Name: 저빈도 체세포 돌연변이 검출을 위한 Sanger 염기서열분석과 결합된 야생형 차단 PCR (동영상) | JoVE Journal
Uploaded: 2024-08-23T12:50:00.000+00:00
Duration: 7 min 17 s
Description: 배우세요 야생형 차단 PCR과 Sanger 염기서열분석을 결합한 저빈도 체세포 돌연변이 검출 방법을 통해 혈액암 연구에 활용할 수 있는 고감도 분석 기술을 익히세요.

ai_agent_IP

ai_agent

maintenance

instantTrialDurationMinutes

isBiopharma

enableNewMyJoveSectionDesign

educationFeatures

seoMetaApi

ai_copilot_institution_blacklist

ai_chat_institution_blacklist

freeAccessWindow

ssoRoleCapture

scheduledMaintenanceBanner

joveLabsFeatures

disable_autoplay_for_bots

extended_trial_duration

5 minutes

<meta charset="utf8"></head><body>Wild-Type Blocking PCR을 통한 저빈도 돌연변이 검출 최적화

<ol><li>Penn Medicine. Testing for measurable/minimal residual disease (MRD). , Oncolink Team. 
 <a target="_blank" href="https://www.oncolink.org/cancer-treatment/procedures-diagnostic-tests/blood-tests-tumordiagnostic-tests/testing-for-measurable-minimal-residualdisease-mrd">https://www.oncolink.org/cancer-treatment/procedures-diagnostic-tests/blood-tests-tumordiagnostic-tests/testing-for-measurable-minimal-residualdisease-mrd</a> (2019).</li>
<li>Xie, Y., Elaine, S. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((How+I+diagnose+angioimmunoblastic+T-cell+lymphoma%5BTitle%5D)+AND+%22Am+J+Clin+Pathol%22%5BJournal%5D)">How I diagnose angioimmunoblastic T-cell lymphoma.</a> Am J Clin Pathol. 156, 1-14 (2021).</li>
<li>Mariko, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Angioimmunoblastic+T-cell+lymphoma%5BTitle%5D)+AND+%22Cancer+Treat+Res%22%5BJournal%5D)">Angioimmunoblastic T-cell lymphoma.</a> Cancer Treat Res. 176, 99-126 (2019).</li>
<li>Daniel, A. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+2016+revision+to+the+World+Health+Organization+classification+of+myeloid+neoplasms+and+acute+lukemia%5BTitle%5D)+AND+%22Blood%22%5BJournal%5D)">The 2016 revision to the World Health Organization classification of myeloid neoplasms and acute lukemia.</a> Blood. 127 (20), 2391-2405 (2016).</li>
<li>Rita, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+5th+edition+of+the+World+Health+Organization+Classification+of+Haematolymphoid+Tumours+%3A+Lymphoid+Neoplasms%5BTitle%5D)+AND+%22Leukemia%22%5BJournal%5D)">The 5th edition of the World Health Organization Classification of Haematolymphoid Tumours : Lymphoid Neoplasms.</a> Leukemia. 36 (7), 1720-1748 (2022).</li>
<li>Hae, Y. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+recurrent+inactivating+mutation+in+RHOA+GTPase+in+angioimmunoblastic+T+cell+lymphoma%5BTitle%5D)+AND+%22Nat+Genet%22%5BJournal%5D)">A recurrent inactivating mutation in RHOA GTPase in angioimmunoblastic T cell lymphoma.</a> Nat Genet. 46 (4), 371-375 (2014).</li>
<li>Lee, P. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((RHOA+G17V+mutation+in+angioimmunoblastic+T-cell+lymphoma%3AA+potential+biomarker+for+cytological+assessment%5BTitle%5D)+AND+%22Exp+Mol+Pathol%22%5BJournal%5D)">RHOA G17V mutation in angioimmunoblastic T-cell lymphoma:A potential biomarker for cytological assessment.</a> Exp Mol Pathol. 110, 104294(2019).</li>
<li>Mamiko, S. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Somatic+RHOA+mutation+in+angioimmunoblastic+T+cell+lymphoma%5BTitle%5D)+AND+%22Nat+Genet%22%5BJournal%5D)">Somatic RHOA mutation in angioimmunoblastic T cell lymphoma.</a> Nat Genet. 46 (2), 171-175 (2014).</li>
<li>Palomero, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Recurrent+mutations+in+epigenetic+regulators%2C+RHOA+and+FYN+kinase+in+peripheral+T+cell+lymphomas%5BTitle%5D)+AND+%22Nat+Genet%22%5BJournal%5D)">Recurrent mutations in epigenetic regulators, RHOA and FYN kinase in peripheral T cell lymphomas.</a> Nat Genet. 46 (2), 166-170 (2014).</li>
