Name: Methicillin - ??? V? ??? ?? ??? ??? ? ?? I? ?????? ?? ??? PCR ?? ?? ?? ??? ?? (동영상) | JoVE Journal
Uploaded: 2013-09-05T15:00:00.000+00:00
Duration: 9 min 3 s
Description: 배우세요 MRSA의 SCCmec 유형을 다중 PCR 분석으로 신속하게 분류하는 방법을. DNA 추출, 증폭, 전기영동을 통해 효율적인 균주 특성화를 수행합니다.

ai_agent_IP

ai_agent

maintenance

instantTrialDurationMinutes

isBiopharma

enableNewMyJoveSectionDesign

educationFeatures

seoMetaApi

ai_copilot_institution_blacklist

ai_chat_institution_blacklist

freeAccessWindow

ssoRoleCapture

scheduledMaintenanceBanner

joveLabsFeatures

disable_autoplay_for_bots

extended_trial_duration

5 minutes

이 연구에 사용된 몇 가지 참조 균주를 선물해 준 T. Ito, K. Hiramatsu, R. Daum, H. de Lencastre 및 D. Coleman에게 감사드립니다. 이 작업은 항생제 내성 센터(CAR), 앨버타 보건 서비스-캘거리/캘거리 연구소 서비스/캘거리 대학교의 재정 지원을 부분적으로 받았습니다.

??? ??? ?? ??? ??? ??? ????? ???????. ??? ??? ? ??? ?? ?? ??? ?? ???????. 1. ?? ?? <ol><li> MRSA? ??? ??? ???? ??? ?????. PCR? ?????? ???, ?? ?? ???? MRSA? ?? ???? ???? ??? ?? ?? (TSA) ??? ????? ??? ??? ?????. ??? ??? ??? ??? ?? ? ? ????. 37 ?? ??

