Name: 약용 식물을 식별하기 위한 DNA 바코드 적용 (동영상) | JoVE Journal
Uploaded: 2024-11-01T13:20:00.000+00:00
Duration: 8 min 55 s
Description: 배우세요 DNA 바코딩 기술을 활용하여 Angelica sinensis와 같은 약용 식물을 정확하게 식별하는 방법을. 고속 분쇄 및 증폭을 통한 이 프로토콜은 품질 관리와 생물다양성 평가에 필수적인 도구를 제공합니다.

ai_agent_IP

ai_agent

maintenance

instantTrialDurationMinutes

isBiopharma

enableNewMyJoveSectionDesign

educationFeatures

seoMetaApi

ai_copilot_institution_blacklist

ai_chat_institution_blacklist

freeAccessWindow

ssoRoleCapture

scheduledMaintenanceBanner

joveLabsFeatures

disable_autoplay_for_bots

extended_trial_duration

5 minutes

<meta charset="utf8"></head><body>약용 식물을 위한 DNA 바코드: 식별 및 계통 발생 분석

<ol><li>Chen, S. L., et al. Conservation and sustainable use of medicinal plants: Problems, progress, and prospects. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=author%3aChen%2C+SL+%22Chin+Med%22">Chin Med</a>. 11, 37(2016).</li>
<li>Han, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((An+authenticity+survey+of+herbal+medicines+from+markets+in+China+using+DNA+barcoding%5BTitle%5D)+AND+%22Sci+Rep%22%5BJournal%5D)">An authenticity survey of herbal medicines from markets in China using DNA barcoding.</a> Sci Rep. 6, 18723(2016).</li>
<li>Zhang, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Integration+of+high-throughput+omics+technologies+in+medicinal+plant+research%3A+The+new+era+of+natural+drug+discovery%5BTitle%5D)+AND+%22Front+Plant+Sci%22%5BJournal%5D)">Integration of high-throughput omics technologies in medicinal plant research: The new era of natural drug discovery.</a> Front Plant Sci. 14, 1073848(2023).</li>
<li>Ji, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Determination+of+the+authenticity+and+origin+of+panax+notoginseng%3A+A+review%5BTitle%5D)+AND+%22J+AOAC+Int%22%5BJournal%5D)">Determination of the authenticity and origin of panax notoginseng: A review.</a> J AOAC Int. 105 (6), 1708-1718 (2022).</li>
<li>Parveen, I., Techen, N., Khan, I. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Identification+of+species+in+the+aromatic+spice+family+apiaceae+using+DNA+mini-barcodes%5BTitle%5D)+AND+%22Planta+Med%22%5BJournal%5D)">Identification of species in the aromatic spice family apiaceae using DNA mini-barcodes.</a> Planta Med. 85 (2), 139-144 (2019).</li>
<li>Techen, N., Parveen, I., Pan, Z., Khan, I. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((DNA+barcoding+of+medicinal+plant+material+for+identification%5BTitle%5D)+AND+%22Curr+Opin+Biotechnol%22%5BJournal%5D)">DNA barcoding of medicinal plant material for identification.</a> Curr Opin Biotechnol. 25, 103-110 (2014).</li>
<li>Xiong, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Market+access+for+Chinese+herbal+medicinal+products+in+Europe-a+ten-year+review+of+relevant+products%2C+policies%2C+and+challenges%5BTitle%5D)+AND+%22Phytomedicine%22%5BJournal%5D)">Market access for Chinese herbal medicinal products in Europe-a ten-year review of relevant products, policies, and challenges.</a> Phytomedicine. 103, 154237(2022).</li>
<li>Virk, J. K., Gupta, V., Kumar, S., Singh, R., Bansal, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Ashtawarga+plants+-+suffering+a+triple+standardization+syndrome%5BTitle%5D)+AND+%22J+Tradit+Complement+Med%22%5BJournal%5D)">Ashtawarga plants - suffering a triple standardization syndrome.</a> J Tradit Complement Med. 7 (4), 392-399 (2017).</li>
<li>An, Y. L., Wei, W. L., Guo, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Application+of+analytical+technologies+in+the+discrimination+and+authentication+of+herbs+from+fritillaria%3A+A+review%5BTitle%5D)+AND+%22Crit+Rev+Anal+Chem%22%5BJournal%5D)">Application of analytical technologies in the discrimination and authentication of herbs from fritillaria: A review.</a> Crit Rev Anal Chem. 54 (6), 1775-1796 (2024).</li>
<li>Li, M., Cao, H., But, P. P. H., Shaw, P. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Identification+of+herbal+medicinal+materials+using+DNA+barcodes%5BTitle%5D)+AND+%22J+Systemat+Evolut%22%5BJournal%5D)">Identification of herbal medicinal materials using DNA barcodes.</a> J Systemat Evolut. 49 (3), 271-283 (2011).</li>
<li>Khan, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Herbal+spices+as+food+and+medicine%3A+Microscopic+authentication+of+commercial+herbal+spices%5BTitle%5D)+AND+%22Plants+%28Basel%29%22%5BJournal%5D)">Herbal spices as food and medicine: Microscopic authentication of commercial herbal spices.</a> Plants (Basel). 13 (8), 1067(2024).</li>