<li>Fujisawa, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Activation+of+RHOA-VAV1+signaling+in+angioimmunoblastic+T-cell+lymphoma%5BTitle%5D)+AND+%22Leukemia%22%5BJournal%5D)">Activation of RHOA-VAV1 signaling in angioimmunoblastic T-cell lymphoma.</a> Leukemia. 32 (3), 694-702 (2018).</li>
<li>Voena, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((RHO+family+GTPases+in+the+biology+of+lymphoma%5BTitle%5D)+AND+%22Cells%22%5BJournal%5D)">RHO family GTPases in the biology of lymphoma.</a> Cells. 8 (7), 646(2019).</li>
<li>Shendure, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((DNA+sequencing+an+40%3A+past%2C+present+and+future%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">DNA sequencing an 40: past, present and future.</a> Nature. 550 (7676), 345-353 (2017).</li>
<li>Athanasios, C. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Comparison+of+Sanger+sequencing%2C+pyrosequencing%2C+and+melting+curve+analysis+for+the+detection+of+KRAS+mutations%3A+diagnostic+and+clinical+implications%5BTitle%5D)+AND+%22J+Mol+Diagn%22%5BJournal%5D)">Comparison of Sanger sequencing, pyrosequencing, and melting curve analysis for the detection of KRAS mutations: diagnostic and clinical implications.</a> J Mol Diagn. 12 (4), 425-432 (2010).</li>
<li>Wu, L. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Multiplexed+enrichment+of+rare+DNA+variants+via+sequence-selective+and+temperature-robust+amplification%5BTitle%5D)+AND+%22Nat+Biomed+Eng%22%5BJournal%5D)">Multiplexed enrichment of rare DNA variants via sequence-selective and temperature-robust amplification.</a> Nat Biomed Eng. 1, 714-723 (2017).</li>
<li>John, S. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+thermodynamics+of+DNA+structural+motifs%5BTitle%5D)+AND+%22Annu+Rev+Biophys+Biomol+Struct%22%5BJournal%5D)">The thermodynamics of DNA structural motifs.</a> Annu Rev Biophys Biomol Struct. 33, 415-440 (2004).</li>
<li>Coren, A. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((PCR-based+methods+for+the+enrichment+of+minority+alleles+and+mutations%5BTitle%5D)+AND+%22Clin+Chem%22%5BJournal%5D)">PCR-based methods for the enrichment of minority alleles and mutations.</a> Clin Chem. 55 (4), 632-640 (2009).</li>
<li>Eliza, M. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Circulating+tumor+DNA+in+B-cell+lymphoma%3A+technical+advances%2C+clinical+applications%2C+and+perspectives+for+translational+research%5BTitle%5D)+AND+%22Leukemia%22%5BJournal%5D)">Circulating tumor DNA in B-cell lymphoma: technical advances, clinical applications, and perspectives for translational research.</a> Leukemia. 36 (9), 2151-2164 (2022).</li>
<li>Lee, H. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Hot-spot-specific+probe+%28HSSP%29+for+rapid+and+accurate+detection+of+KRAS+mutations+in+colorectal+cancer%5BTitle%5D)+AND+%22Biosensors%22%5BJournal%5D)">Hot-spot-specific probe (HSSP) for rapid and accurate detection of KRAS mutations in colorectal cancer.</a> Biosensors. 12 (8), 597(2022).</li>
<li>Matsubara, R. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Detection+of+the+G17V+RHOA+mutation+in+angioimmunoblastic+T-cell+lymphoma+and+related+lymphomas+using+quantitative+allele-specific+PCR%5BTitle%5D)+AND+%22PLoS+One%22%5BJournal%5D)">Detection of the G17V RHOA mutation in angioimmunoblastic T-cell lymphoma and related lymphomas using quantitative allele-specific PCR.</a> PLoS One. 9 (10), e109714(2014).</li>
<li>Dieffenbach, C. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((General+concepts+for+PCR+primer+design%5BTitle%5D)+AND+%22PCR+Methods+Appl%22%5BJournal%5D)">General concepts for PCR primer design.</a> PCR Methods Appl. 3 (3), S30-S37 (1993).</li>
<li>Applied Biosystems. User Guide for Applied Biosystems. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=%223730%2F3730xl+DNA+Analyzer%22">3730/3730xl DNA Analyzer</a>. , (2014).</li>
</ol>