<ol><li>IWG-SCC. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Classification+of+staphylococcal+cassette+chromosome+mec+%28SCCmec%29%3A+guidelines+for+reporting+novel+SCCmec+elements%5BTitle%5D)+AND+%22Antimicrobial+Agents+and+Chemotherapy%22%5BJournal%5D)">Classification of staphylococcal cassette chromosome mec (SCCmec): guidelines for reporting novel SCCmec elements.</a> Antimicrobial Agents and Chemotherapy. 53 (12), 4961-4967 (2009).</li>
<li>Ito, T., Hiramatsu, K., Tomasz, A., de Lencastre, H., Perreten, V., Holden, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Guidelines+for+Reporting+Novel+mecA+Gene+Homologues%5BTitle%5D)+AND+%22Antimicrobial+Agents+and+Chemotherapy%22%5BJournal%5D)">Guidelines for Reporting Novel mecA Gene Homologues.</a> Antimicrobial Agents and Chemotherapy. 56 (10), 4997-4999 (2012).</li>
<li>Okuma, K., Iwakawa, K., Turnidge, J. D., Grubb, W. B., Bell, J. M., O'Brien, F. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Dissemination+of+new+methicillin-resistant+Staphylococcus+aureus+clones+in+the+community%5BTitle%5D)+AND+%22Journal+of+Clinical+Microbiology%22%5BJournal%5D)">Dissemination of new methicillin-resistant Staphylococcus aureus clones in the community.</a> Journal of Clinical Microbiology. 40 (11), 4289-4294 (2002).</li>
<li>Kondo, Y., Ito, T., Ma, X. X., Watanabe, S., Kreiswirth, B. N., Etienne, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Combination+of+multiplex+PCRs+for+staphylococcal+cassette+chromosome+mec+type+assignment%3A+rapid+identification+system+for+mec%2C+ccr%2C+and+major+differences+in+junkyard+regions%5BTitle%5D)+AND+%22Antimicrobial+Agents+and+Chemotherapy%22%5BJournal%5D)">Combination of multiplex PCRs for staphylococcal cassette chromosome mec type assignment: rapid identification system for mec, ccr, and major differences in junkyard regions.</a> Antimicrobial Agents and Chemotherapy. 51 (1), 264-274 (2007).</li>
<li>Oliveira, D. C., de Lencastre, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Multiplex+PCR+strategy+for+rapid+identification+of+structural+types+and+variants+of+the+mec+element+in+methicillin-resistant+Staphylococcus+aureus%5BTitle%5D)+AND+%22Antimicrobial+Agents+and+Chemotherapy%22%5BJournal%5D)">Multiplex PCR strategy for rapid identification of structural types and variants of the mec element in methicillin-resistant Staphylococcus aureus.</a> Antimicrobial Agents and Chemotherapy. 46 (7), 2155-2161 (2002).</li>
<li>Milheirico, C., Oliveira, D. C., de Lencastre, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Update+to+the+multiplex+PCR+strategy+for+assignment+of+mec+element+types+in+Staphylococcus+aureus%5BTitle%5D)+AND+%22Antimicrobial+Agents+and+Chemotherapy%22%5BJournal%5D)">Update to the multiplex PCR strategy for assignment of mec element types in Staphylococcus aureus.</a> Antimicrobial Agents and Chemotherapy. 51 (9), 3374-3377 (2007).</li>
<li>Milheirico, C., Oliveira, D. C., de Lencastre, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Multiplex+PCR+strategy+for+subtyping+the+staphylococcal+cassette+chromosome+mec+type+IV+in+methicillin-resistant+Staphylococcus+aureus%3A+%27SCCmec+IV+multiplex%27%5BTitle%5D)+AND+%22Journal+of+Antimicrobial+Chemotherapy%22%5BJournal%5D)">Multiplex PCR strategy for subtyping the staphylococcal cassette chromosome mec type IV in methicillin-resistant Staphylococcus aureus: 'SCCmec IV multiplex'.</a> Journal of Antimicrobial Chemotherapy. 60 (1), 42-48 (2007).</li>
<li>Zhang, K., McClure, J. A., Elsayed, S., Louie, T., Conly, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Novel+multiplex+PCR+assay+for+characterization+and+concomitant+subtyping+of+staphylococcal+cassette+chromosome+mec+types+I+to+V+in+methicillin-resistant+Staphylococcus+aureus%5BTitle%5D)+AND+%22Journal+of+Clinical+Microbiology%22%5BJournal%5D)">Novel multiplex PCR assay for characterization and concomitant subtyping of staphylococcal cassette chromosome mec types I to V in methicillin-resistant Staphylococcus aureus.</a> Journal of Clinical Microbiology. 43 (10), 5026-5033 (2005).</li>
<li>Zhang, K., McClure, J. A., Conly, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Enhanced+multiplex+PCR+assay+for+typing+of+staphylococcal+cassette+chromosome+mec+types+I+to+V+in+methicillin-resistant+Staphylococcus+aureus%5BTitle%5D)+AND+%22Molecular+and+Cellular+Probes%22%5BJournal%5D)">Enhanced multiplex PCR assay for typing of staphylococcal cassette chromosome mec types I to V in methicillin-resistant Staphylococcus aureus.</a> Molecular and Cellular Probes. 26 (5), 218-221 (2012).</li>
<li>de Lamballerie, X., Zandotti, C., Vignoli, C., Bollet, C., de Micco, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+one-step+microbial+DNA+extraction+method+using+%22Chelex+100%22+suitable+for+gene+amplification%5BTitle%5D)+AND+%22Research+in+Microbiology%22%5BJournal%5D)">A one-step microbial DNA extraction method using "Chelex 100" suitable for gene amplification.</a> Research in Microbiology. 143 (8), 785-790 (1992).</li>
<li>Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Agarose+gel+electrophoresis+for+the+separation+of+DNA+fragments%5BTitle%5D)+AND+%22J.+Vis.+Exp%22%5BJournal%5D)">Agarose gel electrophoresis for the separation of DNA fragments.</a> J. Vis. Exp. (62), e3923(2012).</li>
<li>McClure, J. A., Conly, J. M., Elsayed, S., Zhang, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Multiplex+PCR+assay+to+facilitate+identification+of+the+recently+described+Staphylococcal+cassette+chromosome+mec+type+VIII%5BTitle%5D)+AND+%22Molecular+and+Cellular+Probes%22%5BJournal%5D)">Multiplex PCR assay to facilitate identification of the recently described Staphylococcal cassette chromosome mec type VIII.</a> Molecular and Cellular Probes. 24 (4), 229-232 (2010).</li>
<li>Zhang, K., McClure, J. A., Elsayed, S., Conly, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Novel+staphylococcal+cassette+chromosome+mec+type%2C+tentatively+designated+type+VIII%2C+harboring+class+A+mec+and+type+4+ccr+gene+complexes+in+a+Canadian+epidemic+strain+of+methicillin-resistant+Staphylococcus+aureus%5BTitle%5D)+AND+%22Antimicrobial+Agents+and+Chemotherapy%22%5BJournal%5D)">Novel staphylococcal cassette chromosome mec type, tentatively designated type VIII, harboring class A mec and type 4 ccr gene complexes in a Canadian epidemic strain of methicillin-resistant Staphylococcus aureus.</a> Antimicrobial Agents and Chemotherapy. 53 (2), 531-540 (2009).</li>
</ol>