<li>Techen, N., Crockett, S. L., Khan, I. A., Scheffler, B. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Authentication+of+medicinal+plants+using+molecular+biology+techniques+to+compliment+conventional+methods%5BTitle%5D)+AND+%22Curr+Med+Chem%22%5BJournal%5D)">Authentication of medicinal plants using molecular biology techniques to compliment conventional methods.</a> Curr Med Chem. 11 (11), 1391-1401 (2004).</li>
<li>Sasidharan, S., Chen, Y., Saravanan, D., Sundram, K. M., Yoga Latha, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Extraction%2C+isolation+and+characterization+of+bioactive+compounds+from+plants%27+extracts%5BTitle%5D)+AND+%22Afr+J+Tradit+Complement+Altern+Med%22%5BJournal%5D)">Extraction, isolation and characterization of bioactive compounds from plants' extracts.</a> Afr J Tradit Complement Altern Med. 8 (1), 1-10 (2011).</li>
<li>Wei, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Identification+techniques+and+detection+methods+of+edible+fungi+species%5BTitle%5D)+AND+%22Food+Chem%22%5BJournal%5D)">Identification techniques and detection methods of edible fungi species.</a> Food Chem. 374, 131803(2022).</li>
<li>Mehle, N., Trdan, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Traditional+and+modern+methods+for+the+identification+of+thrips+%28thysanoptera%29+species%5BTitle%5D)+AND+%22J+Pest+Sci%22%5BJournal%5D)">Traditional and modern methods for the identification of thrips (thysanoptera) species.</a> J Pest Sci. 85 (2), 179-190 (2012).</li>
<li>Hebert, P. D., Cywinska, A., Ball, S. L., Dewaard, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Biological+identifications+through+DNA+barcodes%5BTitle%5D)+AND+%22Proc+Biol+Sci%22%5BJournal%5D)">Biological identifications through DNA barcodes.</a> Proc Biol Sci. 270 (1512), 313-321 (2003).</li>
<li>Chen, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Validation+of+the+its2+region+as+a+novel+DNA+barcode+for+identifying+medicinal+plant+species%5BTitle%5D)+AND+%22PLoS+One%22%5BJournal%5D)">Validation of the its2 region as a novel DNA barcode for identifying medicinal plant species.</a> PLoS One. 5 (1), e8613(2010).</li>
<li>Li, D. Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Comparative+analysis+of+a+large+dataset+indicates+that+internal+transcribed+spacer+%28its%29+should+be+incorporated+into+the+core+barcode+for+seed+plants%5BTitle%5D)+AND+%22Proc+Natl+Acad+Sci+U+S+A%22%5BJournal%5D)">Comparative analysis of a large dataset indicates that internal transcribed spacer (its) should be incorporated into the core barcode for seed plants.</a> Proc Natl Acad Sci U S A. 108 (49), 19641-19646 (2011).</li>
<li>Raskoti, B. B., Ale, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((DNA+barcoding+of+medicinal+orchids+in+asia%5BTitle%5D)+AND+%22Sci+Rep%22%5BJournal%5D)">DNA barcoding of medicinal orchids in asia.</a> Sci Rep. 11 (1), 23651(2021).</li>
<li>Chen, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((DNA+barcoding+in+herbal+medicine%3A+Retrospective+and+prospective%5BTitle%5D)+AND+%22J+Pharm+Anal%22%5BJournal%5D)">DNA barcoding in herbal medicine: Retrospective and prospective.</a> J Pharm Anal. 13 (5), 431-441 (2023).</li>
<li>Pei, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Whole-genome+sequencing+in+medicinal+plants%3A+Current+progress+and+prospect%5BTitle%5D)+AND+%22Sci+China+Life+Sci%22%5BJournal%5D)">Whole-genome sequencing in medicinal plants: Current progress and prospect.</a> Sci China Life Sci. 67 (2), 258-273 (2024).</li>
<li>Zhu, S., Liu, Q., Qiu, S., Dai, J., Gao, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((DNA+barcoding%3A+An+efficient+technology+to+authenticate+plant+species+of+traditional+chinese+medicine+and+recent+advances%5BTitle%5D)+AND+%22Chin+Med%22%5BJournal%5D)">DNA barcoding: An efficient technology to authenticate plant species of traditional chinese medicine and recent advances.</a> Chin Med. 17 (1), 112(2022).</li>
<li>Pang, X., Shi, L., Song, J., Chen, X., Chen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Use+of+the+potential+DNA+barcode+its2+to+identify+herbal+materials%5BTitle%5D)+AND+%22J+Nat+Med%22%5BJournal%5D)">Use of the potential DNA barcode its2 to identify herbal materials.</a> J Nat Med. 67 (3), 571-575 (2013).</li>