<table><tbody><tr><td>자동 DNA 추출기</td><td>9001301</td><td>Qiagen</td><td></td></tr><tr><td>DNA 핵산 검출기</td><td>Q32854</td><td>Thermo fisher</td><td></td></tr><tr><td>PCR 증폭 키트</td><td>P4600</td><td>merck</td><td></td></tr><tr><td>PCR 기기</td><td>C1000 Touch</td><td>Biorad</td><td></td></tr><tr><td>proteinase K 용액</td><td>D3001-2-A</td><td>zymo 연구</td><td></td></tr><tr><td>proteinase K 저장 버퍼</td><td>D3001-2-C</td><td>zymo 연구</td><td></td></tr><tr><td>시퀀싱 증폭 효소 키트</td><td>P7670-FIN</td><td>Qiagen</td><td></td></tr></tbody></table>

저빈도 체세포 돌연변이 검출을 위한 sanger 염기서열분석과 결합된 야생형 차단 pcr

Wild-type Blocking PCR Combined with Sanger Sequencing for Detection of Low-frequency Somatic Mutation

테스트 샘플의 염기서열을 참조 염기서열과 비교하여 테스트 샘플의 돌연변이 상태를 얻습니다. BDA 기반 WBT-PCR 기술은 업스트림 및 다운스트림 프라이머의 증폭 간격에서 알려진 RHOA G17V 돌연변이 및 기타 저주파 돌연변이를 검출할 수 있습니다. 그림 1을 참조하십시오. 두 개의 추가 유전자, 즉 IDH2 및 JAK1도 이 방법을 사용하여 각각 그림 2 및 그림 3을 분석했습니다. 결과는 이 방법이 저주파 돌연변이를 감지하는 데 매우 민감하다는 것을 보여줍니다.
<img alt="DNA 시퀀싱 크로마토그램; RHOA 돌연변이 검출 비교를 보여주는 기존 PCR 대 WBT-PCR." class="xfigimg" src="/files/ftp_upload/65647/65647fig01.jpg" data-altupdatedat="1754922859000" data-alt="Figure 1"> 그림 1: RHOA에 대한 염기서열분석 결과. 그림은 위에서 아래로 WBT-PCR에 의해 증폭된 RHOA G17 부위의 염기 돌연변이와 야생형 RHOA G17에 해당하는 전통적인 PCR 증폭 후 염기서열분석 결과를 보여줍니다. 가운데 사진은 검출 민감도가 0.5%일 때 WBT-PCR primer로 증폭한 후 c.50G&gt;T 돌연변이의 염기서열분석 결과를 보여줍니다. 아래 그림은 검출 민감도가 0.5%일 때 WBT-PCR 프라이머로 증폭한 후 c.49-50delinsTT 돌연변이의 염기서열분석 결과를 보여줍니다. <a href="https://www.jove.com/files/ftp_upload/65647/65647fig01large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>
<img alt="WBT-PCR 및 기존 PCR 크로마토그램 비교, c.515G&gt;A 돌연변이 검출, IDH2 유전자." class="xfigimg" src="/files/ftp_upload/65647/65647fig02v2.jpg" data-altupdatedat="1754922859000" data-alt="Figure 2"> 그림 2: IDH2에 대한 염기서열분석 결과. 위 그림은 위에서 아래로 WBT-PCR에 의해 증폭된 IDH2 R172 부위의 염기 돌연변이와 야생형 IDH2 R172에 해당하는 기존 PCR 증폭 후 염기서열분석 결과를 보여줍니다. 상단 그림은 검출 민감도가 0.5%일 때 WBT-PCR primer로 증폭한 c.515G&gt;A 돌연변이의 염기서열 분석 결과를 보여줍니다. <a href="https://www.jove.com/files/ftp_upload/65647/65647fig02largev2.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>
<img alt="DNA 시퀀싱 비교, JAK1 돌연변이 분석 차트를 위한 WBT-PCR 대 기존 PCR." class="xfigimg" src="/files/ftp_upload/65647/65647fig03.jpg" data-altupdatedat="1754922859000" data-alt="Figure 3"> 그림 3: JAK1에 대한 염기서열분석 결과. 위 그림은 위에서 아래로 WBT-PCR에 의해 증폭된 JAK1 S703 부위의 염기 돌연변이와 야생형 JAK1 S703에 해당하는 기존 PCR 증폭 후의 염기서열분석 결과를 보여줍니다. 상단 사진은 검출 민감도가 0.5%일 때 WBT-PCR primer로 증폭한 c.2108G&gt;T 돌연변이의 염기서열분석 결과를 보여줍니다. <a href="https://www.jove.com/files/ftp_upload/65647/65647fig03large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td>입문서</td>
			<td colspan="2">프라이머 시퀀스</td>
		</tr><tr><td>로아-VF</td>
			<td colspan="2">아타아악ttttgtgccaggt</td>
		</tr><tr><td>로아-VR</td>
			<td colspan="2">GCTGAAGACTATGAAGCAAGCA</td>
		</tr><tr><td>로아-WTB</td>
			<td colspan="2">아그카그캣gtctttccacaggcaaaa</td>
		</tr><tr><td>염기서열분석 프라이머</td>
			<td colspan="2">아타아악ttttgtgccaggt</td>
		</tr></tbody></table>표 1: RHOA의 최종 설계된 프라이머 목록.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td>IDH2 R172 프라이머</td>
			<td></td>
		</tr><tr><td>입문서</td>
			<td>프라이머 시퀀스</td>
		</tr><tr><td>IDH2-VF (영문)</td>
			<td>CTGGTTGAAAGATGGCGGCT</td>
		</tr><tr><td>IDH2-VR</td>
			<td>TACCTGGTCGCCATGGGC</td>
		</tr><tr><td>IDH2-WTB</td>
			<td>GCCATGGGCGTGCCTGCCAaaat</td>
		</tr><tr><td>염기서열분석 프라이머</td>
			<td>CTGGTTGAAAGATGGCGGCT</td>
		</tr><tr><td>JAK1 유전자 프라이머</td>
			<td></td>
		</tr><tr><td>입문서</td>
			<td>프라이머 시퀀스</td>
		</tr><tr><td>JAK1-VF</td>
			<td>ACTCTGAGGCCGAGTgtgtgt</td>
		</tr><tr><td>JAK1-VR 시리즈</td>
			<td>CCATTATGGACAT카가캇캇</td>
		</tr><tr><td>JAK1-WTB</td>
			<td>GGACATTCTCACCA그태그CTCAGAAAA</td>
		</tr><tr><td>염기서열분석 프라이머</td>
			<td>ACTCTGAGGCCGAGTgtgtgt</td>
		</tr></tbody></table>표 2: IDH2 및 JAK1의 최종 설계된 프라이머 목록.