이해 상충이 선언되지 않았습니다.

여기에 설명된 다중 PCR 분석은 포도상구균에서 SCCmec I-V 의 유형 및 주요 하위 유형을 분류하는 간단하고 신뢰할 수 있는 방법을 제공하며 MRSA와 MSSA를 동시에 구별합니다. 이 분석은 견고하고 단일 PCR 반응으로 편리하게 수행되며 결과를 해석하기 쉽습니다. 이 분석은 각 SCCmec 유형 내의 개별 유전자좌를 표적으로 한다는 점에서 한계가 있지만 포괄적인 ccr 및 mec 복합 타이핑을 제공하지 않으므로 황금 표준으로 간주될 수 없습니다. 그럼에도 불구하고 프로토콜에 대한 광범위한 검증은 MRSA에 대한 과학 및 역학 연구를 위한 귀중한 분자 도구로 남아 있음을 입증했습니다.
분석의 정교한 특성과 반응에 존재하는 많은 수의 프라이머로 인해 이 분석을 개별 실험실에 적용하는 데 어려움이 있을 가능성이 있습니다. 각 실험실에는 프라이머 농도 또는 순도와 같은 고유한 조건과 요인은 물론 분석 결과에 영향...

An erratum was issued for: <a href="https://www.jove.com/video/50779/multiplex-pcr-assay-for-typing-staphylococcal-cassette-chromosome-mec">Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus</a>.&#160; There was a&#160;typo&#160;in Table 1.
In Table 1, the Oligonucleotide sequence for Type III-F5 was updated from:
TTCTCATTGATGCTGAAGCC
To:
GAAACTAGTTATTTCCAACGG

An erratum was issued for: <a href="https://www.jove.com/video/50779/multiplex-pcr-assay-for-typing-staphylococcal-cassette-chromosome-mec">Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus</a>.&#160; There was a&#160;typo&#160;in Table 1.

