg/ml).</li>
	<li>Incubate the solution at 50 &#176;C for 2 hr. Stop the reaction and inactivate the Proteinase K at 95 &#176;C for 10 min.</li>
	<li>Use 1 &#181;l of the sample for the quantitative PCR (qPCR) assay. Calculate the titer.
	<ol>
		<li>Run quantitative PCR (qPCR) with the primers designed in step 4.1.1 using the samples from step 4.1.4 (standard samples) and from step 4.5 (samples to be measured).
		<ol>
			<li>For each reaction, mix 10 &#181;l of 2x Green master mix (containing Taq polymerase, dNTP mix, buffer, MgCl2, and Green dye), 0.5 &#181;l of forward primer (5 &#181;M), 0.5 &#181;l of reverse primer (5 &#181;M), 8 &#181;l of H2O, and 1 &#181;l of the sample to be measured. Perform qPCR with the following conditions: hold the samples at 50 &#176;C for 2 min and 95 &#176;C for 10 min; perform 40 cycles at 95 &#176;C for 15 sec and at 60 &#176;C for 1 min; for the melt stage, incubate the samples at 95 &#176;C for 30 sec and 60 &#176;C for 15 sec. Generate the standard curve based on the CT numbers of the standard samples (Figure 3).</li>
		</ol>
		</li>
		<li>Calculate the molecular concentration/titer of the AAV sample against the standard curve. The rAAV9 has a single-strand DNA genome, so the molecular concentration will be 2-fold higher than the calculated value (2x power (10, y), Figure 3B). In addition, the titer of the purified rAAV9 will be 20-fold higher than what is obtained from the calculation due to the 1:20 dilution of the virus in DNAse and Proteinase K reactions (5 &#181;l in 100 &#181;l total).</li>
	</ol>
	</li>
</ol>
5. rAAV9 Injection in Neonatal Mice and Gene Expression Assays in the Heart
<ol>
	<li>Prepare rAAV9 working solutions in polyoxyethylene-polyoxypropylene block copolymer PBS solution. Make the virus stock with the titers of 1-7 x 1012 particles/ml. 
	NOTE: Deliver 50-70 &#181;l of rAAV9 solution into each postnatal day 0.5-1.5 mouse by subcutaneous injection. To achieve efficient gene overexpression or knockdown, it is recommended to perform a pilot test for each study to optimize the amount of injected AAV. Use the same amount of rAAV9.cTNT::Luc or rAAV9.U6::scramble controls for each study to minimize the bias. 
	NOTE: We used 1-1.5 x 1011 particles/pup for overexpression and 2.5 - 5 x 1011 particles/pup for knockdown in postnatal day 0.5-1.5 mice).</li>
	<li>Treat neonatal mice with rAAV9 at P0.5-P2.5 by subcutaneous injection.
	<ol>
		<li>Pre-fill a 29G1/2, 0.33 x 12.7 mm insulin syringe with the rAAV9 solution. Be careful to remove air bubbles.</li>
		<li>Hold the&#160;cryo-anesthetized pup in one hand with thumb and forefinger. Prior to injection, swipe the back skin of the pup with a swab stick saturated with 70% isopropyl alcohol to maintain the sterile condition. Insert the syringe needle into the anterior-dorsal subcutis of the animal at an angle of 5 to 10&#176;. Inject 50-70 &#181;l of the rAAV9 solution using the insulin syringe. 
		NOTE: rAAV9 can also be delivered to the mouse via intraperitoneal or intravenous injection26,27. Efficient expression of the delivered genes in the heart can be obtained. However, intraperitoneal injection sometimes may result in leaky expression in the liver. After injection, the condition of the pups was monitored every day.</li>
	</ol>
	</li>
	<li>The level of gene expression in the heart can be monitored with qPCR, immunofluorescence, or western blot (representative results are shown in Figures 4 and 5)25,26. 
	NOTE: Mice were euthanized by CO2 delivered from a compressed gas source. Tissue samples were collected after confirming that heart rate, movement, and breathing of the animals had ceased. Neonatal rodents are resistant to CO2 euthanasia and were euthanized by decapitation using sharp scissors. The method is consistent with the recommendations of the Panel on Euthanasia of the American Veterinary Medical Association.</li>
</ol>

