Name: Generation of Defined Genomic Modifications Using CRISPR-CAS9 in Human Pluripotent Stem Cells (Video) | JoVE Journal
Uploaded: 2019-09-25T14:00:00.000+00:00
Duration: 9 min 4 s
Description: Learn CRISPR-Cas9 gene editing in human pluripotent stem cells to generate defined heterozygous or homozygous mutations. This protocol enables creation of isogenic lines for studying gene function and disease mechanisms.

ai_agent_IP

ai_agent

maintenance

instantTrialDurationMinutes

isBiopharma

enableNewMyJoveSectionDesign

educationFeatures

seoMetaApi

ai_copilot_institution_blacklist

ai_chat_institution_blacklist

freeAccessWindow

ssoRoleCapture

scheduledMaintenanceBanner

joveLabsFeatures

disable_autoplay_for_bots

extended_trial_duration

5 minutes

This research was supported by funding from the National Heart, Lung, and Blood Institute (NHLBI), National Institutes of Health through grants U01HL099656 (P.G. and D.L.F.) and U01HL134696 (P.G. and D.L.F.).

1. Design and construction of guide RNA (gRNA)
NOTE: Each gRNA is made up of two 60 base pair (bp) oligonucleotides that are annealed to generate a 100 bp double stranded (ds) oligonucleotide (Figure 1A-C). The timeline for gRNA design, generation, and testing cutting efficiency is approximately 2 weeks (Figure 2).
<ol>
	<li>Select the DNA region of interest to be genome edited and identify 3-4 23 bp sequences that fit the format, 5&#39;-G(N19)NGG-3&#39;. These sequences should be located within 20 bp of the region of interest. 
	NOTE: Targeting can be performed on the sense or anti-sense strand.</li>
	<li>Evaluate the gRNA sequences for genomic redundancy and off-target probability using a resource such as CRISPOR (http://crispor.tefor.net).</li>
	<li>Incorporate the 20 bp target sequence (excluding the protospacer adjacent motif or PAM) into two 60-mer oligonucleotides as shown (sequences are 5&#39;&#160;to 3&#39;&#160;and red and green are reverse complements as shown in Figure 1C).</li>
	<li>Order the two 60 bp oligonucleotides from vendor of choice. Once the oligonucleotides are received, resuspend each to a final concentration of 100 &#181;M in ddH2O. Make a working stock of 10 &#181;M.</li>
	<li>Anneal the two oligonucleotides and generate a 100 bp dsDNA fragment using DNA polymerase (Table of Materials). Combine 5 &#181;L of 10 &#181;M forward oligonucleotide and 5 &#181;L of 10 &#181;M reverse oligonucleotide in a polymerase chain reaction (PCR) strip tube and incubate at 95 &#176;C for 5 min. Cool the reaction for 10 min at room temperature (RT).</li>
	<li>Set up the PCR as described in Table 1. Perform PCR amplification in a thermal cycler using the parameters outlined in Table 2.</li>
	<li>Visualize the PCR products on a 1.5% (w/v) ethidium bromide (EtBr) agarose gel electrophoresed at 80-100 V for 40 min. Excise the 100 bp band (Figure 3A), visualized on an LED light box, from the gel using a razor blade and purify using a gel extraction kit (Table of Materials).</li>
</ol>
2. Design of PCR primers for screening
<ol>
	<li>Perform screening of the edited DNA using forward and reverse PCR primers that are specifically designed to amplify a 400-500 bp region of the gene of interest (Table 2). Use DNA isolated from any control iPSC line to confirm a clean amplicon when performing the screening PCR.</li>
	<li>Visualize PCR products on a 1.5% (w/v) gel following electrophoresis at 80-100 V for 1 h. 
