Name: Rearing Axenic Delia antiqua with Half-Fermented Sterile Diets (반 발효 멸균 식단으로 Axenic Delia antiqua 사육) (동영상) | JoVE Journal
Uploaded: 2023-12-22T14:55:00.000+00:00
Duration: 5 min 58 s
Description: 배우세요 반 발효 멸균 식단을 이용한 Delia antiqua 무균 사육 방법을 통해 장내 미생물 상호작용을 연구하는 기법입니다. 이 방법은 항생제보다 효과적이고 경제적이며 Wolbachia 균주를 PCR로 검출할 수 있습니다.

ai_agent_IP

ai_agent

maintenance

instantTrialDurationMinutes

isBiopharma

enableNewMyJoveSectionDesign

educationFeatures

seoMetaApi

ai_copilot_institution_blacklist

ai_chat_institution_blacklist

freeAccessWindow

ssoRoleCapture

scheduledMaintenanceBanner

joveLabsFeatures

disable_autoplay_for_bots

extended_trial_duration

5 minutes

playerTrialDesktop

이 연구는 중국국가자연과학재단(32272530), 제남대학 신20대 정책(2021GXRC040), 산둥성 주요 과학기술혁신 프로젝트(2021TZXD002), 치루이공대학 과학교육통합사업(2022PYI009, 2022PY016, 2022PT105)의 지원을 받았다.