<li>Ajmal Ali, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+changing+epitome+of+species+identification+-+DNA+barcoding%5BTitle%5D)+AND+%22Saudi+J+Biol+Sci%22%5BJournal%5D)">The changing epitome of species identification - DNA barcoding.</a> Saudi J Biol Sci. 21 (3), 204-231 (2014).</li>
<li>Peng, H., Chen, G., Ou, L. L., Luo, M., Zhang, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Development+of+a+new+efficient+scar+marker+for+authentication+of+Angelica+sinensis%2C+an+important+traditional+Chinese+medicine%5BTitle%5D)+AND+%22Scienceasia%22%5BJournal%5D)">Development of a new efficient scar marker for authentication of Angelica sinensis, an important traditional Chinese medicine.</a> Scienceasia. 47 (6), 751-757 (2021).</li>
<li>He, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Authentication+of+Angelica+anomala+av%C3%A9-lall+cultivars+through+DNA+barcodes%5BTitle%5D)+AND+%22Mitochondrial+DNA%22%5BJournal%5D)">Authentication of Angelica anomala avé-lall cultivars through DNA barcodes.</a> Mitochondrial DNA. 23 (2), 100-105 (2012).</li>
<li>Yuan, Q. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Identification+of+species+and+materia+medica+within+Angelica+l.+%28umbelliferae%29+based+on+phylogeny+inferred+from+DNA+barcodes%5BTitle%5D)+AND+%22Mol+Ecol+Resour%22%5BJournal%5D)">Identification of species and materia medica within Angelica l. (umbelliferae) based on phylogeny inferred from DNA barcodes.</a> Mol Ecol Resour. 15 (2), 358-371 (2015).</li>
<li>Xie, P. J., Ke, Y. T., Kuo, L. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Modified+ctab+protocols+for+high-molecular-weight+DNA+extractions+from+ferns%5BTitle%5D)+AND+%22Appl+Plant+Sci%22%5BJournal%5D)">Modified ctab protocols for high-molecular-weight DNA extractions from ferns.</a> Appl Plant Sci. 11 (3), e11526(2023).</li>
<li>Stefanova, P., Taseva, M., Georgieva, T., Gotcheva, V., Angelov, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+modified+ctab+method+for+DNA+extraction+from+soybean+and+meat+products%5BTitle%5D)+AND+%22Biotech+Biotechnol+Equipment%22%5BJournal%5D)">A modified ctab method for DNA extraction from soybean and meat products.</a> Biotech Biotechnol Equipment. 27 (3), 3803-3810 (2013).</li>
<li>Li, Z., Parris, S., Saski, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+simple+plant+high-molecular-weight+DNA+extraction+method+suitable+for+single-molecule+technologies%5BTitle%5D)+AND+%22Plant+Meth%22%5BJournal%5D)">A simple plant high-molecular-weight DNA extraction method suitable for single-molecule technologies.</a> Plant Meth. 16, 38(2020).</li>
<li>Keller, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((5.8s-28s+rrna+interaction+and+hmm-based+its2+annotation%5BTitle%5D)+AND+%22Gene%22%5BJournal%5D)">5.8s-28s rrna interaction and hmm-based its2 annotation.</a> Gene. 430 (1-2), 50-57 (2009).</li>
<li>Morgulis, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Database+indexing+for+production+megablast+searches%5BTitle%5D)+AND+%22Bioinformatics%22%5BJournal%5D)">Database indexing for production megablast searches.</a> Bioinformatics. 24 (16), 1757-1764 (2008).</li>
<li>Liao, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Global+pharmacopoeia+genome+database+is+an+integrated+and+mineable+genomic+database+for+traditional+medicines+derived+from+eight+international+pharmacopoeias%5BTitle%5D)+AND+%22Sci+China+Life+Sci%22%5BJournal%5D)">Global pharmacopoeia genome database is an integrated and mineable genomic database for traditional medicines derived from eight international pharmacopoeias.</a> Sci China Life Sci. 65 (4), 809-817 (2022).</li>
<li>Ghahramanlu, A., Rezaei, M., Heidari, P., Balandari, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Species+survey+of+iranian+barberry+genotypes+using+ITS2+sequences+and+basic+local+alignment+search+tools%5BTitle%5D)+AND+%22Erwerbs-Obstbau%22%5BJournal%5D)">Species survey of iranian barberry genotypes using ITS2 sequences and basic local alignment search tools.</a> Erwerbs-Obstbau. 65, 2491-2499 (2023).</li>
<li>Han, K., Wang, M., Zhang, L., Wang, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Application+of+molecular+methods+in+the+identification+of+ingredients+in+Chinese+herbal+medicines%5BTitle%5D)+AND+%22Molecules%22%5BJournal%5D)">Application of molecular methods in the identification of ingredients in Chinese herbal medicines.</a> Molecules. 23 (10), 2728(2018).</li>