	NOTE: Sequencing of edited clones is performed using a nested primer that is designed following confirmation of the screening primer set. Samples are sent to a commercial source for sequencing.</li>
</ol>
3. Preparation of gRNA_cloning vector plasmid
<ol>
	<li>To linearize the cloning vector, take a 1.5 mL centrifuge tube and add 1-5 &#181;g of DNA of the gRNA_cloning vector along with 4 &#181;L of the AflII restriction enzyme buffer and 1.5 &#181;L of AflII restriction enzyme. Bring up the reaction to 24 &#181;L of ddH2O. Mix the reaction by pipetting up and down. Incubate at 37 &#176;C overnight (O/N).</li>
	<li>Electrophorese on a 1% agarose gel at 80-100 V for 1 h and excise bands (expected band size is ~3519 bp).</li>
	<li>Extract and purify as in step 1.6.</li>
</ol>
4. Assembly of gRNA vector
<ol>
	<li>Set up reactions and assemble DNA fragments using the assembly kit (Table of Materials) at 1:5 ratios of AflII digested gRNA cloning vector to 100 bp gel purified insert, as described in Table 3.</li>
	<li>Incubate the reaction at 50 &#176;C for 15 min. Dilute the reaction 1:3 in ddH2O and use 3 &#181;L for bacterial transformation, as per manufacturer&#8217;s instructions (Table of Materials). Plate cells on kanamycin LB/agar plates.</li>
	<li>Pick 3-5 colonies per gRNA. Inoculate each colony in 4 mL of LB and grow O/N at 37 &#176;C in an orbital shaking incubator.</li>
	<li>Purify plasmid DNA using a miniprep plasmid isolation kit, and sequence each gRNA using the following primers to ensure successful cloning: Forward: GTACAAAAAAGCAGGCTTTAAAGG; Reverse: TGCCAACTTTGTACAAGAAAGCT.</li>
</ol>
5. Test gRNA cutting efficiency
<ol>
	<li>Plate hESCs on irradiated murine embryonic fibroblasts (MEFs) in a 6-well plate, as previously described21. When the cells reach 70-80% confluency, prepare the transfection master mix outlined in Table 4.</li>
	<li>Mix by pipetting and incubate at RT for 15 min. Add dropwise to the cells and incubate at 37 &#176;C for 48 h (with a media change after 24 h).</li>
	<li>Harvest cells for sorting after 48 h.
	<ol>
		<li>Remove MEFs enzymatically (Table of Materials) with a 3 min RT incubation.</li>
		<li>Rinse cells 1x with hESC medium (Table 5) and scrape into hESC medium + 10 &#181;M Y-27632 dihydrochloride (Table of Materials).</li>
		<li>Pellet cells at 300 x g for 3 min and resuspend in 0.5 mL of hESC medium + 10 &#181;M Y-27632 dihydrochloride.</li>
		<li>Filter into a 5 mL tube through a 35 &#181;m cell-strainer cap.</li>
	</ol>
	</li>
	<li>Using fluorescence activated cell sorting (FACS), gate on live cells and sort the green fluorescent protein (GFP) positive cells.</li>
	<li>Transfer a maximum of 1.5 x 104 sorted cells directly into a 10 cm2 dish coated with 1:3 basement membrane matrix (Table of Materials) and irradiated MEFs in hESC medium (Table 5) containing Y-27632 dihydrochloride.</li>
	<li>Change medium daily using the hESC medium (Table 5) without Y-27632 dihydrochloride and manually pick clones after 10-15 days, when colonies are ~1 mm in diameter.
	<ol>
		<li>Using a P200 pipette and microscope, carefully scrape a single clone and draw cells into the pipette.</li>
		<li>Disperse the cells by gently pipetting 3-4x in a 96 well plate in the medium drawn up with the colony.</li>
		<li>Dispense into PCR strip tubes for screening and pellet the cells by centrifugation at 10,000 x g for 5 min. Pick 20 colonies per gRNA.</li>
	</ol>