Erratum: Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus

?? ?? ?? ?? ??? ?? (MRSA)? ?? 21-67 - KB ??? ?? ? ??? ?? ????, ?? ?? ?? (MECA) ??? ? ?? ??? ?? ?? 1 ?? ??? ?? ??? ??? ? (SCC MEC)? ?? . SCC MEC? ??? ?? ??? ??, ? ?? ??? ?? ? ?? ?? (MEC ??? ???? CCR ??? ???) ? J-?? (?? 1)? ??? ?? ?????. CCR ??? ?????? SCC MEC? ??? ?? recombinases (CCR / ccrAB)? ? ??? ????? ?? ? ??? ???, 431mec ??, ?? ??? mecR1 ? MECI? ???? ?? ?? IS? ???? ???? ?? ?? ??? 1. ?? ? ?? ??? ? ?? ??? (mecB </EM&gt;? MECC)? ?? ??? 2?? ??? ?? ??? ???? ?? ???. SCC MEC ??? ???? ?? CCR ?? ??? ??? ??? ??? ??? ?? ??? ???? J ?? (J1, J2, J3?)? ???? ????. ?? ?? ? ??? ??? (? : ??, B, C, D ? E) ? CCR ?? allotypes (? : 1-8 ?)? ????. ??? ??? ???? allotypes? ?? ??? ??? SCC ? ??? ?????. SCC MEC ?? ? ??? ?? ??? ??? ?? (IWG-SCC)? ??? ?? ?? ?? ???? ?? ??? ?? SCC ? ??? ?? CCR ??? ???? ??? ?? ???? ???? ??????? ??? J ?? DNA 1? ??? ?? ?? ???? ??. MRSA??? ????? ?? multilocus ??? ?? (ST) ? / ?? ??? ?? ??? ??? (SPA)? ?? (? : ST8 ? (??? / ??) ?? ?? ?? ??? ?? ????? ?? SCC ? ??? ?? ?? ??? ?? ????? -T008-MRSA-IVa?). ??? SCC ? ??? ?? ? ????? ???? ?? ?? MRSA (CA-MRSA)? ??? ????, MRSA? ??? ?? ?? ?? ?? ???? ?? ??? ?? ?????. ?? PCR? ?? ??? ?? MEC? CCR ???? ??? ??? ????? ???? SCC MEC? ?????, ??? ?? (20 ~ 30) ???? ?? ? ?? ?? PCR ??? ?????. ??? ??. ?? ??, 21 ???? ? SCC MEC I-IVB 3? ?? ?? ?? ?? PCR ??? ????. ?? ?. subsequently CCR, MEC, ??? J-??? ?? ???? ??????? ??? ??? ???? ??? ???? ?? PCR ?? 4? ? ??? ????. SCC ?? ??? ????? ??, ?? ??? PCR (M-PCR) ??? ??? ?? PCR ???? ?? ? ? ??? ?????. ? Lencastre? ??? SCC MEC I-IV? ?? ???? M-PCR? ????, ??? SCC ? IV? ?? 5,6,7? ?????? ??? M-PCR?, SCC ? IV? ?? ?????????. ??? ??? ??? ? SCC ? IV ??? ???? ?? 2 ?? ??? ???? ???, ?? ? typeable ??? ?????. SCC ? ???? ???? ??, ??? ?? ? ?? SCC MEC? ??? V 8 ??? I? ???? ??? ?? ??? ?? ??? PCR ??? ????, ??? ??? ??? ??? B? ??????? 9 ecame. ? ??? ??? ??? ???? ?? SCC ? ??? ???? ???? ??, ????? (SCOPUS?? 337, 2013? 1? 30? ????) ? ????? ??????. ?? ?? ??, ??? ??? ?? MRSA SCC MEC ???? ????? ??? ?? ???? ?? ?? ??? ?????. ??? ??? ???? ????? ??? ??? ???? ?? ??? ?? ???? ??? ?? ?? ???? ????. MRSA SCC ? ??? ???? ??? ?????? ??, ??? ?? SCC MEC ????? M-PCR?? ???, ??? ????? ??? ??? ?? ? ?? ???? ??? ??? ???? ??? ????? ????.

<table><tbody><tr><td>Tryptic Soy Agar</td><td>Fisher (BD)</td><td>CA90002-700 (236920)</td><td></td></tr><tr><td>멸균 증류수</td><td>Life Technologies</td><td>10977-015</td><td></td></tr><tr><td>Platinum Taq: 10x PCR 완충액 및 50mM MgCl2</td> <td>포함 Life Technologies</td><td>10966-034</td><td></td></tr><tr><td>100 mM dNTP</td><td>Life Technologies</td><td>10297-018</td><td></td></tr><tr><td>Tris base</td><td>Sigma-Aldrich</td><td>T6066</td><td></td></tr><tr><td>붕산</td><td>시그마-알드리치</td><td>B7901</td><td></td></tr><tr><td>EDTA</td><td>라이프 테크놀로지</td>스 <td>15576-028</td><td></td></tr><tr><td>아가로스</td><td>라이프 테크놀</td>로지스 <td>16500-500</td><td></td></tr><tr><td>글리세롤</td><td>라이프 테크놀</td>스 <td>15514-011</td><td></td></tr><tr><td>브로모페놀 블루</td><td>시그마-알드리치</td><td>B8026</td><td></td></tr><tr><td>1Kb+ DNA 사다리</td><td>라이프 Technologies</td><td>10787-026</td><td></td></tr><tr><td>에티듐 브로마이드</td><td>Sigma-Aldrich</td><td>E7637</td><td></td></tr><tr><td>1.5ml 마이크로 원심분리기 튜브 </td><td>VWR (Axygen Scientific)</td><td>10011-700</td><td></td></tr><tr><td>배양 스틱</td><td>VWR</td><td>CA10805-018</td><td></td></tr><tr><td>PCR 튜브</td><td>Diamed</td><td>AD0210-FCN (new #: DIATEC420-1250)</td><td></td></tr><tr><td>원심분리기</td><td>Eppendorf</td><td>5417c</td><td></td></tr><tr><td>열 블록</td><td>VWR</td><td>13259-030 / 13259-286</td><td></td></tr><tr><td>Thermalcycler</td><td>Applied Biosystems (2720)</td><td>4359659</td><td></td></tr><tr><td>젤 몰드가 있는 수평 수중 젤 전기 영동 챔버</td><td>BioRad</td><td>170-4469</td><td></td></tr><tr><td>전원 공급 장치</td><td>BioRad</td><td>164-5050</td><td></td></tr><tr><td>로커 쉐이커</td><td>VWR</td><td>40000-300</td><td></td></tr><tr><td>분자 이미저 젤 독 시스템</td><td>BioRad</td><td>1708170</td><td></td></tr></tbody></table>

