이 원고는 PEI / MNP 벡터와 자신의 자화에 의해 내피 세포 수 미르 효율적인 비 바이러스 성 전달을 설명합니다. 따라서, 유전자 변형뿐만 아니라,이 방법은 자기 세포 안내와 MRI의 검출 능력 수 있습니다. 이 기술은 치료 세포 제품의 특성을 개선하는 데 사용할 수 있습니다.
Access restricted. Please log in or start a trial to view this content.
Access restricted. Please log in or start a trial to view this content.
Access restricted. Please log in or start a trial to view this content.
Access restricted. Please log in or start a trial to view this content.
Access restricted. Please log in or start a trial to view this content.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| PEI 25 kDa | Sigma Aldrich | 408727 | |
| EZ-Link Sulfo-NHS-LC-Biotin | Thermo Scientific | 21335 | |
| PD-10 탈염 컬럼 | GE Healthcare | 17085101 | Sephadex G-25 매체 |
| 닌히드린 시약 용액 2% | Sigma Aldrich | 7285 | |
| 글리신 | Sigma Aldrich | 410225 | |
| Pierce Biotin 정량 분석 키트 | Thermo Scientific | 28005 | |
| Microplate 리더 모델 680 | Bio-Rad | ||
| Streptavidin MagneSphere 상자성 입자 | Promega | Z5481 | |
| Millex-HV PVDF 필터 | Merck | SLHV013SL | 0.45 µ m |
| Libra 120 투과 전자 현미경 | Zeiss | 가속 전압 120 kV | |
| 사파이어 X-선 검출기 | EDAX-Amatek | ||
| 세포 배양 플라스틱 | TPP | ||
| NHS-Esther Atto 565 | ATTO-TEC GmbH | AD 565-31 | |
| NHS-Esther Atto 488 | ATTO-TEC GmbH | AD 488-31 | |
| Cy5 miRNA 라벨 IT 키트 | Mirus Bio | MIR 9650 | |
| 비오틴 Atto 565 | ATTO-TEC GmbH | AD 565-71 | |
| 콜라겐분해효소 유형 IV Gibco | Thermo Scientific | 17104019 | |
| 내피 성장 배지, EGM-2 | Lonza | CC-3156 & CC-4176 | |
| 페니실린/스트렙토마이신 | 써모 사이언티픽 | 15140122 | 100 U/mL, 100 &마이크로; g/mL |
| Matrigel | BD Biosciences | 356234 | |
| anti-PECAM-1 항체 | Santa Cruz | sc-1506 | |
| MS MACS 컬럼 | Miltenyi Biotec | 130-042-201 | |
| Near-IR Live/Dead Cell Stain Kit | Thermo Scientific | L10119 | |
| Cy3 염료 라벨링 Pre-miR 음성 대조군 | Thermo Scientific | AM17120 | Cy3-miR" 또는 "Cyanine-miR3" 원고 |
| 내 Pre-miR miRNA Precursor Molecules - Negative Control | Thermo Scientific | 원고에 "scr-miR"로 | AM17110 |
| Anti-has-miR92a-3p 합성 억제제 | Thermo Scientific | AM10916 | |
| LSM 780 ELYRA PS.1 시스템 | Zeiss | ||
| 파라포름알데히드 | Sigma Aldrich | 158127 | PBS |
| DAPI 핵 염색 | Thermo Scientific | D1306 | |
| NucleoSpin RNA 분리 키트 | Machery-Nagel | 740955 | |
| mirVana miRNA 분리 키트 | Thermo Scientific | AM1560 | |
| TaqMan MicroRNA 역전사 키트 | Thermo Scientific | 4366596 | |
| StepOnePlus Real-Time PCR 시스템 | 응용 바이오시스템 | ||
| 고용량 cDNA 역전사 키트 | Thermo Scientific | 4368814 | |
| has-miR-92a TaqMan 어세이 | Thermo Scientific | 000431 | Mature miRNA 염기서열: UAUUGCACUUGUCCCGGCCUGU |
| FastGene Taq Ready Mix | Nippon Genetics | LS27 | |
| ITGA5 TaqMan 어세이 | Thermo Scientific | Hs01547673_m1 | |
| RNU6B TaqMan 어세이 | Thermo Scientific | 001093 | |
| 18S rRNA 내인성 제어 | Thermo Scientific | 4333760F | |
| 젤라틴 | 시그마 Aldrich | G7041 | |
| CellTrace Calcein Red-Orange | Thermo Scientific | C34851 | |
| PBS | Pan Biotech | P04-53500 | |
| BSA | Sigma Aldrich | ||
| MACS 버퍼 | Miltenyi Biotec | 130-091-221 | |
| Agarose | Sigma Aldrich | A9539 | |
| 7.1 Tesla 동물 MRI 시스템 | Bruker Corporation | A7906 | |
| ImageJ 소프트웨어 | National Institutes of Health | NIH(AngiogenesisAnalyzer)로 업그레이드 | |
| MPS 장치 | Bruker Biospin | ||
| Matlab 소프트웨어 | Mathworks | ||
| 링 네오딤 자석 | magnets4you GmbH | RM-10x04x05-G | ø 10 mm; 잔열성은 ~ 1.3 T, 보자력 ≥ 955 kA/m |
| Click-iT EdU Alexa Fluor 647 이미징 키트 | Thermo Scientific | C10340 | |
| FluorSave 시약 | Merck | 345789 | |
| 초음파 수조 | Bandelin 전자 | 유형: RK 100 SH |
Access restricted. Please log in or start a trial to view this content.
Request permission to reuse the text or figures of this JoVE article
Request Permission