<li>Wang, X., Liu, Y., Wang, L., Han, J., Chen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+nucleotide+signature+for+the+identification+of+Angelicae+sinensis+radix+%28danggui%29+and+its+products%5BTitle%5D)+AND+%22Sci+Rep%22%5BJournal%5D)">A nucleotide signature for the identification of Angelicae sinensis radix (danggui) and its products.</a> Sci Rep. 6, 34940(2016).</li>
<li>Chen, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((DNA+based+identification+of+medicinal+materials+in+Chinese+patent+medicines%5BTitle%5D)+AND+%22Sci+Rep%22%5BJournal%5D)">DNA based identification of medicinal materials in Chinese patent medicines.</a> Sci Rep. 2, 958(2012).</li>
<li>Hou, D. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Molecular+identification+of+corni+fructus+and+its+adulterants+by+ITS%2FITS2+sequences%5BTitle%5D)+AND+%22Chin+J+Nat+Med%22%5BJournal%5D)">Molecular identification of corni fructus and its adulterants by ITS/ITS2 sequences.</a> Chin J Nat Med. 11 (2), 121-127 (2013).</li>
<li>Han, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+short+ITS2+sequence+serves+as+an+efficient+taxonomic+sequence+tag+in+comparison+with+the+full-length+its%5BTitle%5D)+AND+%22Biomed+Res+Int%22%5BJournal%5D)">The short ITS2 sequence serves as an efficient taxonomic sequence tag in comparison with the full-length its.</a> Biomed Res Int. 2013, 741476(2013).</li>
<li>Trujillo-Argueta, S., Del Castillo, R. F., Velasco-Murguía, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Testing+the+effectiveness+of+rbcla+DNA-barcoding+for+species+discrimination+in+tropical+montane+cloud+forest+vascular+plants+%28oaxaca%2C+mexico%29+using+blast%2C+genetic+distance%2C+and+tree-based+methods%5BTitle%5D)+AND+%22PeerJ%22%5BJournal%5D)">Testing the effectiveness of rbcla DNA-barcoding for species discrimination in tropical montane cloud forest vascular plants (oaxaca, mexico) using blast, genetic distance, and tree-based methods.</a> PeerJ. 10, e13771(2022).</li>
<li>Marizzi, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((DNA+barcoding+brooklyn+%28new+york%29%3A+A+first+assessment+of+biodiversity+in+marine+park+by+citizen+scientists%5BTitle%5D)+AND+%22PLoS+One%22%5BJournal%5D)">DNA barcoding brooklyn (new york): A first assessment of biodiversity in marine park by citizen scientists.</a> PLoS One. 13 (7), e0199015(2018).</li>
<li>Antil, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((DNA+barcoding%2C+an+effective+tool+for+species+identification%3A+A+review%5BTitle%5D)+AND+%22Mol+Biol+Rep%22%5BJournal%5D)">DNA barcoding, an effective tool for species identification: A review.</a> Mol Biol Rep. 50 (1), 761-775 (2023).</li>
<li>Pang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Utility+of+the+trnh-psba+intergenic+spacer+region+and+its+combinations+as+plant+DNA+barcodes%3A+A+meta-analysis%5BTitle%5D)+AND+%22PLoS+One%22%5BJournal%5D)">Utility of the trnh-psba intergenic spacer region and its combinations as plant DNA barcodes: A meta-analysis.</a> PLoS One. 7 (11), e48833(2012).</li>
<li>Tripathi, A. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+internal+transcribed+spacer+%28its%29+region+and+trnh-psba+%5Bcorrected%5D+are+suitable+candidate+loci+for+DNA+barcoding+of+tropical+tree+species+of+India%5BTitle%5D)+AND+%22PLoS+One%22%5BJournal%5D)">The internal transcribed spacer (its) region and trnh-psba [corrected] are suitable candidate loci for DNA barcoding of tropical tree species of India.</a> PLoS One. 8 (2), e57934(2013).</li>
<li>Zheng, X. S., An, W. L., Yao, H., Xu, J., Chen, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Rapid+authentication+of+the+poisonous+plant+Gelsemium+elegans+by+combining+filter-paper-based+DNA+extraction+and+rpa-lfd+detection%5BTitle%5D)+AND+%22Engineering%22%5BJournal%5D)">Rapid authentication of the poisonous plant Gelsemium elegans by combining filter-paper-based DNA extraction and rpa-lfd detection.</a> Engineering. 7 (1), 14-16 (2021).</li>
<li>Jiang, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Barcoding+melting+curve+analysis+for+rapid%2C+sensitive%2C+and+discriminating+authentication+of+saffron+%28Crocus+sativus+l.%29+from+its+adulterants%5BTitle%5D)+AND+%22Biomed+Res+Int%22%5BJournal%5D)">Barcoding melting curve analysis for rapid, sensitive, and discriminating authentication of saffron (Crocus sativus l.) from its adulterants.</a> Biomed Res Int. 2014, 809037(2014).</li>
</ol>