methicillin - ??? v? ??? ?? ??? ??? ? ?? i? ?????? ?? ??? pcr ?? ??<em&gt; ?? ??? ??</em

Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus

??? ?? ??? ??? ??? ? (SCC MEC) ??? ?? ? ????? ???? ?? ?? MRSA (CA-MRSA)? ??? ????, ?? ?? ?? ?? ??? ?? (MRSA)? ??? ?? ?? ?? ?? ???? ?? ??? ?? ?????. ?? PCR? ?? ??? ?? MEC? CCR ???? ??? ??? ????? ???? SCC MEC? ?????, ?? ???? ?? ? ?? ?? PCR ??? ??? ??????. ??? ?? ? ?? SCC MEC ?? ? V? ?? I? ???? ??? ?? ??? ?? ??? PCR ??? ????, ??? ?? ??? ????? ??? ?????????. ? ??? ??? ??? ???? ?? SCC ? ??? ???? ???? ?? ????? ? ????? ??????. ???, ??? NAT? ????? ??? ???? ????? ? ??? URE? ??? ?? ???? ??? ?? ?? ???? ????. , MRSA SCC ? ??? ???? ??? ?? ???? ??? ??? ?? ??? PCR ??? ???? ??? ?????, ??? ????? ??? ??? ?? ? ?? ???? ??? ?????.

업데이트된 이 M-PCR은 SCCmec 유형 I-V뿐만 아니라 SCCmec IV의 주요 아형을 결정(분류)할 수 있습니다. 이 분석법은 mecA 유전자 검출과 동시에 SCCmec I, II, III, IVa, IVb, IVc, IVd, IVE 및 V의 고유하고 특이적인 유전자 좌위(loci)를 표적으로 합니다. SCCmec VI 및 VIII의 잠정적 식별 또한 가능하지만, 확진을 위해서는 추가 테스트가 필요합니다. 그림 3은 대표적인 SCCmec I-VI 및 VIII과 해당 요소 내 각 표적의 위치를 보여줍니다.
제1형 특이 프라이머(빨간색)는 SCCmec I의 J1 영역에 있는 orf E008(균주 NCTC10442; AB033763)을 타겟으로 하며, 제2형 프라이머(진한 녹색)는 지금까지 기술된 모든 SCCmec II...

메티실린 내성 황색포도상구균에 대한 포도상구균 카세트 염색체 mec(SCCmec) I-V 유형의 빠른 스크리닝 및 타이핑을 위한 간단한 멀티플렉스 PCR 분석을 시연하고, 이 분석을 개별 실험실에 성공적으로 적용할 수 있도록 하는 몇 가지 중요한 단계와 절차적 뉘앙스를 제공합니다.

Methicillin - ??? V? ??? ?? ??? ??? ? ?? I? ?????? ?? ??? PCR ?? ??<em&gt; ?? ??? ??</em

Staphylococcal Cassette Chromosome mec (SCCmec) typing  is a very important molecular tool for understanding the epidemiology and  clonal strain ...