	</li>
</ol>
6. Clone screening
<ol>
	<li>Isolate DNA by incubating cell pellets in 20 &#181;L of proteinase K buffer (Table 5) (1 h at 55 &#176;C and 10 min at 95 &#176;C) and vortex vigorously. Centrifuge at 10,000 x g for 5 min and collect the supernatant.</li>
	<li>Perform screening PCR (section 2) in a total volume of 20 &#181;L using a master mix including primers designed to amplify the region of interest and 5 &#181;L of the proteinase K digest. Use genomic DNA isolated from the cell line that was gene edited as a control.</li>
	<li>Evaluate size changes of PCR products following 1 h electrophoresis at 70-90 V on a 2.5% (w/v) agarose gel (Figure 3B,C). Any size difference is indicative of cleavage.</li>
</ol>
7. Precise genome editing in pluripotent stem cells using single strand oligo DNA (ssODNs)
<ol>
	<li>Design 100 bp ssODNs centered around the most efficient gRNA sequence determined to have the best cutting efficiency.</li>
	<li>Prevent re-cleavage of the recombined ODN by introducing silent mutations in the gRNA sequence. A single silent mutation in the PAM sequence is sufficient, but if not possible, 3-4 silent mutations will work. 
	NOTE: To facilitate screening of targeted clones, the introduction of a restriction site within ~20 bp of the gRNA sequence is ideal.</li>
	<li>Design one ODN with the desired base change(s) to create the mutation of interest and one ODN without the base change(s). 
	NOTE: These changes should be no more than ~20 bp from the predicted CRISPR/CAS9 cut site, as recombination drops off considerably at greater distances.</li>
	<li>Order the two ssODNs from vendor of choice and resuspend in water to make 1 &#181;g/&#181;L stocks. Store stocks at -20 &#176;C.</li>
</ol>
8. Transfection setup
<ol>
	<li>To transfect the ssODN and the CRISPR-CAS9 plasmids, plate the target cell line in a 6-well dish on irradiated MEFs to reach 70-80% confluency after an O/N incubation.</li>
	<li>Set up the transfection reaction as described in Table 6. Mix the reaction by pipetting and incubate for 15 min at RT. Add the transfection reaction mixture dropwise to the cells.</li>
	<li>After 48 h, prepare the cells for cell sorting as described in section 5.3.</li>
	<li>Pick colonies ~10 days after plating single cells using a 200 &#956;L pipette. Transfer 100 &#956;L of cells to one well of a 24 or 48 well plate previously coated with gelatin and irradiated MEFs in hESC medium with Y-27632 dihydrochloride. Use the remaining 100 &#956;L for DNA isolation as described in section 6.</li>
</ol>
9. Checking for mutations in single colonies
<ol>
	<li>To check for successful integration of the ssODN, take 5 &#181;L of DNA isolated from each colony to perform PCR using the screening primers designed in section 2. Purify the PCR products (Table of Materials) and prepare the restriction enzyme digestion using the unique enzyme site created in the ssODN. 
	NOTE: This digestion also includes the restriction enzyme buffer and the manufacturer&#39;s recommended concentration of restriction enzyme in a volume of 40 &#181;L.</li>
	<li>Mix the reaction by pipetting and incubate at the manufacturer&#39;s recommended temperature for 1-3 h.</li>
	<li>Visualize the digested PCR products on a 1.5% (w/v) EtBr agarose gel electrophoresed at 80-100 V for 40 min. If successful integration of the ssODN has occurred, sequence specific mutations using a nested primer.</li>
</ol>

