우리는 세포주기의 특정 단계와 관련된 사건을 연구하기위한 배경 정보를 제공하는 두 가지 세포 동기화 프로토콜을보고합니다. 우리는이 접근법이 교란되지 않은 세포주기 또는 세포주기에 영향을 미치는 약물에 노출되었을 때 특정 유전자의 조절을 분석하는데 유용하다는 것을 보여준다.
Access restricted. Please log in or start a trial to view this content.
Access restricted. Please log in or start a trial to view this content.
Access restricted. Please log in or start a trial to view this content.
Access restricted. Please log in or start a trial to view this content.
Access restricted. Please log in or start a trial to view this content.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| DMEM, 고포도당, GutaMAX 보충제 | Thermo Fisher Scientific | 61965-059 | |
| FBS, 적격, EU 승인, 남미 원산지 | Thermo Fisher Scientific | 10270-106 | |
| 페니실린-스트렙토마이신(10,000 U/mL) | Thermo Fisher Scientific | 15140-122 | |
| 0.25% 트립신-EDTA(1x), 페놀 레드 | Thermo Fisher Scientific | 25200-072 | |
| 티미딘 | 시그마 | T1895-5G | 갓 준비했습니다. 약간 따뜻하게 하면 티미딘을 녹이는 데 도움이 될 수 있습니다. |
| Nocodazole | SIGMA | M-1404 | DMSO의 재고 용액은 -20 º에 저장됩니다. 작은 부분 표본의 C |
| Hydroxyurea | SIGMA | H8627 | |
| Streptomyces caespitosus SIGMA | M4287 | 1.5 mM 스톡 용액 멸균 H2O에서 빛으로부터 보호하고 4 º에서 보관; C | |
| 디메틸 설폭사이드 | SIGMA | D2650 | |
| 프로피듐 요오드화물 | SIGMA | P4170 | 멸균 PBS의 저장 용액 5 mg/ml, 4 º에 보관; C는 빛으로부터 보호됩니다. |
| PBS pH 7.6 | 집에서 만든 | ||
| 에탄올 | PANREAC | A3678,2500 | |
| 클로로포름 | SIGMA | C2432 | |
| 구연산나트륨 | PANREAC | 131655 | |
| Triton X-100 | SIGMA | T8787 | |
| RNAse A | Thermo Fisher Scientific | EN0531 | |
| TRIzol 시약 | LifeTechnologies | 15596018 | |
| RNeasy Mini kit | QIAGEN | 74106 | |
| 고용량 cDNA 역전사 키트 | Thermo Fisher Scientific | 4368814 | |
| Anti-Cyclin E1 항체 | Cell Signaling | 4129 | 1:1000 5% 우유, o/n, 4 º에 희석; C |
| 반대로 Cyclin B1 항체 | 세포 신호 | 4135 | 1:1000 5% 우유, o/n, 4 º에 있는 희석; C |
| Anti-β-actin | SIGMA | A-5441 | 1:3000 5% 우유에 희석, 1시간, RT |
| Anti-pH3 (Ser 10) antiboty | Millipore | 06-570 | 프로토콜에 명시 |
| Secondary anti-rabbit AlexaFluor 488 항체 | Invitrogen | R37116 | 프로토콜에 명시 |
| Secondary anti-mouse-HRP 항체 | Santa Cruz Biotechnology | sc-3697 | 5% 우유에 1:3000 희석, 1시간, RT |
| Forward E2F1 항체(인간) TGACATCACCAACGTCCTTGA | Biolegio | Designed by PrimerQuest tool (https://eu.idtdna.com/site) | |
| 역 E2F1 항체 (인간) CTGTGCGAGGTCCTGGGTC | Biolegio | Designed by PrimerQuest tool (https://eu.idtdna.com/site) | |
| Forward E2F7 항체 (인간) GGAAAGGCAACAGCAAACTCT | Biolegio | Designed by PrimerQuest tool (https://eu.idtdna.com/site) | |
| 역 E2F7 항체 (인간) TGGGAGAGCACCAAGAGTAGAAGAGA | Biolegio | Designed by PrimerQuest tool (https://eu.idtdna.com/site) | |
| Forward p21Cip1 antibody (human) AGCAGAGGAAGACCATGTGGAC | Biolegio | PrimerQuest 도구 (https://eu.idtdna.com/site)에 의해 설계됨 | |
| 역방향 p21Cip1 항체 (인간) TTTCGACCCTGAGAGTCTCCAG | Biolegio | Designed by PrimerQuest tool (https://eu.idtdna.com/site) | |
| Forward TBP 항체 (인간) 참조 유전자 | Biolegio | Designed by PrimerQuest tool (https://eu.idtdna.com/site) | |
| 역 TBP 항체 (인간) | Biolegio | Designed by PrimerQuest tool (https://eu.idtdna.com/site) | |
| Forward Oxa1L 항체 (인간) 참조 유전자 CACTTGCCAGAGATCCAGAAG | Biolegio | Designed by PrimerQuest 도구 (https://eu.idtdna.com/site) | |
| Reverse Oxa1L 항체 (인간) 카카그가가트가가그타태그 | Biolegio | Designed by PrimerQuest 도구 (https://eu.idtdna.com/site) | |
| Power SYBRGreen PCR 마스터 믹스 | Thermo Fisher Scientific | 4368702 | |
| FACS 튜브 | Sarstedt | 551578 | |
| MicroAmp Optical 96-Well Reaction Plate | Thermo Fisher Scientific | N8010560 | |
| Corning 100 mm TC-Treated Culture Dish | Corning | ||
| Corning Costar cell culture plates 6 well | Corning | 3506 | |
| Refrigerated Bench-Top Microcentrifuge | Eppendorf | 5415 R | |
| 냉장 벤치탑 원심분리기 Jouan CR3.12 | Jouan | 743205604 | |
| NanoDrop Lite 분광 광도계 | Thermo Scientific | ND-LITE-PR | |
| BD FACS칼리버 유세포 분석기 | BD Bioscience | ||
| QuantStudio 3 Real-Time PCR 시스템 | Thermo Fisher Scientific | A28567 |
Access restricted. Please log in or start a trial to view this content.
Request permission to reuse the text or figures of this JoVE article
Request Permission