<ol><li>Primrose, S. B., Twyman, R. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=author%3aPrimrose%2C+SB+%22Principles+of+gene+manipulation+and+genomics%22">Principles of gene manipulation and genomics</a>. , John Wiley & Sons. (2013).</li>
<li>Doudna, J. A., Charpentier, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+new+frontier+of+genome+engineering+with+CRISPR-Cas9%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">The new frontier of genome engineering with CRISPR-Cas9.</a> Science. 346, 1258096(2014).</li>
<li>Gaj, T., Gersbach, C. A., Barbas, C. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((ZFN%2C+TALEN%2C+and+CRISPR%2FCas-based+methods+for+genome+engineering%5BTitle%5D)+AND+%22Trends+Biotechnol%22%5BJournal%5D)">ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering.</a> Trends Biotechnol. 31, 397-405 (2013).</li>
<li>Hsu, P. D., Lander, E. S., Zhang, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Development+and+applications+of+CRISPR-Cas9+for+genome+engineering%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">Development and applications of CRISPR-Cas9 for genome engineering.</a> Cell. 157, 1262-1278 (2014).</li>
<li>Sander, J. D., Joung, J. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CRISPR-Cas+systems+for+editing%2C+regulating+and+targeting+genomes%5BTitle%5D)+AND+%22Nat.+Biotechnol%22%5BJournal%5D)">CRISPR-Cas systems for editing, regulating and targeting genomes.</a> Nat. Biotechnol. 32, 347-355 (2014).</li>
<li>Szulc, J., Wiznerowicz, M., Sauvain, M. -O., Trono, D., Aebischer, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+versatile+tool+for+conditional+gene+expression+and+knockdown%5BTitle%5D)+AND+%22Nat.+Methods%22%5BJournal%5D)">A versatile tool for conditional gene expression and knockdown.</a> Nat. Methods. 3, 109-116 (2006).</li>
<li>Nimesh, S., Halappanavar, S., Kaushik, N. K., Kumar, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Advances+in+Gene+Delivery+Systems%5BTitle%5D)+AND+%22BioMed+Res.+Int%22%5BJournal%5D)">Advances in Gene Delivery Systems.</a> BioMed Res. Int. 2015, 610342(2015).</li>
<li>Kamimura, K., Suda, T., Zhang, G., Liu, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Advances+in+gene+delivery+systems%5BTitle%5D)+AND+%22Pharm.+Med%22%5BJournal%5D)">Advances in gene delivery systems.</a> Pharm. Med. 25, 293-306 (2011).</li>
<li>Thomas, C. E., Ehrhardt, A., Kay, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Progress+and+problems+with+the+use+of+viral+vectors+for+gene+therapy%5BTitle%5D)+AND+%22Nat.+Rev.+Genet%22%5BJournal%5D)">Progress and problems with the use of viral vectors for gene therapy.</a> Nat. Rev. Genet. 4, 346-358 (2003).</li>
<li>Giacca, M., Zacchigna, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Virus-mediated+gene+delivery+for+human+gene+therapy%5BTitle%5D)+AND+%22J.+Control+Release%22%5BJournal%5D)">Virus-mediated gene delivery for human gene therapy.</a> J. Control Release. 161, 377-388 (2012).</li>
<li>Witlox, M., Lamfers, M., Wuisman, P., Curiel, D., Siegal, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Evolving+gene+therapy+approaches+for+osteosarcoma+using+viral+vectors%3A+review%5BTitle%5D)+AND+%22Bone%22%5BJournal%5D)">Evolving gene therapy approaches for osteosarcoma using viral vectors: review.</a> Bone. 40, 797-812 (2007).</li>
<li>De Miguel, M. P., Cheng, L., Holland, E. C., Federspiel, M. J., Donovan, P. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Dissection+of+the+c-Kit+signaling+pathway+in+mouse+primordial+germ+cells+by+retroviral-mediated+gene+transfer%5BTitle%5D)+AND+%22Proc.+Natl.+Acad.+Sci.+USA%22%5BJournal%5D)">Dissection of the c-Kit signaling pathway in mouse primordial germ cells by retroviral-mediated gene transfer.</a> Proc. Natl. Acad. Sci. USA. 99, 10458-10463 (2002).</li>
<li>Nagano, M., Shinohara, T., Avarbock, M. R., Brinster, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Retrovirus-mediated+gene+delivery+into+male+germ+line+stem+cells%5BTitle%5D)+AND+%22FEBS+Lett%22%5BJournal%5D)">Retrovirus-mediated gene delivery into male germ line stem cells.</a> FEBS Lett. 475, 7-10 (2000).</li>