저빈도 체세포 돌연변이 검출을 위한 Sanger 염기서열분석과 결합된 야생형 차단 PCR

When monitoring minimal residual disease (MRD) after tumor treatment, there are higher requirements of the lower limit of detection than when detecting ...

wild-type-blocking-pcr-combined-with-sanger-sequencing-for-detection

Research

연구

JoVE Journal

Genetics

유전학

풀링된 유전자 시퀀싱은 큰 무리에서 복잡한 phenotypes와 관련된 희귀한 변종을 탐지하기위한 빠르고 비용 효율적인 전략이다. 여기 가시가 소프트웨어 패키지를 사용하여 32 암 관련 유전자의 풀링, 차세대 시퀀싱의 전산 분석을 설명합니다. 이 방식은 확장성, 그리고 관심의 표현형에 적용됩니다.

파편을 사용하여 풀링된 장면에서 드문 게놈 변종의 탐지

이 비디오는 체세포 돌연변이를 감지하는 야생형 차단 중합효소 연쇄 반응(WTB-PCR)에 대해 설명합니다. PCR 기반 기술은 고정 핵산(locked nucleic acid, LNA)을 사용하는데, 이는 올리고뉴클레오타이드(oligonucleotide)로서 상보적인 야생형 대립유전자에 결합하고 그 신장을 차단합니다. 차단은 선택적으로 샘플의 야생형 변이체에 대한 저수준 돌연변이 대립유전자의 증폭을 허용합니다.

