이 연구는 유전자 및 단백질 발현 분석을 위해 쥐 갈색 지방 세포를 분리하는 새로운 방법을 설명합니다.
Access restricted. Please log in or start a trial to view this content.
Access restricted. Please log in or start a trial to view this content.
Access restricted. Please log in or start a trial to view this content.
Access restricted. Please log in or start a trial to view this content.
Access restricted. Please log in or start a trial to view this content.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| Antibodies | |||
| Antigen | Company | Catalog | |
| PPARγ | LSBio | Ls-C368478 | |
| PDGFRa | 산타 크루즈 | sc-398206 | |
| UCP1 | R & D 시스템 | IC6158P | |
| Chemical and solutions | |||
| Collagenase, Type II | Thermo Fisher Scientific | 17101015 | |
| 1-Bromo-3-chloropropane | Sigma-Aldrich | B62404 | |
| 소 혈청 알부민 (BSA) | Goldbio | A-421-10 | |
| 염화칼슘 | 바이오 베이직 | CT1330 | |
| 클로로포름 | IBI 과학 | IB05040 | |
| Dispase II, 프로테아제 | Sigma-Aldrich | D5693 | |
| EDTA | 바이오 베이직 | EB0107 | |
| 에탄올 | IBI 과학 | IB15724 | |
| LiQuant Universal Green qPCR 마스터 믹스 | LifeSct | LS01131905Y | |
| 염화마그네슘 헥사하이드레이트 | Boston BioProducts | P-855 | |
| OneScrip Plus cDNA 합성 SuperMix | ABM | G454 | |
| OptiPrep (요오딕산올) | Cosmo Bio USA | AXS-1114542 | |
| PBS (10x) | Caisson Labs | PBL07 | |
| PBS (1x) | Caisson Labs | PBL06 | |
| Pierce BCA 단백질 분석 키트 | Thermo Fisher Scientific | 23227 | |
| 염화칼 | Boston BioProducts | P-1435 | |
| SimplyBlue 안전 염색 | Invitrogen | LC6060 | |
| 도데실황산나트륨(SDS) | Sigma-Aldrich | 75746 | |
| 트리졸 시약 | 생명 기술 | 15596018 | |
| Primers | |||
| 유전자명(종) | 정방향 | 역방향 | |
| pdgfra (마우스) | CTCAGCTGTCTCCTCACAgG | CAACGCATCTCAGAGAAAAGG | |
| pdgfa (마우스) | TGTGCCCATTCGCAGGAAGAG | TTGGCCACCTTGACACTGCG | |
| 36B4(마우스) | TGCTGAACATCTCCCCCTTCTC | TCTCCACAGACAATGCCAGGAC | |
| ucp1 | ACTGCCACACCTCCAGTCATT | CTTTGCCTCACTCAGGATTGG | |
| strong>Equipment | |||
| Name | Company | Application | |
| Keyence BZ-X700 | Keyence | Imaging brown adipocytes | |
| Magnetic stirrer | VWR | Dissociate BAT | |
| QuantStudio 6 Flex Real-Time PCR System | 적용 Biosystem | Quantitative PCR | |
| The Odyssey Fc 이미징 시스템 | LI-COR | 웨스턴 블롯 이미징 |
Access restricted. Please log in or start a trial to view this content.