<table><tbody><tr><td>CTAB 빠른 식물 게놈 DNA 추출 키트</td><td>Shanghai Huiling Biotechnology Co.</td><td>NG411M</td><td>다양한 식물의 다양한 조직에서 고품질 게놈 DNA를 신속하게 추출하는 데 적합</td></tr><tr><td>DL5000 DNA 마커</td><td>Nanjing vazyme Bio-technology Co.</td><td>MD102-02</td><td>즉시 사용 가능한 제품, 젤을 실행할 때 전기 영동을 위해 이 제품의 적당량을 직접 복용하십시오.</td></tr><tr><td>전기 영동</td><td>베이징 Liuyi 생명 공학 Co.</td><td>DYY-6C</td><td>는 터치 스크린 디자인을 채택하고 설정 전압, 설정 전류를 동시에 표시 할 수 있으며 병렬 출력</td></tr><tr><td>에틸렌 디아민 테트라 아세트산</td><td>BeijingpsaitongBiotechnologyCo., Ltd</td><td>E70015-100G</td><td>핵 절연 버퍼 제형 시약을</td></tr> 표시 할 수 있습니다.<tr><td>Goldview 핵산 겔 염색(10,000&회;)</td><td>Yisheng Biotechnology (Shanghai) Co., Ltd</td><td>10201ES03</td><td>DNA를 검출하기 위해 아가로스 젤 전기영동을 사용할 때 DNA에 결합하여 강한 형광 신호를 생성합니다.</td></tr><tr><td>고속 탁상용 원심 분리기</td>, <td>창사 하이테크 산업 개발구, Xiangyi 원심 분리기 기기 (주)</td><td>H1650</td><td>빠르고 효율적인 시료 분리를 위해 이 작고 가벼운 원심분리기는 신뢰할 수 있는 안전성을 제공합니다</td></tr><tr><td>고처리량 티슈 그라인더</td><td>Shanghai Jingxin Industrial Development Co.</td><td>Tiss-48</td><td>샘플 분쇄를 위한 고주파 진동 기기</td></tr><tr><td>http://www.gpgenome.com/</td> <td>Institute of Chinese Materia Medica, China Academy of Chinese Medical</td> <td>Sciences-HerbGenomics</td> <td>데이터베이스에는 게놈 서열, 유전자 세트, 세포 기관 게놈, 낮은 커버리지 게놈 데이터 및 DNA 바코드 서열이 포함됩니다.</td></tr><tr><td>https://www.ncbi.nlm.nih.gov/</td> <td>미국 국립 의학 도서관</td> <td>-</td> <td>국립 생명 공학 정보 센터(National Center for Biotechnology Information)는 생물 의학 및 게놈 정보에 대한 액세스를 제공하여 과학과 건강을 발전시킵니다.</td></tr><tr><td>Kylin-Bell</td><td>Haimen Qilinbel 악기 제조 유한</td><td>VORTEX-5</td><td>고속 와류의 형태로 빠른 혼합, 혼합 속도, 균일성, 철저함</td></tr><tr><td>LifeTouch</td><td>Hangzhou BORI Technology Co.</td><td>TC-96/G/H(b)B</td>: <td>전반적인 성능을 향상시키기 위해 첨단 열전 냉동 기술 및 새로 생성된 TAS 기술 채택</td></tr><tr>다기능<td>젤 이미지 분석 시스템</td><td>상하이 Tianneng Life Science Co.의 남서부 운영 센터</td><td>Tanon-Mini Space 2000</td>은 <td>증폭 조건을 매핑하기 위한 그래디언트 기능과 최대 30°C의 그래디언트 온도 범위로 신속한 유전자 증폭 실험을 수행합니다. C</td></tr><tr><td>NaCl</td><td>베이징 Solarbio 과학 및 Technology Co., Ltd. (테크놀로지 주식회사)</td><td>S8210-100</td><td>핵 분리 완충액 제형 시약.</td></tr><tr><td>Nanodrop One</td><td>유전자 회사</td><td>ND ONE</td><td>은 단 1-2 &micro로 DNA, RNA 및 단백질 샘플을 몇 초 만에 정량화합니다. 샘플</td></tr><tr><td>폴리비닐 피롤리돈</td><td>Shanghai yuanye Bio-Technology Co., Ltd</td><td>S30268-500g</td><td>핵 절연 버퍼 제형 시약의 L.</td></tr><tr><td>눈송이 제빙기</td><td>, 상하이 Zhixin Experimental Instrument Technology Co.</td><td>ZX-60X</td><td>로터리 압출 제빙 방법, 빠른 제빙 속도 및 얼음 생산의 고효율</td></tr> 채택 <tr><td>조직 균질화기</td><td>Beyotime 생명공학용 스테인리스 스틸 비드.&nbsp;</td><td>F6623</td><td>진동에 의한 조직 및 기타 샘플의 연삭 및 혼합 장비</td></tr><tr><td>Tris Acetate-EDTA buffer</td><td>Beyotime Biotech Inc</td><td>ST716</td><td>TAE는 아가로즈 젤 전기 영동에 자주 사용되는 DNA 전기 영동에 일반적으로 사용되는 완충액입니다.</td></tr><tr><td>Tris-HCl</td><td>베이징 Solarbio 과학 & Technology Co., Ltd. (테크놀로지 주식회사)</td><td>T8230</td><td>핵 절연 버퍼 제형 시약.</td></tr><tr><td>수조 주전자</td><td>Shanghai Senxin Experimental Instrument Co.</td><td>DK-8D</td><td>정밀 온도 조절기 및 온도 조절, 정확하고 신뢰할 수 있는 온도 제어</td></tr><tr><td>&beta;-메르캅토에탄올</td><td>Shanghai Eon Chemical Technology Co.</td><td>R054186-100ml&nbsp; &nbsp;</td><td>핵 분리 완충액 제형 시약.</td></tr></tbody></table>