<ol><li>Srivastava, D., Dewitt, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Review+In+Vivo+Cellular+Reprogramming%3A+The+Next+Generation%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">Review In Vivo Cellular Reprogramming: The Next Generation.</a> Cell. 166 (6), 1386-1396 (2016).</li>
<li>Clevers, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Review+Modeling+Development+and+Disease+with+Organoids%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">Review Modeling Development and Disease with Organoids.</a> Cell. 165 (7), 1586-1597 (2016).</li>
<li>Murry, C. E., Keller, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Differentiation+of+Embryonic+Stem+Cells+to+Relevant+Populations%3A+Lessons+from+Embryonic+Development%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">Differentiation of Embryonic Stem Cells to Relevant Populations: Lessons from Embryonic Development.</a> Cell. 132 (4), 661-680 (2008).</li>
<li>Liu, C., Oikonomopoulos, A., Sayed, N., Wu, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Modeling+human+diseases+with+induced+pluripotent+stem+cells%3A+from+2D+to+3D+and+beyond%5BTitle%5D)+AND+%22Development%22%5BJournal%5D)">Modeling human diseases with induced pluripotent stem cells: from 2D to 3D and beyond.</a> Development. 145 (5), 1-6 (2018).</li>
<li>Avior, Y., Sagi, I., Benvenisty, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Pluripotent+stem+cells+in+disease+modelling+and+drug+discovery%5BTitle%5D)+AND+%22Nature+Reviews+Molecular+Cell+Biology%22%5BJournal%5D)">Pluripotent stem cells in disease modelling and drug discovery.</a> Nature Reviews Molecular Cell Biology. 17 (3), 170-182 (2016).</li>
<li>Tiyaboonchai, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((GATA6+Plays+an+Important+Role+in+the+Induction+of+Human+Definitive+Endoderm%2C+Development+of+the+Pancreas%2C+and+Functionality+of+Pancreatic+%CE%B2+Cells%5BTitle%5D)+AND+%22Stem+Cell+Reports%22%5BJournal%5D)">GATA6 Plays an Important Role in the Induction of Human Definitive Endoderm, Development of the Pancreas, and Functionality of Pancreatic β Cells.</a> Stem Cell Reports. 8 (3), 589-604 (2017).</li>
<li>Guo, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Using+hESCs+to+Probe+the+Interaction+of+the+Diabetes-Associated+Genes+CDKAL1+and+MT1E%5BTitle%5D)+AND+%22Cell+Reports%22%5BJournal%5D)">Using hESCs to Probe the Interaction of the Diabetes-Associated Genes CDKAL1 and MT1E.</a> Cell Reports. 19 (8), 1512-1521 (2017).</li>
<li>Zeng, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((An+Isogenic+Human+ESC+Platform+for+Functional+Evaluation+of+Genome-wide-Association-Study-Identified+Diabetes+Genes+and+Drug+Discovery%5BTitle%5D)+AND+%22Cell+Stem+Cell%22%5BJournal%5D)">An Isogenic Human ESC Platform for Functional Evaluation of Genome-wide-Association-Study-Identified Diabetes Genes and Drug Discovery.</a> Cell Stem Cell. 19 (3), 326-340 (2016).</li>
<li>Wang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genome+editing+of+human+embryonic+stem+cells+and+induced+pluripotent+stem+cells+with+zinc+finger+nucleases+for+cellular+imaging%5BTitle%5D)+AND+%22Circulation+Research%22%5BJournal%5D)">Genome editing of human embryonic stem cells and induced pluripotent stem cells with zinc finger nucleases for cellular imaging.</a> Circulation Research. 111, 1494-1503 (2012).</li>
<li>Xue, H., Wu, J., Li, S., Rao, M. S., Liu, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genetic+Modification+in+Human+Pluripotent+Stem+Cells+by+Homologous+Recombination+and+CRISPR%2FCas9+System%5BTitle%5D)+AND+%22Methods+in+Molecular+Biology%22%5BJournal%5D)">Genetic Modification in Human Pluripotent Stem Cells by Homologous Recombination and CRISPR/Cas9 System.</a> Methods in Molecular Biology. 1307, 173-190 (2014).</li>