<li>Scharfmann, R., Axelrod, J. H., Verma, I. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Long-term+in+vivo+expression+of+retrovirus-mediated+gene+transfer+in+mouse+fibroblast+implants%5BTitle%5D)+AND+%22Proc.+Natl.+Acad.+Sci.+USA%22%5BJournal%5D)">Long-term in vivo expression of retrovirus-mediated gene transfer in mouse fibroblast implants.</a> Proc. Natl. Acad. Sci. USA. 88, 4626-4630 (1991).</li>
<li>Katz, R. A., Greger, J. G., Skalka, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Effects+of+cell+cycle+status+on+early+events+in+retroviral+replication%5BTitle%5D)+AND+%22J.+Cell.+Biochem%22%5BJournal%5D)">Effects of cell cycle status on early events in retroviral replication.</a> J. Cell. Biochem. 94, 880-889 (2005).</li>
<li>Escors, D., Breckpot, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Lentiviral+vectors+in+gene+therapy%3A+their+current+status+and+future+potential%5BTitle%5D)+AND+%22Arch.+Immunol.+Ther.+Exp%22%5BJournal%5D)">Lentiviral vectors in gene therapy: their current status and future potential.</a> Arch. Immunol. Ther. Exp. 58, 107-119 (2010).</li>
<li>Mátrai, J., Chuah, M. K., VandenDriessche, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Recent+advances+in+lentiviral+vector+development+and+applications%5BTitle%5D)+AND+%22Mol.+Ther%22%5BJournal%5D)">Recent advances in lentiviral vector development and applications.</a> Mol. Ther. 18, 477-490 (2010).</li>
<li>Miyazaki, Y., Miyake, A., Nomaguchi, M., Adachi, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Structural+dynamics+of+retroviral+genome+and+the+packaging%5BTitle%5D)+AND+%22Front.+Microbiol%22%5BJournal%5D)">Structural dynamics of retroviral genome and the packaging.</a> Front. Microbiol. 2, 1-9 (2011).</li>
<li>Douglas, J. T. Adenovirus-Mediated Gene Delivery. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=author%3aDouglas%2C+JT+%22Gene+Delivery+to+Mammalian+Cells%3A+Volume+2%3A+Viral+Gene+Transfer+Techniques%22">Gene Delivery to Mammalian Cells: Volume 2: Viral Gene Transfer Techniques</a>. , 3-14 (2004).</li>
<li>Armendáriz-Borunda, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Production+of+first+generation+adenoviral+vectors+for+preclinical+protocols%3A+amplification%2C+purification+and+functional+titration%5BTitle%5D)+AND+%22J.+Biosci.+Bioeng%22%5BJournal%5D)">Production of first generation adenoviral vectors for preclinical protocols: amplification, purification and functional titration.</a> J. Biosci. Bioeng. 112, 415-421 (2011).</li>
<li>Snyder, R. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Adeno-associated+virus-mediated+gene+delivery%5BTitle%5D)+AND+%22J+Gene+Med%22%5BJournal%5D)">Adeno-associated virus-mediated gene delivery.</a> J Gene Med. 1, 166-175 (1999).</li>
<li>Samulski, R. J., Muzyczka, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((AAV-mediated+gene+therapy+for+research+and+therapeutic+purposes%5BTitle%5D)+AND+%22Annu.+Rev.+Virol%22%5BJournal%5D)">AAV-mediated gene therapy for research and therapeutic purposes.</a> Annu. Rev. Virol. 1, 427-451 (2014).</li>
<li>Kaplitt, M. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Long-term+gene+transfer+in+porcine+myocardium+after+coronary+infusion+of+an+adeno-associated+virus+vector%5BTitle%5D)+AND+%22Ann.+Thorac.+Surg%22%5BJournal%5D)">Long-term gene transfer in porcine myocardium after coronary infusion of an adeno-associated virus vector.</a> Ann. Thorac. Surg. 62, 1669-1676 (1996).</li>
<li>Kaspar, B. K., et al. Myocardial gene transfer and long-term expression following intracoronary delivery of adeno-associated virus. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=author%3aKaspar%2C+BK+%22J.+Gene.+Med%22">J. Gene. Med</a>. 7, 316-324 (2005).</li>
<li>Ding, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Trbp+regulates+heart+function+through+microRNA-mediated+Sox6+repression%5BTitle%5D)+AND+%22Nat.+Genet%22%5BJournal%5D)">Trbp regulates heart function through microRNA-mediated Sox6 repression.</a> Nat. Genet. 47, 776-783 (2015).</li>