약용 식물을 식별하기 위한 dna 바코드 적용

Application of DNA Barcoding to Identify Medicinal Plants

시료 DNA 품질
OD260/OD280 흡광도 비율의 범위는 1.80-1.84였습니다. 각 샘플에 대해 분광광도계로 측정한 DNA 양은 100ng/μL 이상이었으며(표 3) 이는 샘플 DNA 추출의 품질이 우수함을 나타냅니다. 이는 샘플이 추출 과정에서 단백질, RNA 또는 시약에 의해 오염되지 않았으며 품질이 양호하고 다운스트림 PCR 증폭에 적합함을 나타냅니다.
PCR 분석
겔 전기영동은 3개의 평행한 실험 샘플의 PCR 산물에 대해 수행하였다. 설정은 그림 3과 같이 마커, 샘플 1-3(AS-1, AS-2, AS-3) 및 음성 대조군(0)이었습니다. AS-1, AS-2, AS-3의 크기는 모두 500 bp 사이이며 단일하고 밝고 투명한 띠가 있으며 0에는 띠가 없어 추출된 DNA가 ITS2 프라이머를 사용하여 500bp로 증폭되었음을 나타냅니다.
염기서열분석 결과의 데이터베이스 비교
염기서열분석 결과, GPGD 데이터베이스의 종 식별 결과와 동일한 NCBI 데이터베이스의 BLAST 식별 결과를 결합하여 A. sinensis 를 100% 서열 유사성으로 확인하였다(표 4). BLAST 결과는 가장 높은 퍼센트 ID 점수와 가장 낮은 e-value를 사용하여 결정되었습니다. 종 식별은 가장 높은 최대 백분율 정체성이 단일 종을 포함하고 &gt;99%를 기록했을 때 성공적인 것으로 간주되었습니다. 점수가 99%≤ 경우 염기서열분석 파일의 품질 또는 PCR 산물이 오염되었는지 여부를 확인하십시오.
종 식별을 위한 계통발생 나무 기반 분석
그 결과, 구성된 NJ 계통수에서 4 종 모두가 별도의 군집에 군집되어 있었고, 외군으로서의 P. praeruptorum 은 안젤리카 군에서 분리되었습니다. 스플라이싱 서열은 A. sinensis OR879715.1 clade로 클러스터링되었고, clade 지지 값(bootstrap)은 100이었고, 다른 두 종인 A. dahurica와 A. cartilaginomarginata 는 각각 별도의 clade에 클러스터링되어 스플라이싱 서열이 A. sinensis 임을 증명했습니다(그림 4).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/66925/66925fig01.jpg"> 그림 1: 약용 식물 종 식별 흐름도. (A) 식물 가공, 약용 식물의 DNA 추출 및 염기서열 분석, (B) 데이터베이스를 사용한 종 염기서열 비교, (C) 종 간의 계통 발생 관계를 확인하기 위한 분류학적 검증을 위해 계통 발생 나무를 사용합니다. <a href="https://www.jove.com/files/ftp_upload/66925/66925fig01large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/66925/66925fig02.jpg"> 그림 2: 약용 식물 DNA 추출 워크플로우. (A) 약용 식물에서 DNA를 추출하는 데는 총 6단계가 포함됩니다. (B) PCR 기기 증폭 및 PCR 순환 공정. (C) 전기영동. (D) Sanger 염기서열분석 및 염기서열분석 크로마토그램. <a href="https://www.jove.com/files/ftp_upload/66925/66925fig02large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/66925/66925fig03.jpg"> 그림 3: Angelica sinensis (Oliv.)의 겔 전기영동 디엘스. DL5000 DNA marker를 molecular marker로 사용하여 AS-1, AS-2 및 AS-3을 샘플로 사용하고 0을 대조군으로 사용합니다. 겔 전기영동을 실시한 결과, AS-1, AS-2, AS-3 시료는 모두 500bp의 띠를 가지고 있는 반면, 대조군은 띠를 보이지 않는 것으로 나타났습니다. <a href="https://www.jove.com/files/ftp_upload/66925/66925fig03large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/66925/66925fig04.jpg"> 그림 4 : 13 개의 염기서열로 생성 된 Neighbor-Joining 계통 발생 나무. NCBI 데이터베이스에서 4종의 식물 종에서 총 10개의 염기서열을 다운로드하고, 스플라이싱 염기서열을 비교하여 종내 및 종간 염기서열 변이를 분석 및 비교하고 계통발생학적 이웃 결합 나무를 구축했습니다. <a href="https://www.jove.com/files/ftp_upload/66925/66925fig04large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td>재료/장비의 이름</td>