D. antiqua 는 Taian의 Fanzhen 분야에서 얻습니다.
1. 멸균 식단 준비
<ol><li>파의 바깥 층을 벗기고 녹색 잎을 버립니다. 파의 흰 부분(그림 1A)을 유지하고 멸균수로 씻고 헹굼 과정을 세 번 반복합니다. 나중에 사용하기 위해 75% EtOH 용액(2.5단계에서 언급)으로 멸균한 가위( 재료 표 참조)를 사용하여 파의 흰색 부분을 1-2cm 깍둑썰기한 조각으로 자릅니다.</li>
	<li>깍둑썰기한 파 50g의 무게를 달아 푸드 프로세서에 넣습니다( 재료 표 참조). 멸균수 50mL를 넣고 각각 2분씩 5회 갈아줍니다. 깍둑썰기한 모든 파는 페이스트와 같은 농도로 갈아야 합니다(그림 2A).</li>
	<li>핀셋을 사용하여 D. antiqua의 3번째 인스타 유충 10개를 10mL의 1x PBS가 포함된 10mL 원심분리 튜브에 옮기고 일회용 분쇄 유봉(재료 표 참조)으로 약 5분 동안 분쇄하여 유충 분쇄액을 얻습니다.</li>
	<li>반죽 같은 파 액체와 유충 분쇄액을 깨끗한 500mL 원뿔형 플라스크에 붓습니다( 재료 표 참조). 원뿔형 플라스크 입구를 두 겹의 투명 밀봉 필름으로 감싼 다음 플라스크를 흔들리는 인큐베이터( 재료 표 참조)에 넣어 25°C 및 180rpm에서 12시간 동안 발효합니다(그림 2B).</li>
	<li>가위로 10cm면의 사각 거즈 7 겹 (멸균 필요 없음)을 잘라내어 함께 쌓아 간단한 필터 장치를 만듭니다. 발효된 파 액체를 거즈에 천천히 붓고 여과된 액체를 짜내어 새 500mL 원뿔형 플라스크에 넣습니다. 나중에 사용할 수 있도록 거즈에 남은 파 잔여물을 은박지로 싸십시오.</li>
	<li>이전 단계에서 얻은 여과액을 진공 펌프( 재료 표 참조)와 Buchner 깔때기를 사용하여 여과합니다. 탈이온수로 적신 여과지를 Buchner 깔때기에 놓고 여과액을 붓고 다른 여과지로 3회 흡입 여과를 수행합니다. 500mL 원뿔형 플라스크에 최종 여과액을 수집합니다.</li>
	<li>0.22μM 필터 병과 진공 펌프를 사용하여 또 다른 여과를 수행합니다. 추가 사용을 위해 흡입 필터 플라스크의 덮개를 매우 깨끗한 벤치( 재료 표 참조)에 나사로 고정합니다. 이 시점에서 발효된 파 잔류물과 여과액이 얻어집니다(그림 2C). 알림: 이 단계에서 얻은 여과된 액체는 멸균됩니다. (0.22μM 필터 병은 여과액을 살균하기 위한 멸균 진공 여과 시스템입니다.)</li>
	<li>이전 단계를 반복하여 발효되지 않은 파 잔류물과 여과액을 얻습니다. 여기서 차이점은 발효가 필요하지 않다는 것입니다.</li>
	<li>0.24 g의 염화콜린과 0.56 g의 L-아스코르브산( 재료 표 참조)을 10mL 원심분리 튜브에 넣습니다. 탈이온수 3mL를 넣고 완전히 녹을 때까지 세게 흔듭니다. 매우 깨끗한 벤치에서 새로운 5mL 주사기를 사용하고 0.22μM 주사기 필터 3개( 재료 표 참조)를 부착하여 용액을 멸균한 다음 나중에 사용할 수 있도록 멸균 10mL 원심분리 튜브에 넣습니다. 알림: 염화콜린은 곤충의 성장에 필수적인 신경 전달 물질입니다., L-아스코르브산은 방부제 역할을 합니다.</li>
	<li>한천 분말 2g과 TSB 6g( 재료 표 참조)의 무게를 측정하고 500mL 원뿔형 플라스크에 붓습니다. 그런 다음 100mL의 탈이온수를 추가하여 배양 배지를 준비합니다. 유리 막대를 탈이온수로 헹군 후 잘 섞일 때까지 혼합물을 저어줍니다. 그런 다음 두 겹의 투명 밀봉 필름을 사용하여 원추형 플라스크를 밀봉합니다.</li>
	<li>발효된 파와 발효되지 않은 파(1.5단계 및 1.8단계에서 언급)를 알루미늄 호일로 싸서 배양 배지와 함께 121°C의 오토클레이브에서 20분 동안 살균합니다.</li>
	<li>매우 깨끗한 벤치에서 멸균된 염화콜린, L-아스코르브산, 멸균 여과액을 배양 배지에 붓고 부드럽게 휘저어 완전히 섞습니다. 마지막으로 발효된 파와 발효되지 않은 파를 넣고 손으로 세게 흔들어 멸균 사료를 얻습니다. 50mL 원심분리 튜브(멸균, 0.22μM PVDF 소수성 멤브레인이 있는 벤트 캡)( 재료 표 참조)에 비스듬히 붓습니다(그림 2D). 알림: 멸균 후 배양 배지의 온도는 65-80°C 사이로 유지되어 파 또는 기타 재료를 추가할 때 급속 냉각 및 응고를 방지해야 합니다. 또한 각 튜브에 약 10-15mL의 식단을 붓습니다. 식단이 굳으면 튜브를 즉시 사용하지 않을 경우 4°C의 냉장고에 보관하십시오.</li>
</ol>2. 액세스 알의 획득
<ol><li>D. antiqua의 실험실 사육 시스템
	<ol><li>25°C 내부 LED 조명 인큐베이터(주기당 24시간, 빛과 어둠의 비율은 16:8)에 사육 케이지를 배치하여 성충 수컷과 암컷이 짝짓기를 하고 알을 낳을 수 있도록 합니다. 정수기(그림 1B)에 물을 채우고 적신 면봉으로 밀봉하여 성인에게 물을 제공합니다.</li>
		<li>35mm x 12mm 페트리 접시 바닥 4개를 94mm x 16mm 페트리 접시 뚜껑에 넣습니다. 이온수로 탈지면을 적신 다음 페트리 접시 바닥 두 곳에 축축한 탈지면을 놓고 탈지면 위에 자당 1큰술을 넣습니다.</li>
		<li>다른 두 개의 페트리 접시 바닥을 성충의 먹이 역할을 하는 자당과 효모 추출물 2테이블스푼( 재료 표 참조)으로 채웁니다(그림 1C). 알림: 2.1.2 단계 및 2.1.3 단계에서 언급 한 자당 및 효모 추출물은 멸균 할 필요가 없습니다.</li>
		<li>94mm x 16mm 페트리 접시 바닥에 축축한 모래와 뿌리를 내리지 않고 껍질을 벗긴 마늘 정향 조각(그림 1D)을 플라이 케이지 안에 넣어 알을 모은다. 암컷은 마늘 냄새에 이끌려 그 주위에 알을 낳습니다.</li>
	</ol></li>
	<li>달걀 채취<ol><li>위에서 언급한 모래와 마늘이 들어 있는 94mm x 16mm 페트리 접시인 산란 장치(2.14단계)를 케이지에서 꺼냅니다. 마늘과 함께 모래를 500mL 비커에 붓고 수돗물을 사용하여 마늘에 남아 있는 계란을 비커에 넣습니다. 이 시점에서 알은 물에 떠 있습니다.</li>
		<li>100메쉬 체( 재료 표 참조)를 가져다가 수돗물로 적십니다. 그런 다음 비커에서 떠 다니는 계란이 들어있는 물을 체에 붓습니다. 계란은 체에 남아 있습니다.</li>
		<li>계란이 체에서 자연적으로 건조된 후 브러시를 사용하여 계란을 페트리 접시에 부드럽게 쓸어냅니다.</li>
	</ol></li>
	<li>첫날에는 산란 장치를 세척하여 소독이나 살균 없이 알을 채취합니다. 둘째 날 오후 4시에 달걀을 다시 씻어내고 깨끗한 물로 체로 쳐서 모은다. 참고: 둘째 날에 알을 모으는 것은 후속 단계에서 일관된 성장 속도를 보장하기 위한 것입니다. 오후 4시는 D. antiqua의 알을 낳는 피크입니다. 따라서 이때 알을 모으는 것이 이상적입니다.</li>