<li>Lin, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cardiac-specific+YAP+activation+improves+cardiac+function+and+survival+in+an+experimental+murine+MI+model%5BTitle%5D)+AND+%22Circ.+Res%22%5BJournal%5D)">Cardiac-specific YAP activation improves cardiac function and survival in an experimental murine MI model.</a> Circ. Res. 115, 354-363 (2014).</li>
<li>Wahlquist, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Inhibition+of+miR-25+improves+cardiac+contractility+in+the+failing+heart%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">Inhibition of miR-25 improves cardiac contractility in the failing heart.</a> Nature. 508, 531-535 (2014).</li>
<li>Carroll, K. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+mouse+model+for+adult+cardiac-specific+gene+deletion+with+CRISPR%2FCas9%5BTitle%5D)+AND+%22Proc.+Natl.+Acad.+Sci.+USA%22%5BJournal%5D)">A mouse model for adult cardiac-specific gene deletion with CRISPR/Cas9.</a> Proc. Natl. Acad. Sci. USA. 113, 338-343 (2016).</li>
<li>Jiang, J., Wakimoto, H., Seidman, J., Seidman, C. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Allele-specific+silencing+of+mutant+Myh6+transcripts+in+mice+suppresses+hypertrophic+cardiomyopathy%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Allele-specific silencing of mutant Myh6 transcripts in mice suppresses hypertrophic cardiomyopathy.</a> Science. 342, 111-114 (2013).</li>
<li>Gibson, D. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Enzymatic+assembly+of+DNA+molecules+up+to+several+hundred+kilobases%5BTitle%5D)+AND+%22Nat.+Methods%22%5BJournal%5D)">Enzymatic assembly of DNA molecules up to several hundred kilobases.</a> Nat. Methods. 6, 343-345 (2009).</li>
<li>Rychlik, W., Spencer, W., Rhoads, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Optimization+of+the+annealing+temperature+for+DNA+amplification+in+vitro%5BTitle%5D)+AND+%22Nucleic+Acids+Res%22%5BJournal%5D)">Optimization of the annealing temperature for DNA amplification in vitro.</a> Nucleic Acids Res. 18, 6409-6412 (1990).</li>
<li>Allocca, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Serotype-dependent+packaging+of+large+genes+in+adeno-associated+viral+vectors+results+in+effective+gene+delivery+in+mice%5BTitle%5D)+AND+%22J.+Clin.+Invest%22%5BJournal%5D)">Serotype-dependent packaging of large genes in adeno-associated viral vectors results in effective gene delivery in mice.</a> J. Clin. Invest. 118, 1955-1964 (2008).</li>
<li>Wu, Z., Yang, H., Colosi, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Effect+of+genome+size+on+AAV+vector+packaging%5BTitle%5D)+AND+%22Mol.+Ther%22%5BJournal%5D)">Effect of genome size on AAV vector packaging.</a> Mol. Ther. 18, 80-86 (2010).</li>
<li>Li, J., Sun, W., Wang, B., Xiao, X., Liu, X. -Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Protein+trans-splicing+as+a+means+for+viral+vector-mediated+in+vivo+gene+therapy%5BTitle%5D)+AND+%22Hum.+Gene+Ther%22%5BJournal%5D)">Protein trans-splicing as a means for viral vector-mediated in vivo gene therapy.</a> Hum. Gene Ther. 19, 958-964 (2008).</li>
<li>Piras, B. A., O'Connor, D. M., French, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Systemic+delivery+of+shRNA+by+AAV9+provides+highly+efficient+knockdown+of+ubiquitously+expressed+GFP+in+mouse+heart%2C+but+not+liver%5BTitle%5D)+AND+%22PLoS+One%22%5BJournal%5D)">Systemic delivery of shRNA by AAV9 provides highly efficient knockdown of ubiquitously expressed GFP in mouse heart, but not liver.</a> PLoS One. 8, e75894(2013).</li>
<li>Lovric, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Terminal+differentiation+of+cardiac+and+skeletal+myocytes+induces+permissivity+to+AAV+transduction+by+relieving+inhibition+imposed+by+DNA+damage+response+proteins%5BTitle%5D)+AND+%22Mol.+Ther%22%5BJournal%5D)">Terminal differentiation of cardiac and skeletal myocytes induces permissivity to AAV transduction by relieving inhibition imposed by DNA damage response proteins.</a> Mol. Ther. 20, 2087-2097 (2012).</li>
</ol>