			<td>복용량</td>
		</tr><tr><td>폴리비닐 피롤리돈</td>
			<td>10 지</td>
		</tr><tr><td>트리스-HCl</td>
			<td>1개 M 50mL</td>
		</tr><tr><td>에틸렌디아민테트라아세트산</td>
			<td>0.5 M 20 mL</td>
		</tr><tr><td>염화나트륨</td>
			<td>20.45 지</td>
		</tr><tr><td>β-메르캅토에탄올</td>
			<td>10mL</td>
		</tr><tr><td>멸균된 탈이온수</td>
			<td>500mL</td>
		</tr></tbody></table>표 1: 핵 분리 완충액 제형 시약.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td>바코드</td>
			<td>입문서</td>
			<td colspan="2">프라이머 시퀀스(5'-3')</td>
			<td colspan="3">PCR 증폭 염기서열분석(Amplification Sequencing)</td>
		</tr><tr><td rowspan="5">그것2</td>
			<td rowspan="3">아르 자형:3R</td>
			<td colspan="2" rowspan="3">GACGCTTCTCCAGACTACAAT</td>
			<td>94°C</td>
			<td colspan="2">5분</td>
		</tr><tr><td>94°C</td>
			<td>30대</td>
			<td rowspan="3">40사이클</td>
		</tr><tr><td>56°섭씨</td>
			<td>30대</td>
		</tr><tr><td rowspan="2">F:2층</td>
			<td colspan="2" rowspan="2">ATGCGATACTTGGTGTGAAT</td>
			<td>72°C</td>
			<td>45대</td>
		</tr><tr><td>72°C</td>
			<td colspan="2">10분</td>
		</tr></tbody></table>표 2: DNA 바코드 프라이머 및 PCR 반응 조건.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td>샘플</td>
			<td>DNA 추출(ng/μL)</td>
			<td>OD260/OD280</td>
		</tr><tr><td>그대로 -1</td>
			<td>124</td>
			<td>1.84</td>
		</tr><tr><td>그대로 -2</td>
			<td>184</td>
			<td>1.81</td>
		</tr><tr><td>그대로 -3</td>
			<td>164</td>
			<td>1.82</td>
		</tr></tbody></table>표 3: Angelica sinensis (올리브) Diels는 DNA 품질을 추출했습니다.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td>샘플</td>
			<td>정렬된 시퀀스 길이(bp)</td>
			<td>접합 순서 길이(bp)</td>
			<td>GC(%)</td>
			<td>NCBI:퍼센트 BLAST(%)</td>
			<td>GPGD:퍼센트 종 식별(%)</td>
		</tr><tr><td>그대로 -1</td>
			<td>500bp</td>
			<td>229bp</td>
			<td>55.50%</td>
			<td>100%</td>
			<td>100%</td>
		</tr><tr><td>그대로 -2</td>
			<td>504bp</td>
			<td>229bp</td>
			<td>55.50%</td>
			<td>100%</td>
			<td>100%</td>
		</tr><tr><td>그대로 -3</td>
			<td>499bp</td>
			<td>229bp</td>
			<td>55.50%</td>
			<td>100%</td>
			<td>100%</td>
		</tr></tbody></table>표 4: 염기서열분석 결과의 데이터베이스 비교.