본 절차의 전체적인 목표는 멀티플렉스 PCR 분석을 통해 메티실린 내성 황색포도상구균(methicillin resistant staphylococcus aureus) 또는 MRSA 분리주의 SCC MEC 유형을 결정하는 것입니다. 이는 먼저 물에서 박테리아 세포를 가열하는 빠르고 간단한 추출 기술을 사용하여 균주로부터 DNA를 분리함으로써 수행됩니다. 두 번째 단계는 각 SCC MEC 유형에 특이적인 표적을 증폭하기 위해 멀티플렉스 PCR 분석을 수행하는 것입니다.다음으로, PCR 산물을 AROS 겔 전기영동으로 분리합니다. 마지막 단계는 DNA 시각화 및 데이터 분석을 위해 겔을 염색하는 것입니다. 최종적으로, 이 멀티플렉스 PCR 분석으로 얻은 특정 PCR 산물들의 고유한 조합을 통해 MRS A 분리주의 SE cmec 유형을 결정합니다. 개별 CCR 및 MEC 유전자 복합체를 표적으로 하여 여러 개의 개별 PCR 튜브가 필요한 기존의 전통적인 S CEC 타이핑 방식과 같은 방법들에 비해 이 기술의 주요 장점은 작업량을 크게 간소화할 수 있으며 단일 PCR 튜브에서 수행 가능하다는 점입니다.이 절차는 인증된 생물안전 2등급 실험실에서 수행되어야 합니다. PCR 수행 전날에는 항상 적절한 개인 보호 장비를 착용해야 합니다. 멸균 배양 스틱을 사용하여 신선한 overnight 플레이트에서 MRSA 단일 콜로니를 선택하고, triptych soy agri 플레이트에 박테리아를 진하게 스트리킹하여 준비합니다.여러 개의 시료를 하나의 플레이트에 스트리킹하여 37 °C에서 하룻밤 동안 배양할 수 있습니다. 1.5 mL 마이크로 원심분리 튜브에 75 µL의 멸균 증류수를 넣습니다. 멸균된 배양 스틱을 사용하여.하룻밤 동안 과성장시킨 스트리킹 플레이트에서 소량의 박테리아를 채취합니다. 멸균수에 박테리아를 넣고 섞어 탁한 용액을 준비합니다. 모든 샘플에 대해 이 과정을 반복합니다.박테리아를 용해하고 DNA를 방출시키기 위해 95 °C로 설정된 건식 히팅 블록에서 튜브를 10분 동안 배양합니다. 히팅 블록에서 샘플을 꺼내어 실온에서 5분 동안 방치합니다. 샘플을 13,000 RPM에서 1분 동안 원심분리합니다.결과물인 샘플에는 세포 파편 펠릿과 DNA가 포함된 투명한 상층액이 형성됩니다. PCR 준비를 위해 10 XPCR 버퍼, 50 millimolar 염화마그네슘, DTPs 및 프라이머를 포함한 PCR 시약들을 -20 °C

multiplex-pcr-assay-for-typing-staphylococcal-cassette-chromosome-mec

Research

연구

JoVE Journal

Immunology and Infection

면역학 및 감염학

43 분자 타겟까지 동시 검출을위한 저렴, 높은 처리량 방법을 설명합니다. mPCR / RLB의 응용은 미생물 입력 및 임상 샘플에서 여러 병원균의 감지를 포함합니다.

멀티 플렉스 PCR 및 역방향 라인 얼룩 하이브리드화 분석 (mPCR / RLB)

우리는 살모넬라균 enterica serovars Enteritidis, 해더, 하이 델베르크, 그리고 Typhimurium의 급속한 탐지를위한 멀티 플렉스 PCR을 설명합니다. 특정 살모넬라균의 serovars는 유전자와 주어진 serovar의 O - 항원 생합성 클러스터 및 flagellin 고유의 시퀀스로 PCR 다중을 대상으로 확인할 수 있습니다. Serovar는 대상 allele에 해당하는 특정 크기 amplicons (PCR 제품)의 모양에 따라 분리 살모넬라균에 다음 할당됩니다.