The authors have nothing to disclose.

It is important to minimize undesired ITR recombination during plasmid construction. Before generating the virus, one must always monitor the ITR integrity of the AAV plasmids by using restriction digestion and agarose gel electrophoresis. It is impossible to obtain 100% intact plasmids, but the recombination ratio should be minimized as much as possible. Less than 20% is acceptable for successful rAAV9 packaging. Of note, culturing the bacteria at lower temperature (30 &#176;C) with a lower shaking speed (180-200 rpm) c...

A correction was made to the Authors section in: <a href="http://www.jove.com/video/54787">Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts</a>.
One of the authors names and affiliation was corrected from:
Jian-Ming Jiang3,4 
3 Department of Genetics, Harvard Medical School 
4 Howard Hughes Medical Institute
to:
Jianming Jiang5 
5 Department of Biochemistry, Yong Loo Lin School of Medicine, National University of Singapore

A correction was made to the Authors section in: <a href="http://www.jove.com/video/54787">Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts</a>.

Erratum: Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts

Controlling expression or activity of specific genes in various biological systems has become a valuable strategy in the study of gene function1. A direct means of accomplishing this goal is to manipulate nucleotide sequences and generate mutant alleles. Although making precise, targeted changes to the genome of living cells is still a time-consuming and labor-intensive practice, the development of the powerful TALEN and Crispr/Cas9 tools has opened a new era of genome editing2-5. A more routine laboratory method for gene manipulation has focused on the introduction of genetic materials (DNAs and RNAs containing coding sequences or siRNAs/shRNAs) into the cells to express or knockdown the gene(s) of interest1,6.
In many cases, the major bottleneck for gene manipulation is the delivery of DNA, RNA, or protein into the cells. With regard to in vitro studies, efficient transfection systems have been established in many cultured cell lines. However, in the mouse model in particular, in vivo gene delivery is more challenging. There are a series of extra- and intracellular barriers that need to be bypassed in order to achieve efficient cellular uptake of the exogenous reagents. Additional obstacles include the rapid clearance and the short duration of the delivered materials7,8. One strategy to circumvent these issues is to use viral vectors as &#34;carriers&#34; or &#34;vehicles&#34; for in vivo gene delivery. The naturally-evolved transduction properties of viruses allow the efficient delivery of a gene of interest into cells7,9,10. Numerous types of viral vectors have been developed and enable flexible in vivo gene manipulation in different cell types and organs in mice.
The most commonly-used viral systems include Retrovirus, Lentivirus, Adenovirus, and Adeno-associated virus (AAV)11. Retroviruses are single-stranded RNA viruses and can introduce their genetic material to the host cell genome in a stable manner during mitotic division, providing the potential for lifelong expression of the transduced genes in the target cells and organs12-14. However, many types of retroviruses only infect dividing cells, and their efficacy in non-dividing cells is very low15. This limits their utility for gene delivery. Lentivirus is a genus of the Retroviridae family. Different from other retroviruses, Lentivirus can infect both dividing and non-dividing cells and has been widely used for gene transfer into post-mitotic and highly-differentiated cells16. The life cycle of Lentivirus also involves the integration of vector DNA into the host genome. Thus, Lentivirus-mediated gene delivery enables stable and long-duration expression of the transduced genetic elements16-18. However, this feature may represent a double-edged sword in the use of these viruses to manipulate gene expression, as integration of vector DNA may lead to insertional mutagenesis in the host cells and can cause artefactual effects. Adenovirus is another widely-used gene delivery system. Unlike retroviruses and lentiviruses, Adenoviruses are non-integrated and do not interfere with the genomic integrity of host cells8,10,11,19. In addition, Adenoviruses can transfect DNA into many cell types, and infection is not dependent upon active cell division19. Another important characteristic of Adenoviruses is the ease of vector purification, as the viral vectors have the ability to be replicated19,20. However, the major caveat of this system is that Adenovirus infection can trigger strong immune responses in target cells and organs19, restricting its use in many investigations, particularly in gene therapy studies.
Compared with these different types of viral vectors, recombinant Adeno-associated virus (rAAV) appears to be the ideal gene delivery system21,22. It exhibits minimal immunogenicity and pathogenicity23,24. In addition, rAAV infects a broad range of cell types, including both dividing and non-dividing cells. In most cases, rAAV does not integrate into host genomes; thus, the risk of undesired genetic or genomic changes in the target cells is low22.
Recently, rAAV systems have been successfully used for the in vivo delivery of DNA encoding proteins, miRNAs, shRNAs, and Crispr-gRNAs into mouse cardiac muscle23,25-29. This methodology has facilitated fundamental investigations and gene therapy studies in the field of cardiovascular research. Here, the detailed procedure to generate rAAV9 vectors that efficiently overexpress or knockdown the genes of interest in mouse hearts was described. The protocol provides a simple and effective method of manipulating cardiac gene expression in murine experimental models.