	<li>수집된 계란을 매우 깨끗한 벤치(그림 3A)의 멸균 세포 체(재료 표 참조)에 놓습니다.</li>
	<li>계란 살균을 위한 용액 준비<ol><li>5.2% NaClO 5mL( 재료 표 참조)를 멸균된 250mL 원뿔형 플라스크에 옮깁니다. 멸균수 95mL를 첨가하여 총 부피 100mL를 만들어 0.26% NaClO 용액을 만듭니다.</li>
		<li>75% EtOH 용액을 준비하려면 75mL의 99.7% EtOH를 멸균된 250mL 원뿔형 플라스크에 옮깁니다. 멸균수 25mL를 첨가하여 총 부피 100mL를 만들면 75%의 EtOH 용액이 됩니다.</li>
	</ol></li>
	<li>페트리 접시에 NaClO 30mL를 붓고 다른 페트리 접시에 30mL EtOH를 붓습니다. 단계 2.4에서 언급된 계란이 포함된 세포체를 NaClO가 포함된 접시에 넣습니다. 0.26% NaClO 용액에 0.5분 동안 담그십시오. 그런 다음 체를 EtOH가 포함된 접시에 옮기고 75% EtOH 용액에 0.5분 더 담가둡니다.</li>
	<li>0.5분마다 0.26% NaClO와 75% EtOH를 번갈아 가며 이 과정을 세 번 반복합니다. 그 후 액센 알을 얻을 수 있습니다. 이 시점에서 계란이 들어 있는 체를 EtOH에 담가야 합니다. 참고: 철저한 멸균을 위해 1mL 피펫을 사용하여 NaClO 및 EtOH를 흡인하고 계란을 분산시킵니다. 헹굼 과정을 여러 번 반복합니다. 이 단계는 잔류 박테리아와 불순물로부터 계란 표면을 추가로 청소하여 깨끗하고 멸균된 표면을 보장합니다.</li>
</ol>3. 도끼 유충의 사육
<ol><li>멸균된 계란을 옮기려면 알코올 램프로 멸균된 가위를 사용하여 1mL 피펫의 끝 끝을 자릅니다(그림 3B). 절단된 피펫의 끝 구멍이 계란의 직경(약 2mm)보다 큰지 확인하십시오. 그런 다음 피펫을 사용하여 EtOH 용액(계란과 용액 포함)(그림 3C)의 계란을 멸균 사료가 들어 있는 원심분리 튜브로 옮기고 각 튜브에는 약 20-50개의 계란이 들어 있어야 합니다(그림 3D). 모든 알이 옮겨질 때까지 이 과정을 반복합니다. 알림: 피펫 팁의 직경은 이송 중에 계란이 깨져 사망에 이를 수 없도록 가능한 한 커야 합니다.</li>
	<li>피펫을 사용하여 튜브에서 과도한 에탄올을 제거합니다. 자체 밀봉 백 안에 뚜껑으로 닫힌 원심분리기 튜브를 놓고 공기 순환을 위해 백 입구에 면 조각을 놓습니다. 마지막으로 관찰 및 배양을 위해 백을 25°C 인큐베이터(상대 습도: 50%-70%, 광주기: 16시간 밝음: 8시간 어두움)에 넣습니다.</li>
	<li>약 3일 후, 사료의 도끼 알이 부화하기 시작합니다(그림 4A). 부화한 유충은 활성화되고 무균 식단의 표면은 더 이상 매끄럽지 않습니다. 유충은 먹이를 먹기 시작합니다.</li>
	<li>유충이2nd instar 유충의 단계에 도달할 때까지 유충을 계속 관찰합니다. 이 기간 동안 그들의 성장과 발달을 계속 모니터링하십시오.</li>
	<li>9-12일 후, 알의 80% 이상이 3번째 인스타 유충으로 발달합니다(그림 4B). 이것은 유충의 성공적인 성장과 발달을 나타냅니다.</li>
</ol>4. 배양 의존적 분석을 통한 axenic 유충 검증
<ol><li>원심분리 튜브에서 3개의 axenic3rd instar 유충을 무작위로 선택합니다.</li>
	<li>청소를 위해 94% 알코올이 포함된 16mm x 75mm 페트리 접시에 유충을 넣습니다. 그런 다음 추가 헹굼을 위해 멸균수가 담긴 용기에 옮깁니다.</li>
	<li>75% EtOH 용액으로 멸균된 소독된 해부 겸자를 사용하여 유충을 잡습니다(머리와 꼬리는 그림 5A 참조). 해부 가위를 사용하여 머리와 꼬리 끝을 제거합니다(그림 5B). 집게로 유충의 꼬리를 잡고 다른 집게를 사용하여 꼬리에서 머리까지 부드럽게 짜내고 내부 장기를 추출합니다( 그림 5C 참조). 내부 장기를 탈이온수에 넣고 집게로 지방 조직을 눌러 장을 부드럽게 떼어내고 추출한 내부(그림 5D)를 멸균 물에 넣어 나중에 사용합니다.</li>
	<li>장을 멸균된 1.5mL 원심분리기 튜브에 넣고 멸균된 1x PBS 완충액 500μL를 추가한 다음 일회용 유봉을 사용하여 장 조직을 균질하게 분쇄합니다.</li>
	<li>균질액 100μL를 취하여 영양 한천 배지에 첨가합니다. 한천 플레이트를 줄무늬로 만들기 위해 L자형 스프레더( 재료 표 참조)를 사용하십시오.</li>
	<li>페트리 접시를 28°C의 생화학적 인큐베이터에 넣고 72시간 동안 배양하여 콜로니의 성장을 관찰합니다.</li>
</ol>5. 배양 독립적 분석을 통한 axenic 유충 검증
<ol><li>제조업체의 지침에 따라 DNA 추출 키트( 재료 표 참조)를 사용하여 axenic 유충의 내장 조직에서 총 DNA를 추출합니다.</li>
	<li>UV 분광 광도계를 사용하여 DNA 농도를 측정합니다.</li>
	<li>범용 박테리아 16S rRNA 프라이머(1492R: 5'- GGTTACCTTGTTACGACTT -3', 27F: 5'- AGAGTTTGATCATGGCTCAG -3')를 사용하여 PCR 반응을 수행합니다. 총 반응 부피는 25μL이며 1μL DNA 템플릿, 0.5μL 순방향 프라이머, 0.5μL 역방향 프라이머, 10.5μL ddH2O및 12.5μL 2x Taq PCR Master Mix로 구성됩니다( 재료 표 참조). PCR 반응 조건을 다음과 같이 설정하십시오 : 94 °C에서 3 분 동안 초기 변성; 94°C에서 30초 동안 변성 35회, 55°C에서 30초 동안 어닐링, 72°C에서 90초 동안 연장; 72°C에서 10분 동안 최종 확장 추가 분석을 위해 PCR 산물을 4°C에서 보관합니다.</li>
	<li>범용 진균 ITS 프라이머(ITS1: 5'- TCCGTAGGTGAACCTGCGG -3', ITS4: 5'- TCCTCCGCTTATTGATATGC -3')를 사용하여 PCR 반응을 수행합니다. 총 반응 부피는 25μL이며 1μL DNA 템플릿, 0.5μL 순방향 프라이머, 0.5μL 역방향 프라이머, 10.5μL ddH2O및 12.5μL 2x Taq PCR Master Mix로 구성됩니다. PCR 조건을 95°C에서 5분 동안 설정합니다. 30초 동안 95°C, 1분 동안 55°C, 90초 동안 72°C의 35회 주기; 72°C에서 10분 동안 가열합니다. 추가 분석을 위해 PCR 산물을 4°C에서 보관합니다.</li>
	<li>Super Green 핵산 염료( 재료 표 참조)를 사용하여 두 가지 유형의 PCR 산물 각각과 고르게 혼합하고 1x TAE 완충액(50x TAE에서 희석됨, 재료 표 참조)에서 1% 아가로스 겔에 전기영동으로 분석합니다. 3μL의 DNA 마커( 재료 표 참조)를 참조로 사용합니다.</li>
	<li>UV transilluminator를 사용하여 겔을 관찰하고 표적 단편을 찾습니다.</li>
</ol>