약용 식물을 식별하기 위한 DNA 바코드 적용

Medicinal plants are valuable resources globally and are used worldwide to maintain health and treat disease; however, the presence of adulteration ...

application-of-dna-barcoding-to-identify-medicinal-plants

Research

연구

JoVE Journal

Genetics

유전학

우리는 엽록체 trnL-F 스페이서 지역 내의 대상의 DNA 서열 차이의 종류를 구분하는 것이 다양한 특정 PCR primers의 직원을 고용하고 비용 효과적이고 신속한 분자 genotyping 프로토콜을...

의 야생 - 타입과 장식 품종을 구별하기 PCR 기반 Genotyping 방법 Imperata cylindrica</em

세포 생물학의 기본적인 탐구는 진핵 세포를 만드는 organelles의 신원을 기초 메커니즘을 정의하는 것입니다. 여기 형광 현미경과 차세대 시퀀싱 도구를 사용하여 식물 organelles의 형태학의 기능적인 무결성에 대한 책임 유전자를 식별하는 방법을 제안합니다.

형광 - 현미경 검사와 차세대 장면 : Organelle 무결성에 관련된 유전자의 식별을위한 유용한 도구

실시간 고해상도 질량 분석 다변량 통계 분석을 직접 분석에 의해 식물 재료의 종을 식별하는 방법이 제공된다.

실시간 고해상도 질량 분석에 직접 분석을 사용하여 식물 소재의 신속한 높은 처리량 종 확인

이 문서에서는 DNA 분리 및 매우 가난한 품질 DNA의 구조를 포함 하 여 식물 표본 상자 물자에서 높은 처리량 시퀀싱 도서관 건축을 위한 상세한 프로토콜을 보여 줍니다.

강력한 DNA 고립과 표 본관 표본에 대 한 높은 처리량 시퀀싱 도서관 건축

여기에 휴대용 qPCR 시스템을 사용하여 Matricaria chamomilla의 현장 식별을위한 프로토콜이 여기에 제시된다. 이 수행하기 쉬운 프로토콜은 농장이나 창고와 같이 실험실 장비 및 전문 지식에 대한 액세스가 제한된 위치에서 식물 종의 신원을 확인하는 방법으로 이상적입니다.

휴대용 qPCR 시스템을 이용한 마이트리카리아 샤모말라의 현장 식별

천연 제품은 신약 및 치료제 개발을 위한 유망한 출발점을 나타냅니다. 그러나, 높은 화학 다양성으로 인해, 식물에서 새로운 치료 화합물을 찾는 것은 도전적이고 시간이 많이 소요되는 작업입니다. 우리는 식물 추출물과 분획에서 항균 및 항바이오필름 분자를 식별하는 단순화된 접근법을 설명합니다.

식물의 추출물과 분획에서 새로운 항균 및 항바이오필름 분자를 식별하여 치과 용 충치를 방지하기 위한 체계적인 접근법

여기서 우리는 상피 세포 DNA에서 VNTR 궤적 D1S80을 증폭하여 DNA 지문 프로파일을 생성하는 간단한 프로토콜을 설명합니다.

실험실 클래스에서 D1S80 로커스를 사용하여 DNA 지문 응용 프로그램

현재 논문은 식물 관련 내생균의 분리, 분리물의 장기 보존, 형태학적 특성 분석 및 후속 분자 식별 및 균유전체 분석을 위한 전체 DNA 추출을 위한 상세하고 적절한 프로토콜을 제공하는 것을 목표로 합니다.

Mycoheterotrophic 식물에서 내생균 균류를 식별하기 위한 분리, 특성화 및 전체 DNA 추출

이 연구는 분자 네트워킹과 함께 2차원 고성능 액체 크로마토그래피-질량 분석법(2D-HPLC-MS) 기술을 활용하여 티베트 약용 식물 Aconitum pendulum Busch(APB)의 복잡한 화학 조성을 밝힙니다. 이 기사는 생약의 복잡한 화학 성분을 체계적으로 탐색하고 식별하기 위한 자세한 프로토콜을 제공합니다.

티베트 의학 Aconitum pendulum 의 구성 요소 식별을 위해 분자 네트워크와 결합 된 2D-HPLC-MS 기술

액체 크로마토그래피 고분해능 질량 분석법과 결합된 13C 6-Glucose 라벨링의 개발된 방법은 다재다능하며 약용 식물에서 2차 대사 산물의 합성에 관여하는 1차 장기 및 경로에 대한 향후 연구와 이러한 2차 대사 산물의 포괄적인 활용을 위한 토대를 마련합니다.

13명LC-MS와 관련된 C6-포도당 라벨링: 2차 대사산물 합성에서 식물 일차 장기 식별

배우세요 DNA 바코딩 기술을 활용하여 Angelica sinensis와 같은 약용 식물을 정확하게 식별하는 방법을. 고속 분쇄 및 증폭을 통한 이 프로토콜은 품질 관리와 생물다양성 평가에 필수적인 도구를 제공합니다.

약용 식물을 식별하기 위한 DNA 바코드 적용

더 많은 동영상 탐색