<table><tbody><tr><td>Polyethylenimine, Linear (MW 25,000)</td><td>Polysciences, Inc.&amp;nbsp;</td><td>#23966-2</td><td></td></tr><tr><td>Tube, Polypropylene, 36.2 ml, 25 x 87 mm, (qty. 56)</td><td>Beckman Coulter, Inc</td><td># 362183</td><td></td></tr><tr><td>Nuclease, ultrapure</td><td>SIGMA</td><td>#E8263-25KU</td><td></td></tr><tr><td>Density Gradient Medium(Iodixanol)</td><td>SIGMA</td><td>#D1556-250ML</td><td></td></tr><tr><td>Centrifugal Filter Unit with Ultracel-100 membrane</td><td>EMD Millipore Corporation</td><td>#UFC910008</td><td></td></tr><tr><td>Laboratory pipetting needle with 90&amp;deg; blunt ends,gauge 14, L 6 in., nickel plated hub</td><td>SIGMA</td><td>#CAD7942-12EA</td><td></td></tr><tr><td>Poloxamer 188 solution (Pluronic&amp;reg; F-68 solution)</td><td>SIGMA</td><td>P5556-100ML</td><td></td></tr><tr><td>Proteinase K</td><td>SIGMA</td><td>3115828001</td><td></td></tr><tr><td>DNase I</td><td>Roche</td><td>10104159001</td><td></td></tr><tr><td>Centrifuge machine</td><td>Thermo Scientific</td><td>75004260</td><td></td></tr><tr><td>Centrifuge System</td><td>Beckman Coulter</td><td>363118</td><td></td></tr><tr><td>Ultracentrifuge</td><td>Beckman Coulter</td><td></td><td></td></tr><tr><td>DMEM medium</td><td>Fisher Scientific</td><td>SH30243FS</td><td></td></tr><tr><td>Fetal Bovine Serum&amp;nbsp;</td><td>Atlanta Biologicals&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;</td><td>S11150</td><td></td></tr><tr><td>rAAV9 vector</td><td>Penn Vector Core</td><td>P1967</td><td></td></tr></tbody></table>

preparation of raav9 to overexpress or knockdown genes in mouse hearts

Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts

Controlling the expression or activity of specific genes through the myocardial delivery of genetic materials in murine models permits the investigation of gene functions. Their therapeutic potential in the heart can also be determined. There are limited approaches for in vivo molecular intervention in the mouse heart. Recombinant adeno-associated virus (rAAV)-based genome engineering has been utilized as an essential tool for in vivo cardiac gene manipulation. The specific advantages of this technology include high efficiency, high specificity, low genomic integration rate, minimal immunogenicity, and minimal pathogenicity. Here, a detailed procedure to construct, package, and purify the rAAV9 vectors is described. Subcutaneous injection of rAAV9 into neonatal pups results in robust expression or efficient knockdown of the gene(s) of interest in the mouse heart, but not in the liver and other tissues. Using the cardiac-specific TnnT2 promoter, high expression of GFP gene in the heart was obtained. Additionally, target mRNA was inhibited in the heart when a rAAV9-U6-shRNA was utilized. Working knowledge of rAAV9 technology may be useful for cardiovascular investigations.

The strategies for rAAV9 construction of rAAV9.cTNT::GFP or rAAV9.U6::shRNA plasmids are shown in Figures 1 and 2, respectively. As the examples, the rAAV9 vector was generated to overexpress the GFP gene in mouse hearts. The resulting plasmid contains the cTNT::GFP cassette flanked by two ITR sites (Figure 1). The rAAV9.U6::shRNA vector was constructed to knockdown Trbp mRNA (Figure 2)
<p class="jove_content" fo:keep...

In this manuscript, a method to prepare recombinant adeno-associated virus 9 (rAAV9) vectors to manipulate gene expression in the mouse heart is described.

Controlling the expression or activity of specific genes through the myocardial delivery of genetic materials in murine models permits the investigation ...