확인을 위해 Allelotyping PCR 살모넬라 enterica serovars Enteritidis, 해더, 하이 델베르크, 그리고 Typhimurium

우리는 oligonucleotide 결합 형광 구슬을 사용하여 샘​​플 내에 미생물의 검출을위한 다양한 방법을 설명합니다. 샘플 내의 모든 생물에서 Amplicon는 프로브 결합 구슬의 패널에 hybridized입니다. Luminex 또는 바이오 플렉스 악기는 비드 타입과 하이브 리다이 제이션 신호를 각 비드를 쿼리하는 데 사용됩니다.

Oligonucleotide - 결합 형광등 Microspheres를 사용하여 복잡한 임상 및 환경 샘플에서 박테리아의 멀티 플렉스 감지

용해성 파지 바이오 센서 및 항체 비즈 메티 실린 내성 (MRSA) 및 민감한 황색 포도상 구균 박테리아를 구별 할 수 있습니다. 파지는 석영 크리스탈 마이크로 센서의 표면에 랭 뮤어 - 블로 젯 방식으로 고정 넓은 범위 포도상 구균 프로브로 근무 하였다. 항체 비즈 MRSA를 인식하고 있습니다.

항생제 내성 황색 포도상 구균 박테리아의 검출을위한 바이오 센서

증폭 마이크로 어레이 크게 최종 사용자를위한 마이크로 어레이 플로 간소화 단일 챔버로 비대칭 PCR 증폭 및 마이크로 어레이 혼성화를 결합한다. 마이크로 어레이 워크 플로우를 간소화하는 것은 정기적으로 낮은 자원 환경에서 사용할 수있는 마이크로 어레이 기반의 진단 프로그램을 만들기위한 필요한 첫 번째 단계입니다.

다중 약물 내성을 보여<em&gt; 결핵균</em&gt; 증폭 마이크로 어레이

이 프로토콜은 식품에서 클래스 1 인테그론 및 관련 유전자 카세트의 검출을 설명합니다.

클래스 1 Integrons 유전자 카세트 식품을 선별

여기서 리보솜 스페이서 PCR(RS-PCR)은 소형 전기영동 시스템과 함께 적당한 비용으로 S. aureus를 유전형 분석하기 위한 빠르고 고분해능 방법으로 사용되어 높은 처리량을 허용합니다.

의 유전자형<em&gt; 황색 포도상 구균</em&gt;에 의해 리보솜 스페이서 PCR (RS-PCR)

일반적인 호흡기 바이러스에 대한 두 가지 프로브 기반 원스텝 RT-qPCR 키트를 소개합니다. 첫 번째 분석은 SARS-CoV-2(N), 인플루엔자 A(H1N1 및 H3N2) 및 인플루엔자 B에 대한 것입니다. 두 번째는 SARS-Cov-2(N)와 메르스(UPE 및 ORF1a)에 대한 것입니다. 이러한 분석은 모든 전문 실험실에서 성공적으로 구현할 수 있습니다.

SARS-CoV-2, 인플루엔자 A/B 및 MERS-CoV 검출을 위한 다중 Real-Time RT-qPCR 분석 개발

드립 흐름 반응기로 개방형 시스템 흐름 biofilms을 활용하여 디스크 원자로 회전을위한 프로토콜이 상세하게 제공됩니다.

에 대한 드립 흐름 및 회전 디스크 원자로의 사용 포도상 구균 Biofilm 분석

Murine 피부와 부드러운 조직 감염 모델은 methicillin 내성 포도상 구균 (MRSA) 및 호스트 면역 응답의 독성 기능을 평가하기위한 활용합니다. 여기, 우리는 피부와 부드러운 조직 감염 피하 감염 모델을 소개하고 있습니다.

Methicillin 내성 황색 포도상 구균 아리 어스의 피하 감염 (MRSA)

배우세요 MRSA의 SCCmec 유형을 다중 PCR 분석으로 신속하게 분류하는 방법을. DNA 추출, 증폭, 전기영동을 통해 효율적인 균주 특성화를 수행합니다.

Methicillin - ??? V? ??? ?? ??? ??? ? ?? I? ?????? ?? ??? PCR ?? ??

더 많은 동영상 탐색