Axenic Delia antiqua 의 개발 연구 및 박테리아 없는 성장 보장

<ol><li>Al-Asmakh, M., Zadjali, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Use+of+germ-free+animal+models+in+microbiota-related+research%5BTitle%5D)+AND+%22Journal+of+Microbiology+and+Biotechnology%22%5BJournal%5D)">Use of germ-free animal models in microbiota-related research.</a> Journal of Microbiology and Biotechnology. 25 (10), 1583-1588 (2015).</li>
<li>Bhattarai, Y., Kashyap, P. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Germ-free+mice+model+for+studying+host-microbial+interactions%5BTitle%5D)+AND+%22Methods+in+Molecular+Biology%22%5BJournal%5D)">Germ-free mice model for studying host-microbial interactions.</a> Methods in Molecular Biology. 1438, 123-135 (2016).</li>
<li>Douglas, A. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Multiorganismal+insects%3A+diversity+and+function+of+resident+microorganisms%5BTitle%5D)+AND+%22Annual+Review+of+Entomology%22%5BJournal%5D)">Multiorganismal insects: diversity and function of resident microorganisms.</a> Annual Review of Entomology. 60 (1), 17-34 (2015).</li>
<li>Wang, G. -H., Brucker, R. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((An+optimized+method+for+Nasonia+germ-free+rearing%5BTitle%5D)+AND+%22Scientific+Reports%22%5BJournal%5D)">An optimized method for Nasonia germ-free rearing.</a> Scientific Reports. 12 (1), 219(2022).</li>
<li>Nishide, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Aseptic+rearing+procedure+for+the+stinkbug+Plautia+stali+%28Hemiptera%3A+Pentatomidae%29+by+sterilizing+food-derived+bacterial+contaminants%5BTitle%5D)+AND+%22Applied+Entomology+and+Zoology%22%5BJournal%5D)">Aseptic rearing procedure for the stinkbug Plautia stali (Hemiptera: Pentatomidae) by sterilizing food-derived bacterial contaminants.</a> Applied Entomology and Zoology. 52 (3), 407-415 (2017).</li>
<li>Ma, M., Liu, P., Yu, J., Han, R., Xu, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Preparing+and+rearing+axenic+insects+with+tissue+cultured+seedlings+for+host-gut+microbiota+interaction+studies+of+the+leaf+beetle%5BTitle%5D)+AND+%22Journal+of+Visualized+Experiments%22%5BJournal%5D)">Preparing and rearing axenic insects with tissue cultured seedlings for host-gut microbiota interaction studies of the leaf beetle.</a> Journal of Visualized Experiments. 176, e63195(2021).</li>
<li>Zhu, Z., Wang, D., Liu, Y., Tang, T., Wang, G. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Optimizing+the+rearing+procedure+of+germ-free+wasps%5BTitle%5D)+AND+%22Journal+of+Visualized+Experiments%22%5BJournal%5D)">Optimizing the rearing procedure of germ-free wasps.</a> Journal of Visualized Experiments. 197, e65292(2023).</li>
<li>Somerville, J., Zhou, L. Q., Raymond, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Aseptic+rearing+and+infection+with+gut+bacteria+improve+the+fitness+of+transgenic+diamondback+moth%2C+Plutella+xylostella%5BTitle%5D)+AND+%22Insects%22%5BJournal%5D)">Aseptic rearing and infection with gut bacteria improve the fitness of transgenic diamondback moth, Plutella xylostella.</a> Insects. 10 (4), 89(2019).</li>
<li>Shuoying, N., Jiufeng, W., Jinian, F., Hugo, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Predicting+the+current+potential+and+future+world+wide+distribution+of+the+onion+maggot%2C+Delia+antiqua+using+maximum+entropy+ecological+niche+modeling%5BTitle%5D)+AND+%22PLoS+ONE%22%5BJournal%5D)">Predicting the current potential and future world wide distribution of the onion maggot, Delia antiqua using maximum entropy ecological niche modeling.</a> PLoS ONE. 12 (2), e0171190(2017).</li>
<li>Ellis, P. R., Eckenrode, C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Factors+influencing+resistance+in+Allium+sp.+to+onion+maggot%5BTitle%5D)+AND+%22Bulletin+of+the+Entomological+Society+of+America%22%5BJournal%5D)">Factors influencing resistance in Allium sp. to onion maggot.</a> Bulletin of the Entomological Society of America. 25 (2), 151-154 (1979).</li>
<li>Nault, B. A., Straub, R. W., Taylor, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Performance+of+novel+insecticide+seed+treatments+for+managing+onion+maggot+%28Diptera+%3A+Anthomyiidae%29+in+onion+fields%5BTitle%5D)+AND+%22Crop+Protection%22%5BJournal%5D)">Performance of novel insecticide seed treatments for managing onion maggot (Diptera : Anthomyiidae) in onion fields.</a> Crop Protection. 25 (1), 58-65 (2006).</li>
<li>Leach, A., Reiners, S., Fuchs, M., Nault, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Evaluating+integrated+pest+management+tactics+for+onion+thrips+and+pathogens+they+transmit+to+onion%5BTitle%5D)+AND+%22Agriculture+Ecosystems+%26+Environment%22%5BJournal%5D)">Evaluating integrated pest management tactics for onion thrips and pathogens they transmit to onion.</a> Agriculture Ecosystems & Environment. 250, 89-101 (2017).</li>
<li>Zhou, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Bacterial+Inhibition+on+Beauveria+bassiana+Contributes+to+Microbiota+Stability+in+Delia+antiqua%5BTitle%5D)+AND+%22Frontiers+in+Microbiology%22%5BJournal%5D)">Bacterial Inhibition on Beauveria bassiana Contributes to Microbiota Stability in Delia antiqua.</a> Frontiers in Microbiology. 12, 710800(2021).</li>
<li>Zhou, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Symbiotic+bacterium-derived+organic+acids+protect+delia+antiqua+larvae+from+entomopathogenic+fungal+infection%5BTitle%5D)+AND+%22mSystems%22%5BJournal%5D)">Symbiotic bacterium-derived organic acids protect delia antiqua larvae from entomopathogenic fungal infection.</a> mSystems. 5 (6), 00778-00820 (2020).</li>
<li>Jing, T. Z., Qi, F. H., Wang, Z. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Most+dominant+roles+of+insect+gut+bacteria%3A+digestion%2C+detoxification%2C+or+essential+nutrient+provision%5BTitle%5D)+AND+%22Microbiome%22%5BJournal%5D)">Most dominant roles of insect gut bacteria: digestion, detoxification, or essential nutrient provision.</a> Microbiome. 8 (1), 38(2020).</li>
<li>Kietz, C., Pollari, V., Meinander, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Generating+germ-free+drosophila+to+study+gut-microbe+interactions%3A+protocol+to+rear+Drosophila+under+axenic+conditions%5BTitle%5D)+AND+%22Current+Protocols+in+Toxicology%22%5BJournal%5D)">Generating germ-free drosophila to study gut-microbe interactions: protocol to rear Drosophila under axenic conditions.</a> Current Protocols in Toxicology. 77 (1), e52(2018).</li>
<li>Schretter, C. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+gut+microbial+factor+modulates+locomotor+behaviour+in+Drosophila%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">A gut microbial factor modulates locomotor behaviour in Drosophila.</a> Nature. 563 (7731), 402(2018).</li>
<li>Brummel, T., Ching, A., Seroude, L., Simon, A. F., Benzer, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Drosophila+lifespan+enhancement+by+exogenous+bacteria%5BTitle%5D)+AND+%22Proceedings+of+the+National+Academy+of+Sciences+of+the+United+States+of+America%22%5BJournal%5D)">Drosophila lifespan enhancement by exogenous bacteria.</a> Proceedings of the National Academy of Sciences of the United States of America. 101 (35), 12974-12979 (2004).</li>
<li>Romoli, O., Schonbeck, J. C., Hapfelmeier, S., Gendrin, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Production+of+germ-free+mosquitoes+via+transient+colonisation+allows+stage-specific+investigation+of+host-microbiota+interactions%5BTitle%5D)+AND+%22Nature+Communications%22%5BJournal%5D)">Production of germ-free mosquitoes via transient colonisation allows stage-specific investigation of host-microbiota interactions.</a> Nature Communications. 12 (1), 942(2021).</li>