The overall goal of this procedure is to prepare recombinant adeno-associated virus nine, or rAAV9, to manipulate gene expression in mouse hearts. The method can answer key question in the field of cardiology and molecular genetics, such as how to study gene function in mouse heart in vivo. The main advantage of this technique is that it will allow us to easily manipulate the gene expression and function in vivo in mouse heart, allowing the functional access of gene function without having to rely on the genetically modified animal models.After generating rAAV9 constructs and culturing HEK293 cells according to the text protocol, to transfect the cells on day one, combine 70 micrograms of AAV Rep-Cap plasmid, 70 micrograms of rAAV9 plasmid, and 200 micrograms of Ad helper plasmid in a 50-milliliter centrifuge tube. Add 49 milliliters of room temperature DMEM without FBS to the tube and mix well. Then, to make a four-to-one PEI to DNA solution, add 1, 360 microliters of PEI to the tube and mix well.Incubate the solution at room temperature for 15 to 30 minutes. After the incubation, add five milliliters of the solution to each 150-milliliter dish of cells. Culture the cells at 37 degrees Celsius and 5%CO2 for 50 to 72 hours.To harvest the transfected cells, dislodge and suspend the cells by using the culture medium to pipette up and down. Then transfer the cell suspensions to sterile 50-milliliter tubes. Centrifuge the cells at 500 times G for five minutes.Then add five milliliters of PBS to each tube and re-suspend the cell pellets before combining all the suspensions in one 50-milliliter tube. After spinning the cells at 500 times G for five minutes, discard the supernatant. To purify the AAV, re-suspend the pellet in 10 milliliter of lysis buffer.Freeze the lysate at minus 80 degrees Celsius or in a dry ice ethanol bath. Then thaw it at 37 degrees Celsius. Vortex the lysate for one minute before repeating the freeze and thaw two more times.Next, add one millimolar magnesium chloride to the thawed lysate. Then add nuclease to a final concentration of 250 units per milliliter. Incubate the solution at 37 degrees Celsius for 15 minutes to dissolve the DNA protein aggregation.Centrifuge the sample at 4, 800 times G and four degrees Celsius for 20 minutes. Then collect the supernatant. Meanwhile, to prepare a 17%iodixanol gradient solution, mix five milliliters of 10X PBS with 0.05 milliliters of one molar magnesium chloride, 0.125 milliliters of one molar potassium chloride, 10 milliliters of five molar sodium chloride, and 12.5 milliliters of density gradient medium.Use water to adjust the total volume to 50 milliliters. After preparing 25, 40, and 60%gradient solutions according to the text protocol, use a needle and syringe to load five milliliters of 17%gradient solution into a polypropylene tube. Follow this with five milliliters each of 25, 40, and 60%gradient solutions.Layer the lysate on top of the gradient. Then fill the tube with lysis buffer and cover it with a cork. Centrifuge the gradient at 185, 000 times G and 16%Celsius for 90 minutes.Following the spin, use a syringe to harvest the 40%viral fraction by inserting a 21 gauge needle into the intersection between the 40 and 60%fractions, completely avoiding the 25%layer. Mix the viral fraction with sterilized polyoxyethylene polyoxypropylene, or PEG-PPG block copolymer PBS solution, up to a total volume of 15 milliliters. Load the mixture into a filter tube with a molecular weight cutoff of 100 kilodaltons.Then centrifuge the sample at 2, 000 times G and four degrees Celsius for 30 minutes. Decant the solution from the bottom of the tube. Then use PEG-PPG to refill the filter tube to 15 milliliters.Centrifuge the tube at 2, 000 times G and four degrees Celsius for 20 minutes. After repeating the refilling and spin two more times, collect the purified rAAV9 virus fraction still above the filter. Aliquot 100 to 400 microliters of the purified rAAV9 into 1.7-milliliter tubes, depending on the viral titer, and store the virus at minus 80 degrees Celsius.After determining the viral titer according to the text protocol, prepare rAAV9 working solutions with virus titers of one to seven times 10 to the 12th particles per milliliter. To treat neonatal mice, use the rAAV9 solution to pre-fill a 0.33 by 12.7-milliliter insulin syringe with a 29 gauge one-half inch needle, avoiding air bubbles. After cryo-anesthetizing a pup, hold the pup in one hand with thumb and forefinger, then swipe the back skin of the pup with a swab stick saturated with 70%isopropyl alcohol.Insert the syringe into the anterior dorsal subcutis of the animal at an angle of five to 10 degrees before injecting 50 to 70 microliters of the rAAV9 solution. The standard curve for rAAV9 titration was generated with the qPCR data by linear regression. The manipulated variable y represents the log10 value of the DNA molecular concentration of each standard sample, and the corresponding variable x represents the Ct value.The log10 concentration values and Ct numbers exhibit a nice linear correlation and fit with the equation shown here. Titers of rAAV9 samples were calculated based on the linear equation. Using the method demonstrated in this video, a high titer of rAAV9 vectors was obtained in this representative study.To monitor the efficiency and tissue specificity of rAAV9 cTNT vectors, P0.5 pups were treated with the same amount of rAAV9 cTNT luciferase or rAAV9 cTNT GFP by subcutaneous injection. Two weeks after injection, robust expression of GFP was detected in the heart but not in other organs. To monitor the knockdown efficiency and tissue specificity of rAAV9 U6 vectors, P0.5 mice were treated with the same amount of rAAV9 U6 scramble or rAAV9 U6 Trbp shRNA by subcutaneous injection.Two weeks after injection, the mRNA level of Trbp in the heart was substantially reduced by rAAV9 U6 shTrbp. Down-regulation of Trbp was also detected to a lesser extent in the liver. Once mastered, rAAV preparation can be done in five days, if it is formulated properly.While attempting this procedure, it is important to remember to use healthy 293 cells for rAAV packaging. After its development, this technique paved the way for researchers in the field of cardiology and genetics to explore gene functions and gene therapeutic potentials in mouse hearts. After watching this video, you should have a good understanding of how to prepare recombinant AAV9 to manipulate the gene expressing any function in mouse hearts.