<li>Huang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Production+of+gene-corrected+adult+beta+globin+protein+in+human+erythrocytes+differentiated+from+patient+iPSCs+after+genome+editing+of+the+sickle+point+mutation%5BTitle%5D)+AND+%22Stem+Cells%22%5BJournal%5D)">Production of gene-corrected adult beta globin protein in human erythrocytes differentiated from patient iPSCs after genome editing of the sickle point mutation.</a> Stem Cells. 33 (5), 1470-1479 (2015).</li>
<li>Wang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Unbiased+detection+of+off-target+cleavage+by+CRISPR-Cas9+and+TALENs+using+integrase-defective+lentiviral+vectors%5BTitle%5D)+AND+%22Nature+Biotechnology%22%5BJournal%5D)">Unbiased detection of off-target cleavage by CRISPR-Cas9 and TALENs using integrase-defective lentiviral vectors.</a> Nature Biotechnology. 33 (2), 175-178 (2015).</li>
<li>Sim, X., Cardenas-Diaz, F. L., French, D. L., Gadue, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+Doxycycline-Inducible+System+for+Genetic+Correction+of+iPSC+Disease+Models%5BTitle%5D)+AND+%22Methods+in+Molecular+Biology%22%5BJournal%5D)">A Doxycycline-Inducible System for Genetic Correction of iPSC Disease Models.</a> Methods in Molecular Biology. 1353, 13-23 (2015).</li>
<li>Hockemeyer, D., Jaenisch, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Review+Induced+Pluripotent+Stem+Cells+Meet+Genome+Editing%5BTitle%5D)+AND+%22Stem+Cell%22%5BJournal%5D)">Review Induced Pluripotent Stem Cells Meet Genome Editing.</a> Stem Cell. 18 (5), 573-586 (2016).</li>
<li>Byrne, S. M., Mali, P., Church, G. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genome+editing+in+human+stem+cells%5BTitle%5D)+AND+%22Methods+in+Enzymology%22%5BJournal%5D)">Genome editing in human stem cells.</a> Methods in Enzymology. 546, 119-138 (2014).</li>
<li>Zhu, Z., González, F., Huangfu, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+iCRISPR+platform+for+rapid+genome+editing+in+human+pluripotent+stem+cells%5BTitle%5D)+AND+%22Methods+in+Enzymology%22%5BJournal%5D)">The iCRISPR platform for rapid genome editing in human pluripotent stem cells.</a> Methods in Enzymology. 546, 215-250 (2014).</li>
<li>Hou, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Efficient+genome+engineering+in+human+pluripotent+stem+cells+using+Cas9+from+Neisseria+meningitidis%5BTitle%5D)+AND+%22Proceedings+of+the+National+Academy+of+Sciences+of+the+United+States+of+America%22%5BJournal%5D)">Efficient genome engineering in human pluripotent stem cells using Cas9 from Neisseria meningitidis.</a> Proceedings of the National Academy of Sciences of the United States of America. 110 (39), 15644-15649 (2013).</li>
<li>Cong, L., Zhang, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genome+engineering+using+CRISPR-Cas9+system%5BTitle%5D)+AND+%22Methods+in+Molecular+Biology%22%5BJournal%5D)">Genome engineering using CRISPR-Cas9 system.</a> Methods in Molecular Biology. 1239, Clifton, N.J. 197-217 (2015).</li>
<li>Mali, P., Esvelt, K. M., Church, G. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cas9+as+a+versatile+tool+for+engineering+biology%5BTitle%5D)+AND+%22Nature+Methods%22%5BJournal%5D)">Cas9 as a versatile tool for engineering biology.</a> Nature Methods. 10 (10), 957-963 (2013).</li>
<li>Richardson, C. D., Ray, G. J., DeWitt, M. A., Curie, G. L., Corn, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Enhancing+homology+directed+genome+editing+by+catalytically+active+and+inactive+CRISPR-Cas9+using+asymmetric+donor+DNA%5BTitle%5D)+AND+%22Nature+Biotechnology%22%5BJournal%5D)">Enhancing homology directed genome editing by catalytically active and inactive CRISPR-Cas9 using asymmetric donor DNA.</a> Nature Biotechnology. 34 (3), 339-344 (2016).</li>
<li>Maguire, J. A., Cardenas-Diaz, F. L., Gadue, P., French, D. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Highly+efficient+crispr+cas9-mediated+genome+editing+in+human+pluripotent+stem+cells%5BTitle%5D)+AND+%22Current+Protocols+in+Stem+Cell+Biology%22%5BJournal%5D)">Highly efficient crispr cas9-mediated genome editing in human pluripotent stem cells.</a> Current Protocols in Stem Cell Biology. 48 (1), 64(2019).</li>
</ol>