<li>Ma, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Metabolic+and+immunological+effects+of+gut+microbiota+in+leaf+beetles+at+the+local+and+systemic+levels%5BTitle%5D)+AND+%22Integrative+Zoology%22%5BJournal%5D)">Metabolic and immunological effects of gut microbiota in leaf beetles at the local and systemic levels.</a> Integrative Zoology. 16 (3), 313-323 (2021).</li>
<li>Zhang, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Differences+between+microbial+communities+of+pinus+species+having+differing+level+of+resistance+to+the+pine+wood+nematode%5BTitle%5D)+AND+%22Microbial+Ecology%22%5BJournal%5D)">Differences between microbial communities of pinus species having differing level of resistance to the pine wood nematode.</a> Microbial Ecology. 84 (4), 1245-1255 (2022).</li>
<li>Jung, S., Kim, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Synergistic+effect+of+Xenorhabdus+nematophila+K1+and+Bacillus+thuringiensis+subsp+aizawai+against+Spodoptera+exigua+%28Lepidoptera+%3A+Noctuidae%29%5BTitle%5D)+AND+%22Biological+Control%22%5BJournal%5D)">Synergistic effect of Xenorhabdus nematophila K1 and Bacillus thuringiensis subsp aizawai against Spodoptera exigua (Lepidoptera : Noctuidae).</a> Biological Control. 39 (2), 201-209 (2006).</li>
<li>Raymond, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+mid-gut+microbiota+is+not+required+for+the+pathogenicity+of+Bacillus+thuringiensis+to+diamondback+moth+larvae%5BTitle%5D)+AND+%22Environmental+Microbiology%22%5BJournal%5D)">A mid-gut microbiota is not required for the pathogenicity of Bacillus thuringiensis to diamondback moth larvae.</a> Environmental Microbiology. 11 (10), 2556-2563 (2009).</li>
<li>Weersma, R. K., Zhernakova, A., Fu, J. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Interaction+between+drugs+and+the+gut+microbiome%5BTitle%5D)+AND+%22Gut%22%5BJournal%5D)">Interaction between drugs and the gut microbiome.</a> Gut. 69 (8), 1510-1519 (2020).</li>
<li>Llop, P., Latorre, A., Moya, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Experimental+epidemiology+of+antibiotic+resistance%3A+looking+for+an+appropriate+animal+model+system%5BTitle%5D)+AND+%22Microbiology+Spectrum%22%5BJournal%5D)">Experimental epidemiology of antibiotic resistance: looking for an appropriate animal model system.</a> Microbiology Spectrum. 6 (1), (2018).</li>
<li>Doll, J. P., Trexler, P. C., Reynolds, L. I., Bernard, G. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+use+of+peracetic+acid+to+obtain+germfree+invertebrate+eggs+for+gnotobiotic+studies%5BTitle%5D)+AND+%22American+Midland+Naturalist%22%5BJournal%5D)">The use of peracetic acid to obtain germfree invertebrate eggs for gnotobiotic studies.</a> American Midland Naturalist. 6 (1), 239(1963).</li>
<li>Dillon, R., Charnley, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Mutualism+between+the+desert+locust+Schistocerca+gregaria+and+its+gut+microbiota%5BTitle%5D)+AND+%22Research+in+Microbiology%22%5BJournal%5D)">Mutualism between the desert locust Schistocerca gregaria and its gut microbiota.</a> Research in Microbiology. 153 (8), 503-509 (2002).</li>
<li>Tegtmeier, D., Thompson, C. L., Schauer, C., Brune, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Oxygen+affects+gut+bacterial+colonization+and+metabolic+activities+in+a+gnotobiotic+cockroach+model%5BTitle%5D)+AND+%22Applied+and+Environmental+Microbiology%22%5BJournal%5D)">Oxygen affects gut bacterial colonization and metabolic activities in a gnotobiotic cockroach model.</a> Applied and Environmental Microbiology. 82 (4), 1080-1089 (2016).</li>
<li>Muhammad, A., Habineza, P., Hou, Y. M., Shi, Z. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Preparation+of+red+palm+weevil+Rhynchophorus+Ferrugineus+%28Olivier%29+%28Coleoptera%3A+Dryophthoridae%29+germ-free+larvae+for+host-gut+microbes+interaction+studies%5BTitle%5D)+AND+%22Bio-Protocol%22%5BJournal%5D)">Preparation of red palm weevil Rhynchophorus Ferrugineus (Olivier) (Coleoptera: Dryophthoridae) germ-free larvae for host-gut microbes interaction studies.</a> Bio-Protocol. 9 (24), e3456(2019).</li>
<li>Bavani, M. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Sterilization+of+Lucilia+sericata+%28Diptera%3A+Calliphoridae%29+Eggs+for+maggot+debridement+therapy%5BTitle%5D)+AND+%22Journal+of+Medical+Entomology%22%5BJournal%5D)">Sterilization of Lucilia sericata (Diptera: Calliphoridae) Eggs for maggot debridement therapy.</a> Journal of Medical Entomology. 59 (3), 1076-1080 (2022).</li>
<li>Han, L. Z., Li, S. B., Liu, P. L., Peng, Y. F., Hou, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((New+artificial+diet+for+continuous+rearing+of+Chilo+suppressalis+%28Lepidoptera%3A+Crambidae%29%5BTitle%5D)+AND+%22Annals+of+the+Entomological+Society+of+America%22%5BJournal%5D)">New artificial diet for continuous rearing of Chilo suppressalis (Lepidoptera: Crambidae).</a> Annals of the Entomological Society of America. 105 (2), 253-258 (2012).</li>
<li>Bezerra, C. E. S., Amaral, B. B., Souza, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Rearing+Chrysoperla+externa+larvae+on+artificial+diets%5BTitle%5D)+AND+%22Neotropical+Entomology%22%5BJournal%5D)">Rearing Chrysoperla externa larvae on artificial diets.</a> Neotropical Entomology. 46 (1), 93-99 (2017).</li>
<li>Feng, H. Q., Jin, Y. L., Li, G. P., Feng, H. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Establishment+of+an+artificial+diet+for+successive+rearing+of+Apolygus+lucorum+%28Hemiptera%3A+Miridae%29%5BTitle%5D)+AND+%22Journal+of+Economic+Entomology%22%5BJournal%5D)">Establishment of an artificial diet for successive rearing of Apolygus lucorum (Hemiptera: Miridae).</a> Journal of Economic Entomology. 105 (6), 1921-1928 (2012).</li>
<li>Hassan, B., Siddiqui, J. A., Xu, Y. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Vertically+transmitted+gut+bacteria+and+nutrition+influence+the+immunity+and+fitness+of+Bactrocera+dorsalis+larvae%5BTitle%5D)+AND+%22Frontiers+in+Microbiology%22%5BJournal%5D)">Vertically transmitted gut bacteria and nutrition influence the immunity and fitness of Bactrocera dorsalis larvae.</a> Frontiers in Microbiology. 11, 596352(2020).</li>
<li>Li, X. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Dynamics+of+the+intestinal+bacterial+community+in+black+soldier+fly+larval+guts+and+its+influence+on+insect+growth+and+development%5BTitle%5D)+AND+%22Insect+Science%22%5BJournal%5D)">Dynamics of the intestinal bacterial community in black soldier fly larval guts and its influence on insect growth and development.</a> Insect Science. 30 (4), 947-963 (2023).</li>
<li>Moran, N. A., McCutcheon, J. P., Nakabachi, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genomics+and+Evolution+of+heritable+bacterial+symbionts%5BTitle%5D)+AND+%22Annual+Review+of+Genetics%22%5BJournal%5D)">Genomics and Evolution of heritable bacterial symbionts.</a> Annual Review of Genetics. 42, 165-190 (2008).</li>
<li>Weinert, L. A., Araujo-Jnr, E. V., Ahmed, M. Z., Welch, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+incidence+of+bacterial+endosymbionts+in+terrestrial+arthropods%5BTitle%5D)+AND+%22Proceedings+of+the+Royal+Society+B-Biological+Sciences%22%5BJournal%5D)">The incidence of bacterial endosymbionts in terrestrial arthropods.</a> Proceedings of the Royal Society B-Biological Sciences. 282 (1807), 20150249(2015).</li>
<li>Weeks, A. R., Turelli, M., Harcombe, W. R., Reynolds, K. T., Hoffmann, A. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((From+parasite+to+mutualist%3A+Rapid+evolution+of+Wolbachia+in+natural+populations+of+Drosophila%5BTitle%5D)+AND+%22PLOS+Biology%22%5BJournal%5D)">From parasite to mutualist: Rapid evolution of Wolbachia in natural populations of Drosophila.</a> PLOS Biology. 5 (5), 997-1005 (2007).</li>
</ol>