저주파 체세포 돌연변이를 검출하기 위한 Wild-type Blocking PCR

우리는 바코드 DNA 라이브러리 및 대규모 병렬 "다음 세대"염기 서열 임상 종양 표본의 주요 암 관련 변이의 검출에 대한 후속 하이브리드 기반의 엑손 캡처의 준비에 대해 설명합니다. 대상 엑손 시퀀싱 따라서 낮은 주파수 변이를 검출하는 높은 감도를 산출, 높은 처리량, 낮은 비용, 그리고 깊은 순서 범위의 혜택을 제공합니다.

엑손 캡처 및 대규모 병렬 염기 서열 종양 검체에서 체세포 유전 변경을 검출

이 원고는 두 개의 차세대 염기서열분석 패널에 대한 임상 프로토콜을 설명합니다. 한 패널은 혈액학적 악성 종양을 조사하고 다른 패널은 고형 종양에서 일반적으로 돌연변이가 발생하는 유전자를 대상으로 합니다. 인간 악성 종양에서 드라이버 돌연변이의 분자 분류는 귀중한 예후 및 예측 정보를 제공합니다.

고체 및 액체 종양에서 실행 가능한 돌연변이의 검출을위한 차세대 시퀀싱

종양학 검체의 차세대 표적 염기서열분석을 위한 통합 시스템에 대해 설명합니다. 이 크로스 플랫폼 시스템은 저품질 및 소량 종양 생검에 최적화되어 있고, 낮은 DNA 입력을 수용하며, 잘 특성화된 다중 변이 대조군을 포함하고, 정량적 사전 분석 품질 관리 측정에 의해 정보를 얻은 새로운 변이 호출자를 특징으로 합니다.

낮은 품질과 낮은 수량 종양 생검의 습식 및 건식 벤치 프로세스의 통합을 대상으로 최적화하여 차세대 시퀀싱

Wild-type blocking PCR에 이어 직접 염기서열분석(direct sequencing)은 다양한 샘플 유형에서 저주파 체세포 돌연변이를 매우 민감하게 검출할 수 있는 방법을 제공합니다.

와일드 형은 PCR은 낮은 주파수 체세포 돌연변이의 검출을위한 고감도 방법으로 직접 시퀀싱과 결합 블로킹

차세대 시퀀싱 (NGS) 플랫폼 (~0.5–2.0%)의 높은 오류 속도 의해 제한 되는 genomic 특성 분석을 위한 강력한 도구입니다. NGS 오류율을 제거 하 고 변형 대립 유전자 분수 0.0001 희귀에서 변이 감지 수 있는 오류 수정 시퀀싱의 우리의 방법을 설명 합니다.

드문 이벤트 감지 오류 수정 DNA와 RNA 시퀀싱을 사용 하 여

여기, 우리는 정확 하 게 계량 드롭 ddPCR 독특한 가수분해 프로브 쌍을 사용 하 여 단일 반응에서 대상 지역의 여러 유전 변경 하는 프로토콜을 제시.

하나의 물방울 디지털 연쇄 반응 핫스팟 지역에서 돌연변이의 포괄적이 고 동시 검색

여기에서, 우리는 환자 생물학적 유체 (biofluids)에 존재하는 순환 DNA에 있는 종양 체세포 돌연변이를 검출하는 프로토콜을 제시합니다. 우리의 액적 디지털 중합효소 연쇄 반응 (dPCR) 기지를 둔 방법은 종양 돌연변이 allelic 주파수 (MAF)의 정량화를 가능하게 하고, 종양 반응의 진단 그리고 시간적 감시에 최소침습 적인 보충을 촉진하.

환자 생체 유체에서 종양 관련 순환 DNA의 검출 및 모니터링

이 문서에서는 주어진 환자에게서 다른 견본 중 클론 및 subclonal 변경을 확인하는 방법을 설명합니다. 여기에서 기술된 실험은 특정 종양 모형에 집중하더라도, 접근은 그밖 고형 종양에 광범위하게 적용가능하다.

표적 시퀀싱 접근법을 통한 비교 병변 분석

배우세요 야생형 차단 PCR과 Sanger 염기서열분석을 결합한 저빈도 체세포 돌연변이 검출 방법을 통해 혈액암 연구에 활용할 수 있는 고감도 분석 기술을 익히세요.

저빈도 체세포 돌연변이 검출을 위한 Sanger 염기서열분석과 결합된 야생형 차단 PCR

더 많은 동영상 탐색