The authors have nothing to disclose.

In this protocol, the use of CRISPR-CAS9 along with two ssODN repair templates to generate specific heterozygous or homozygous genome changes is demonstrated in human pluripotent stem cells. This method resulted in the successful generation of isogenic cell lines expressing heterozygous genomic changes with an efficiency close to 10%. This protocol has been optimized for both human ESCs and iPSCs grown on irradiated MEFs which support cell growth and survival after culturing cells at low density after cell sorting. Cell ...

Human embryonic stem cells (hESCs) and induced pluripotent stem cells (iPSCs) are valuable tools for modeling human disease due to their capacity for renewal, while maintaining the ability to generate cell types of different lineages1,2,3,4. These models open the possibility to interrogate gene function, and understand how specific mutations and phenotypes are related to various diseases5,6. However, to understand how a specific alteration is linked to a particular phenotype, the use of a paired isogenic control and mutant cell lines is important to control for line to line variability7,8. Transcription activator-like effector nucleases (TALENs) and zinc finger nucleases have been used to generate insertion or deletion (indels) mutations in diverse genetic models, including primary cells; but these nucleases can be cumbersome to use and expensive9,10,11,12,13,14. The discovery of the clustered regularly interspaced short palindromic repeat (CRISPR)-CAS9 nuclease has revolutionized the field due to efficiency in indel formation in virtually any region of the genome, simplicity of use, and reduction in cost15,16,17,18,19.
A challenge in using the CRISPR-CAS9 based genome editing technology has been the generation or correction of specific mutations in one allele without creating an indel mutation in the second allele20. The major goal of this protocol is to overcome this challenge by using two single-stranded oligonucleotide (ssODN) repair templates to reduce indel formation in the second allele. Both ssODNs are designed to contain silent mutations to prevent re-cutting by the CAS9 nuclease, but only one contains the alteration of interest. This method increases the efficiency of generating a specific heterozygous genetic modification without inducing indel formation in the second allele. Using this protocol, gene editing experiments in six independent genomic locations demonstrate the precise introduction of the desired genomic change in one allele without indel formation in the second allele and occurs with an overall efficiency of ~10%. The described protocol has been adapted from Maguire et al.21.