저자는 공개할 이해 상충이 없습니다.

곤충은 매우 복잡한 장내 미생물군(20,21)을 가지고 있으므로, 곤충-미생물 상호작용을 연구하기 위해 특정 장내 미생물 균주를 접종한 축곤충을 사용해야 합니다. 도끼 곤충의 준비는 이러한 연구 노력에 매우 중요합니다. 항생제 치료는 장내 미생물군을 제거하는 데 사용되는 방법입니다. 예를 들어, 융(Jung)과 킴(Kim)22은 스포도프테라 엑시구아(Spodoptera exigua)에게 페니실린을 먹였고, 레이몬드(Raymond)(23)는 장내 세균을 제거하기 위해 리팜피신(rifampicin)이 함유된 인공 사료를 P. 자일로스텔라(P. xylostella)에게 먹였다. 그러나 항생제 치료는 장내 세균을 완전히 제거할 수 없으며 숙주 곤충에 많은 부작용이 있습니다. 여기에는 대사 효소 활성의 변화, 장 기능...

생존 가능한 미생물이나 기생충이 검출되지 않는 동물로 정의되는 Axenic 동물은 숙주-미생물 상호 작용을 연구하는 데 유용한 실험 모델입니다 1,2. 무척추동물의 가장 큰 그룹인 곤충은 미생물과 공생 관계를 형성할 수 있다3. 축삭 곤충은 공생 시스템에서 숙주-공생 상호 작용을 연구하는 데 사용할 수 있습니다4. 예를 들어, Nishide et al.5은 악취 웜 Plautia stali에 대한 실용적인 멸균 사육 절차를 확립하여 모델 공생 시스템에서 숙주-공생 상호 작용에 대한 신뢰할 수 있고 엄격한 분석을 가능하게 했습니다. 도끼 곤충은 알 단계를 살균하고 유충과 성충에게 멸균 식품을 제공함으로써 생산할 수 있다 6,7. Axenic 곤충은 매우 중요하며 생물학 연구에 널리 사용됩니다. 예를 들어, 서머빌(Somerville) 등8이 실시한 연구에 따르면 엔테로박터 클로아카에(Enterobacter cloacae)를 접종한 다이아몬드백나방은 형질전환 수컷의 적응성을 향상시켰다.
Delia antiqua Meigen은 전 세계적으로 양파 및 기타 백합과 작물의 경제적으로 중요한 해충으로, 유충이 양파 및 기타 백합과 작물의 구근을 손상시킨다9. D. antiqua는 주로 온대 기후에서 발견되며 아메리카, 유럽 및 아시아의 양파 재배 지역에 널리 퍼져 있습니다. 적절하게 통제하지 않으면 양파(Allium cepa L.), 마늘(Allium sativum L.), 샬롯(Allium fistulosum L.) 및 부추(Alliumchoenoprasum L.)에서 50%에서 100%에 이르는 작물 손실을 유발할 수 있습니다10,11. 유충은 식물의 지하 부분을 먹으며, 이 먹이로 인해 묘목이 시들어 결국 죽습니다. 또한 손상된 식물은 병원균이 침입하여 구근을 썩게 할 수 있습니다12. 식물이 유충에 의해 완전히 소멸되지 않더라도 양파 식물이 초래하는 손상으로 인해 양파 식물은 시장성이 떨어지고 경제적 손실이 발생합니다.
곤충은 장내 미생물군과 밀접한 관련이 있으며, 대부분의 곤충 내장에는 숙주가 제공하는 영양분을 먹고 번성하는 다양한 공생 박테리아가 포함되어 있다13,14. Jing et al.15에 따르면 장내 공생 군집의 주요 기능은 필수 영양소를 제공하는 것이며, 소화 및 해독과 관련된 기능이 그 뒤를 잇습니다. 어떤 경우에는 장내 세균이 해충 관리 목적으로 미생물 자원 역할을 할 수 있습니다. 따라서 D. antiqua의 체내에서 개별 장내 세균의 성능과 특정 기능을 연구하는 것이 바람직합니다. 그러므로, 축삭 유충을 준비하는 것은 특정 박테리아 균주와 곤충 사이의 상호작용을 연구하는 데 특히 중요하다16. 현재, 곤충 장내 세균을 제거하기 위해 일반적으로 사용되는 방법은 관련 미생물을 박멸하기 위해 항생제 조합을 사용하는 것이다 17,18,19. 미생물 수만 줄일 수 있는 항생제만 사용하는 것과 달리, 곤충의 축류 사육은 미생물의 구성과 양을 제어할 수 있어 장내 미생물군의 기능을 보다 정확하게 검증할 수 있습니다.
따라서 이 기사에서는 axenic D. antiqua를 준비하고 기르기 위한 프로토콜을 소개합니다. Axenic 유충 먹이는 반 발효 식품과 결합 된 자연 식단의 고온 살균을 활용하여 얻습니다. 알은 액센 알을 얻기 위한 실험 프로토콜에 따라 멸균되고, 마지막으로 액센 알에서 액센 유충을 배양합니다. 액식 사육 시스템은 실험을 위해 한 세대 동안만 수행되었습니다. 이것은 곤충과 장내 미생물 사이의 상호 작용을 연구하는 데 편리함을 제공할 것입니다.