preparation-of-raav9-to-overexpress-or-knockdown-genes-in-mouse-hearts

Research

JoVE Journal

Genetics

Adult cardiac myocytes are primary cells that can be isolated from animal hearts and cultured for several days. Within this culture period adenoviral gene transfer can be used to express genetically encoded biosensors (GEBs) or fluorescent fusion proteins. Both approaches allow cellular investigations by means of confocal microscopy.

Isolation and Genetic Manipulation of Adult Cardiac Myocytes for Confocal Imaging

In this video, we demonstrate recombinant adeno associated virus-based gene delivery in the mouse pup. This method helps in studying gene expression in the targeted cells.

Recombinant Adeno Associated Virus Based Gene Delivery: A Technique for Transgene Delivery and Cardiac-Specific Expression in Rodent Model

Here we present a protocol for cardiac-specific gene manipulation in mice. Under anesthesia, the mouse hearts were externalized through the fourth intercostal space. Subsequently, adenoviruses encoding specific genes were injected with a syringe into the myocardium, followed by protein expression measurement via in vivo imaging and Western blot analysis.

A Simple and Efficient Method for In Vivo Cardiac-specific Gene Manipulation by Intramyocardial Injection in Mice

Here we provide a detailed protocol to carry out in vivo cardiac gene editing in mice using recombinant Adeno-Associated Virus(rAAV)-mediated delivery of CRISPR. This protocol offers a promising therapeutic strategy to treat dystrophic cardiomyopathy in Duchenne muscular dystrophy and can be used to generate cardiac-specific knockout in postnatal mice.

Adeno-Associated Virus-Mediated Delivery of CRISPR for Cardiac Gene Editing in Mice

This protocol presents a simple and coherent way to transiently upregulate a gene of interest using modRNA after myocardial infarction in mice.

Delivery of Modified mRNA in a Myocardial Infarction Mouse Model

The present protocol describes methods for transgene expression in rat and mouse hearts by direct intramyocardial injection of the virus under echocardiography guidance. Methods for the assessment of the susceptibility of hearts to ventricular arrhythmias by the programmed electrical stimulation of isolated, Langendorff-perfused hearts are also explained here.

Viral Transgene Expression in Rodent Hearts and the Assessment of Cardiac Arrhythmia Risk

In this protocol, we describe the technical procedures to generate brown adipose tissue (BAT)-specific knockout mice leveraging a combined Cre-LoxP, CRISPR-Cas9, and adeno-associated virus (AAV) single-guide RNA (sgRNA) system. The described steps include the design of the sgRNAs, the preparation of the AAV-sgRNA particles, and the microinjection of AAV into the BAT lobes.

Generation of Brown Fat-Specific Knockout Mice Using a Combined Cre-LoxP, CRISPR-Cas9, and Adeno-Associated Virus Single-Guide RNA System

Here, we describe a method to selectively alter gene expressions in the choroid plexus while avoiding any impact in other brain areas.

Targeted Knockdown of Genes in the Choroid Plexus

This protocol presents a detailed methodological framework for electroporation-based transgenesis of cardiac cells in developing mouse hearts. The video assets provided here will facilitate learning of this versatile technique.

An Efficient Transgenesis Approach for Gene Delivery in the Mouse Embryonic Heart

Here we present a protocol that facilitates the medium to high throughput functional characterization of gene and promoter constructs in tree secondary stem tissue within comparatively short time frames. It is efficient, easy to use and widely applicable to a range of tree species.

The Use of Induced Somatic Sector Analysis (ISSA) for Studying Genes and Promoters Involved in Wood Formation and Secondary Stem Development

Learn to prepare rAAV9 vectors for gene overexpression and knockdown in mouse hearts using HEK293 cell transfection. This method enables cardiac gene function studies without genetically modified animal models.

Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts

Explore More Videos