<table><tbody><tr><td>5-ml polystyrene round-bottom tube with cell-strainer cap</td><td>Corning</td><td>352235</td><td></td></tr><tr><td>6-well polystyrene tissue culture dishes</td><td>Corning</td><td>353046</td><td></td></tr><tr><td>AflII restriction endonuclease</td><td>New England Biolabs</td><td>R0520</td><td></td></tr><tr><td>Agarose</td><td>VWR</td><td>N605</td><td></td></tr><tr><td>DMEM/F12 medium</td><td>ThermoFisher</td><td>11320033</td><td></td></tr><tr><td>dNTPs</td><td>Roche</td><td>11969064001</td><td></td></tr><tr><td>Fluorescence-activated cell sorter (FACS) apparatus</td><td></td><td></td><td></td></tr><tr><td>Gel extraction kit</td><td>Macherey-Nagel</td><td>740609</td><td></td></tr><tr><td>Gibson Assembly Kit</td><td>New England Biolabs</td><td>E2611</td><td></td></tr><tr><td>gRNA_Cloning Vector</td><td>Addgene</td><td>41824</td><td></td></tr><tr><td>LB agar plates containing 50 &amp;mu;g/ml kanamycin</td><td></td><td></td><td></td></tr><tr><td>Lipofectamine Stem Reagent</td><td>ThermoFisher</td><td>(STEM00001)</td><td></td></tr><tr><td>Matrigel Growth Factor Reduced (GFR)</td><td>Corning</td><td>354230</td><td></td></tr><tr><td>Murine embryonic fibroblasts (MEFs)</td><td></td><td></td><td></td></tr><tr><td>Nucleospin Gel Extraction and PCR Clean-up Kit</td><td>Macherey-Nagel</td><td>740609</td><td></td></tr><tr><td>Orbital shaking incubator</td><td></td><td></td><td></td></tr><tr><td>pCas9_GFP vector</td><td>Addgene</td><td>44719</td><td></td></tr><tr><td>PCR strip tubes</td><td>USA Scientific</td><td>1402-2900</td><td></td></tr><tr><td>Phusion High Fidelity DNA Polymerase and 5&amp;times; Phusion buffer</td><td>New England Biolabs</td><td>M0530</td><td></td></tr><tr><td>PurelinkTM Quick Plasmid Miniprep Kit</td><td>Invitrogen</td><td>K210011</td><td></td></tr><tr><td>Proteinase K</td><td>Qiagen</td><td>Qiagen 19133</td><td></td></tr><tr><td>StellarTM electrocompetent Escherichia coli cells</td><td>Takara</td><td>636763</td><td></td></tr><tr><td>SOC medium</td><td>New England Biolabs</td><td>B9020S</td><td></td></tr><tr><td>TrypLE Express Enzyme</td><td>ThermoFisher</td><td>12605036</td><td></td></tr><tr><td>Y-27632 dihydrochloride/ROCK inhibitor (ROCKi)</td><td>Tocris</td><td>1254</td><td></td></tr></tbody></table>

generation of defined genomic modifications using crispr-cas9 in human pluripotent stem cells

Generation of Defined Genomic Modifications Using CRISPR-CAS9 in Human Pluripotent Stem Cells

Human pluripotent stem cells offer a powerful system to study gene function and model specific mutations relevant to disease. The generation of precise heterozygous genetic modifications is challenging due to CRISPR-CAS9 mediated indel formation in the second allele. Here, we demonstrate a protocol to help overcome this difficulty by using two repair templates in which only one expresses the desired sequence change, while both templates contain silent mutations to prevent re-cutting and indel formation. This methodology is most advantageous for gene editing coding regions of DNA to generate isogenic control and mutant human stem cell lines for studying human disease and biology. In addition, optimization of transfection and screening methodologies have been performed to reduce labor and cost of a gene editing experiment. Overall, this protocol is widely applicable to many genome editing projects utilizing the human pluripotent stem cell model.

Generation of gRNAs and screening for indels
Each gRNA will be cloned into a plasmid vector and expressed using the U6 promoter. The AflII restriction enzyme is used to linearize the plasmid (addgene #41824) and is located after the U6 promoter. The 100 bp band generated after annealing the two 60 bp oligos is cloned into the gRNA expression vector using the DNA assembly. Once the gRNA plasmids are generated, they are transfected into hESCs or iPSCs along with a CRISP...

This protocol provides a method to facilitate the generation of defined heterozygous or homozygous nucleotide changes using CRISPR-CAS9 in human pluripotent stem cells.

Human pluripotent stem cells offer a powerful system to study gene function and model specific mutations relevant to disease. The generation of precise ...

generation-defined-genomic-modifications-using-crispr-cas9-human

Research

JoVE Journal

Genetics

This video demonstrates a technique of zinc-finger nuclease-based genome editing in human pluripotent stem cells (hPSCs). As hPSCs can potentially be differentiated into various cell types, this technology is helpful for in vitro pathological and pharmacological studies in a patient-specific manner.