<table><tbody><tr><td>0.22 &무; M 필터 병</td><td>Thermo Scientific</td><td>450-0045</td><td></td></tr><tr><td>0.22 &mu; M 주사기 필터</td><td>Biosharp</td><td>BS-QT-011</td><td></td></tr><tr><td>100메시 체</td><td>Zhejiang Shangyu Jinding 표준 체 공장</td><td>카탈로그 번호</td><td></td></tr><tr><td>없음 1x PBS 용액</td><td>Solarbio</td><td>P1020</td><td></td></tr><tr><td>2x Taq PCR 마스터 믹스</td><td>GENVIEW</td><td>GR1113-1ML</td><td></td></tr><tr><td>5.2% NaClO 용액</td><td>Sinopharm Chemical Reagent Co., Ltd.</td><td></td><td></td></tr><tr><td>80010428 500 mL 원뿔형 플라스크</td><td>Thermo Scientific</td><td>4103-0500</td><td></td></tr><tr><td>50 mL 통풍 원심분리기 튜브</td><td>JET BIOFIL</td><td>BRT-011-050</td><td></td></tr><tr><td>50x TAE 버퍼</td><td>GENVIEW</td><td>GT1307</td><td></td></tr><tr><td>한천 분말</td><td>Ding Guo</td><td>DH010-1.1</td><td></td></tr><tr><td>생화학 인큐베이터</td><td>STIK</td><td>21040121500010</td><td></td></tr><tr><td>Cell Sieve</td><td>SAINING</td><td>5022200</td><td></td></tr><tr><td>염화콜린</td><td>Sangon Biotech</td><td>A600299-0100</td><td></td></tr><tr><td>ddH2O</td><td>Ding Guo</td><td>PER018-2</td><td></td></tr><tr><td>일회용 연삭 유봉</td><td>JET BIOFIL</td><td>CSP-003-002</td><td></td></tr><tr><td>DNA 추출 키트</td><td>Sangon Biotech</td><td>B518221-0050</td><td></td></tr><tr><td>DNA 마커</td><td>Sangon Biotech</td><td>B600335-0250</td><td></td></tr><tr><td>에탄올 앱솔루트</td><td>시노팜 화학시약 주식회사</td><td></td><td></td>10009218</tr><tr><td>여과지</td><td>NEWSTAR</td><td>1087309025</td><td></td></tr><tr><td>식품 가공업자</td><td>Guangdong Midea Life Electric Appliance Manufacturing Co., Ltd.</td><td></td><td></td>WBL25B26</tr><tr><td>조명&nbsp; 인큐베이터</td><td>Shanghai ESTABLISH Instrumentation Co., Ltd.</td><td></td><td></td>A16110768</tr><tr><td>L-Ascorbic acid</td><td>Sangon Biotech</td><td>A610021-0100</td><td></td></tr><tr><td>L-shaped Spreader</td><td>SAINING</td><td>6040000</td><td></td></tr><tr><td>영양 아가 매체</td><td>Hope Bio</td><td>HB0109</td><td></td></tr><tr><td>가위</td><td>Bing Yu</td><td>&nbsp; </td><td>Jingdong</td></tr><tr><td>충격 인큐베이터</td><td>Shanghai Zhichu Instrument Co., Ltd.에서</td> BY-103 구매<td></td><td></td>2020000014</tr><tr><td>설탕</td><td>GENVIEW</td><td>CS326-500G</td><td></td></tr><tr><td>슈퍼 그린 핵산 염료</td><td>Biosharp</td><td>BS355A</td><td></td></tr><tr><td>슈퍼 클린 테이블</td><td>Heal Force</td><td>AC130052</td><td></td></tr><tr><td>TSB</td><td>Hope Bio</td><td>HB4114</td><td></td></tr><tr><td>진공 펌프</td><td>Zhejiang Taizhou Seeking Precision Vacuum Pump Co., Ltd.</td><td></td><td></td>22051031</tr><tr><td>효모 추출물</td><td>Thermo Scientific</td><td>LP0021B</td><td></td></tr></tbody></table>

rearing axenic delia antiqua with half-fermented sterile diets (반 발효 멸균 식단으로 axenic delia antiqua 사육)

Rearing Axenic Delia antiqua with Half-Fermented Sterile Diets

Axenic 곤충은 멸균 배지를 사용하는 멸균 인공 사육 시스템에서 얻습니다. 이 곤충은 작은 크기, 짧은 성장 주기 및 낮은 사료 요구 사항이 특징이며 미생물과 숙주 간의 관계를 연구하는 데 이상적입니다. 장내 미생물총은 곤충 숙주의 생리적 특성에 큰 영향을 미치며, 축삭 곤충에 특정 균주를 도입하면 장내 미생물 기능을 검증할 수 있습니다. Delia antiqua는 Diptera, Anthomyiidae 계통 및 Delia 속의 위협적인 해충으로 주로 양파, 마늘, 부추 및 Liliaceae 계통의 기타 채소를 먹습니다. 유충은 구근을 먹어 식물 전체가 썩고 시들고 심지어 죽기까지 합니다. 도끼 유충을 사육함으로써 장내 미생물이 D. antiqua의 성장과 발달에 미치는 영향을 관찰하기 위한 후속 연구를 수행할 수 있습니다. 관련 미생물의 항생제 제거와 관련된 방법과 달리 이 논문은 도끼 D. antiqua를 키우는 저비용 및 고효율 접근 방식을 제시합니다. D. antiqua 알의 표면 멸균 후, 유충을 기르기 위해 반발효 멸균 사료를 사용하였고, D. antiqua 의 액센 상태는 배양 의존적 및 배양 독립적 분석을 통해 검증하였다. 결론적으로, 곤충 알 살균과 유충 배양을 위한 멸균 식단 준비의 조합은 도끼 D. antiqua를 얻기 위한 효율적이고 간단한 방법의 개발을 가능하게 했습니다. 이 방법은 곤충-미생물 상호 작용을 연구하는 강력한 접근 방식을 제공합니다.

D. antiqua의 생애 단계는 그림 4에 묘사되어 있습니다. 전체 수명 주기는 알, 유충, 번데기(그림 4C) 및 성충(그림 4D)으로 구성됩니다. 그들은 멸균 원심 분리기 튜브에서 재배되며 외관과 생존율은 비 축 조건에서 자란 D. antiqua와 구별 할 수 없습니다. D. antiqua의 각 단계에 대한 성장 및 발달 시간은 그림 6에서 확인할 수 있습니다. 비축삭 사육 D. antiqua의 난자 단계는 2.83 ± 0.29일, 축삭 사육 D. antiqua의 난자 단계는 2.83 ± 0.29일로 둘 사이에 유의한 차이는 없습니다(독립 t-검정, t=0.00, p=1.00). 정상 유충 단계는 13.83 ± 0.7...