Zinc Finger Nuclease-Based Genome Editing: A Technique for Modifying Genome in Human Pluripotent Stem Cells by Double-Stranded Homology Dependant Repair Mechanism

Genome editing tools such as the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas (CRISPR-associated) system have greatly improved gene targeting efficiency in human induced pluripotent stem cells (hiPSCs). This manuscript describes a protocol for generating lineage specific hiPSC reporter using CRISPR/Cas system assisted homologous recombination.

Efficient Generation of hiPSC Neural Lineage Specific Knockin Reporters Using the CRISPR/Cas9 and Cas9 Double Nickase System

Genome editing of human pluripotent stem cells (hPSCs) can be done quickly and efficiently. Presented here is a robust experimental procedure to genetically engineer hPSCs as exemplified by editing the AAVS1 safe harbor locus to express EGFP and introduce antibiotic resistance.

Establishment of Genome-edited Human Pluripotent Stem Cell Lines: From Targeting to Isolation

Protocols to generate hPSC mutant lines using the iCRISPR platform and to differentiate hPSCs into glucose-responsive β-like cells are described. Combining genome editing technology with hPSC-directed differentiation provides a powerful platform for the systematic analysis of the role of lineage determinants in human development and disease progression.

Genome Editing and Directed Differentiation of hPSCs for Interrogating Lineage Determinants in Human Pancreatic Development

This protocol describes in detail the generation of footprint-free induced pluripotent stem cells (iPSCs) from human pancreatic cells in feeder-free conditions, followed by editing using CRISPR/Cas9 ribonucleoproteins and characterization of the modified single-cell clones.

Efficient Generation and Editing of Feeder-free IPSCs from Human Pancreatic Cells Using the CRISPR-Cas9 System

A protocol for fast CRISPR/Cas9-mediated gene disruption in mouse and human primary hematopoietic cells is described in this article. Cas9-sgRNA ribonucleoproteins are introduced via electroporation with sgRNAs generated through in vitro transcription and commercial Cas9. High editing efficiencies are achieved with limited time and financial cost.

Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9

Described here is a protocol for tagging endogenously expressed proteins with fluorescent tags in human induced pluripotent stem cells using CRISPR/Cas9. Putatively edited cells are enriched by fluorescence activated cell sorting and clonal cell lines are generated.

Endogenous Protein Tagging in Human Induced Pluripotent Stem Cells Using CRISPR/Cas9

CRISPR-Cas is a powerful technology to engineer the complex genomes of plants and animals. Here, we detail a protocol to efficiently edit the human genome using different Cas endonucleases. We highlight important considerations and design parameters to optimize editing efficiency.

Genome Editing in Mammalian Cell Lines using CRISPR-Cas

Here, we describe a detailed method for seamless gene editing in human pluripotent stem cells using a piggyBac-based donor plasmid and the Cas9 nickase mutant. Two point mutations were introduced into exon 8 of the hepatocyte nuclear factor 4 alpha (HNF4α) locus in human embryonic stem cells (hESCs).

Introducing Point Mutations into Human Pluripotent Stem Cells Using Seamless Genome Editing

The presented method describes the generation of a CRISPR-mediated gene knockout in the human embryonic stem cell (hESC) line H9, which stably expresses sgRNAs targeting the L2HGDH gene using a highly efficient lentiviral-mediated gene delivery system.

CRISPR-Cas9 Mediated Gene Deletion in Human Pluripotent Stem Cells Cultured Under Feeder-Free Conditions

The protocol describes methods for Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-based epigenome editing in human cell lines using plasmid DNA transfection and mRNA nucleofection.

CRISPR Epigenome Editing in Human Cells using Plasmid DNA Transfection and mRNA Nucleofection Delivery

Learn CRISPR-Cas9 gene editing in human pluripotent stem cells to generate defined heterozygous or homozygous mutations. This protocol enables creation of isogenic lines for studying gene function and disease mechanisms.

Generation of Defined Genomic Modifications Using CRISPR-CAS9 in Human Pluripotent Stem Cells

Explore More Videos