반 발효 멸균 사료로 axenic Delia antiqua 를 기르는 간단한 절차가 설명되어 있습니다. PCR을 사용하여 axnic D. antiqua 의 각 instar에서 하나의 Wolbachia 균주만 검출되었습니다.

Rearing Axenic Delia antiqua with Half-Fermented Sterile Diets (반 발효 멸균 식단으로 Axenic Delia antiqua 사육)

Axenic insects are obtained from sterile artificial rearing systems using sterile media. These insects, characterized by their small size, short growth ...

우리의 연구 분야는 미생물 생태학이며, 우리는 axenic Delia antiqua를 사육하여 내부 미생물 상호 작용을 탐구하고자 합니다. Delia antiqua의 장내 곰팡이의 다양성과 Delia antiqua의 성장과 발달에 미치는 영향에 대한 질문에 답할 것입니다. 반쯤 발효된 멸균 사료로 Delia antiqua를 사육하는 간단한 방법이 확립되었으며 PCR을 사용한 Delia antiqua의 각 instar에서 확인된 Wolbachia 균주가 하나만 검출되었습니다.항생제 치료와 달리 이 프로토콜은 장내 세균을 완전히 제거하고 숙주 곤충에게 많은 부작용을 일으키지 않습니다. 곤충 장내 미생물군의 기능도 표시되지 않습니다. 항생제 치료보다 효과적이고 저렴합니다.

rearing-axenic-delia-antiqua-with-half-fermented-sterile-diets

Research

연구

JoVE Journal

Biology

생물학

여기에 단단한 판 기반식이 제한을 수행하는 프로토콜을...

솔리드 플레이트 기반식이 제한에 Caenorhabditis 엘레간스</em

계란에서 웜 (EIW) 분석은 달걀 누워 행동을 정량화 할 수있는 유용한 방법입니다. 달걀 부설의 변화는 모델 유기체의 행동 반응 할 수...

에 박테리아의 효과를 측정<em&gt; C. 엘레</em계란 보존 분석을 사용하여&gt; 행동

C. elegans의는 일반적으로 고체 한천 플레이트에 성장 또는 액체 문화에서 E. 씨앗을 품고있다 대장균. 독성 및 영양 연구를 혼동에서 세균의 부산물을 방지하기 위해, 우리는 다운 스트림 응용 프로그램의 범위에 대한 웜의 수가 증가하고 동기화, 무균 액체 배지, CeHR을 이용했다.

배양 예쁜 꼬마 선충 미세 폭격에 의한 무균 액체 미디어 및 형질 전환 웜의 생성에

이 프레젠테이션의 목표는 생체 내에서와 곤충 병원성 선충의 양육을위한 체외 기술에 증명하는 것입니다. 체외 방법이 풍부한 한천 미디어를 활용하는 반면, 생체 내 방법, 곤충 호스트와이 선충의 양육을 고려하십시오.

생체 내에서와 곤충 병원성 선충의 체외 양육 (Steinernematidae 및 Heterorhabditidae)

무균 및 무균 조건에서 초파리 melanogaster의를 양육하는 방법이 제공된다. 플라이 배아는, 차아 염소산 나트륨에 dechorionated 멸균 다이어트에 무균 적으로 전송하고, 밀폐 용기에 양육된다. 박테리아와식이 요법과 배아를 접종은 무균 협회에 이르게하고, 세균의 존재는 전신 초파리 균질 도금에 의해 확인된다.

과일 비행을 양육<em&gt; 노랑 초파리</em&gt; 무균 및 무균 조건에서

선 충 류 꼬마 선 충 호스트 병원 체 상호 작용을 해 부에 우수한 모델입니다. 여기에 설명 된 멤버 mitis 그룹 streptococci와 웜 감염 유 기체의이 그룹에 의해 생산 H2O2 에 대 한 산화 스트레스 반응의 활성화를 결정 하는 프로토콜이입니다.

산화 스트레스는 Mitis 그룹 Streptococci 꼬마 선 충 에 의해 발생 하는 공부

여기서 우리는 상업용 육계 라인 인 Ross PM3의 알에서 세균이없는 병아리를 생성하는 방법을 설명합니다. 이 방법은 다른 가금류 종으로부터 세균이없는 동물의 생성에 적합 할 수 있습니다.

Microbiota 연구를위한 상업 라인에서 세균이없는 빠르게 성장하는 육계 생산

도끼 곤충을 얻기 위해 달걀 표면을 살균하고 부화 한 유충은 도끼 잎을 사용하여 사육됩니다. 이 방법은 항생제를 투여하거나 다른 잎을 먹는 곤충에도 적용 할 수있는 인공 식단을 개발하지 않고도 축산 곤충 준비를위한 효율적인 방법을 제공합니다.

잎 딱정벌레의 숙주 - 장 microbiota 상호 작용 연구를위한 조직 배양 묘목으로 축 곤충 준비 및 사육

여기에 제시된 것은 미세 가공된 멀티웰 장치의 고체 배지에서 분리된 개별 선충을 배양하기 위한 최적화된 프로토콜입니다. 이 접근 방식을 통해 활동, 신체 크기 및 모양, 움직임 기하학 및 생존을 포함하여 노화 및 건강과 관련된 다양한 표현형에 대해 개별 동물을 평생 동안 모니터링할 수 있습니다.

Multi-well 장치의 고체 배지에서 분리된 Caenorhabditis elegans의 장기 배양 및 모니터링Long-term culture and monitoring of isolated Caenorhabditis elegans on Solid Media in Multi-well devices

이 프로토콜은 액체 배양에서 박테리아의 청소율을 측정하여 Caenorhabditis elegans 섭식 속도를 정량화하는 분석을 설명합니다.

예쁜꼬마선충( Caenorhabditis elegans )의 음식 섭취량을 세균 청소율 측정으로 정량화

이 논문은 Lower dipteran fly Bradysia (Sciara) coprophila의 실험실 유지 관리 (짝짓기 및 먹이 포함)를 간략하게 설명합니다.

Lower Dipteran Fly Bradysia (Sciara) coprophila의 실험실 유지 보수 : 새로운 / 오래된 신흥 모델 유기체

배우세요 반 발효 멸균 식단을 이용한 Delia antiqua 무균 사육 방법을 통해 장내 미생물 상호작용을 연구하는 기법입니다. 이 방법은 항생제보다 효과적이고 경제적이며 Wolbachia 균주를 PCR로 검출할 수 있습니다.

Rearing Axenic Delia antiqua with Half-Fermented Sterile Diets (반 발효 멸균 식단으로 Axenic Delia antiqua 사육)

더 많은 동영상 탐색