Name: 인간 모유 미생물총(Human Milk Microbiota)의 개별화된 재구성: 실제 환경에서 실현 가능한 접근 방식 (동영상) | JoVE Journal
Uploaded: 2025-02-07T14:00:00.000+00:00
Duration: 4 min 16 s
Description: 학습하세요 산모 자신의 모유 미생물총을 사용하여 저온 살균 기증 모유를 재구성하는 방법을. 이 프로토콜은 신생아의 영양 프로필을 개선하고 병원 환경에서 쉽게 적용할 수 있는 실용적인 전략을 제공합니다.

ai_agent_IP

ai_agent

maintenance

instantTrialDurationMinutes

isBiopharma

enableNewMyJoveSectionDesign

educationFeatures

seoMetaApi

ai_copilot_institution_blacklist

ai_chat_institution_blacklist

freeAccessWindow

ssoRoleCapture

scheduledMaintenanceBanner

joveLabsFeatures

disable_autoplay_for_bots

extended_trial_duration

5 minutes

<meta charset="utf8"></head><body>모유를 이용한 저온살균 기증자 모유 미생물군 복원

<ol><li>Szyller, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Bioactive+components+of+human+milk+and+their+impact+on+child%27s+health+and+development%2C+Literature+Review%5BTitle%5D)+AND+%22Nutrients%22%5BJournal%5D)">Bioactive components of human milk and their impact on child's health and development, Literature Review.</a> Nutrients. 16 (10), 1487(2024).</li>
<li>Fernández, L., Rodríguez, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Human+milk+microbiota%3A+Origin+and+potential+uses%5BTitle%5D)+AND+%22Nestle+Nutr+Inst+Workshop+Ser%22%5BJournal%5D)">Human milk microbiota: Origin and potential uses.</a> Nestle Nutr Inst Workshop Ser. 94, 75-85 (2020).</li>
<li>Fernández, L., Ruiz, L., Jara, J., Orgaz, B., Rodríguez, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Strategies+for+the+preservation%2C+restoration+and+modulation+of+the+human+milk+microbiota.+Implications+for+human+milk+banks+and+neonatal+intensive+care+units%5BTitle%5D)+AND+%22Front+Microbiol%22%5BJournal%5D)">Strategies for the preservation, restoration and modulation of the human milk microbiota. Implications for human milk banks and neonatal intensive care units.</a> Front Microbiol. 9, 2676(2018).</li>
<li>Meier, P. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((More+evidence%3A+Mothers%27+own+milk+is+personalized+medicine+for+very+low+birthweight+infants%5BTitle%5D)+AND+%22Cell+Rep+Med%22%5BJournal%5D)">More evidence: Mothers' own milk is personalized medicine for very low birthweight infants.</a> Cell Rep Med. 3 (8), 100710(2022).</li>
<li>Fewtrell, M. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Predictors+of+expressed+breast+milk+volume+in+mothers+expressing+milk+for+their+preterm+infant%5BTitle%5D)+AND+%22Arch+Dis+Child+Fetal+Neonatal+Ed%22%5BJournal%5D)">Predictors of expressed breast milk volume in mothers expressing milk for their preterm infant.</a> Arch Dis Child Fetal Neonatal Ed. 101 (6), F502-F506 (2016).</li>
<li>Abrams, S. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Donor+human+milk+for+the+high-risk+infant%3A+Preparation%2C+safety%2C+and+usage+options+in+the+United+States%5BTitle%5D)+AND+%22Pediatrics%22%5BJournal%5D)">Donor human milk for the high-risk infant: Preparation, safety, and usage options in the United States.</a> Pediatrics. 139 (1), e20163440(2017).</li>
<li>Brasil é referência em doação de leite materno. , Serviços e Informações do Brasil. At
 <a target="_blank" href="https://www.gov.br/pt-br/noticias/saude-e-vigilancia-sanitaria/2020/02/brasil-e-referencia-em-doacao-de-leite-materno">https://www.gov.br/pt-br/noticias/saude-e-vigilancia-sanitaria/2020/02/brasil-e-referencia-em-doacao-de-leite-materno</a> (2024).</li>
<li>Landers, S., Updegrove, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Bacteriological+screening+of+donor+human+milk+before+and+after+holder+pasteurization%5BTitle%5D)+AND+%22Breastfeed+Med%22%5BJournal%5D)">Bacteriological screening of donor human milk before and after holder pasteurization.</a> Breastfeed Med. 5 (3), 117-121 (2010).</li>
<li>Cacho, N. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Personalization+of+the+microbiota+of+donor+human+milk+with+mother%27s+own+milk%5BTitle%5D)+AND+%22Front+Microbiol%22%5BJournal%5D)">Personalization of the microbiota of donor human milk with mother's own milk.</a> Front Microbiol. 8, 1470(2017).</li>
<li>Pumping breast milk. , Centers for Disease Control and Prevention - CDC. 
 <a target="_blank" href="https://www.cdc.gov/nutrition/infantandtoddlernutrition/breastfeeding/pumping-breast-milk.html">https://www.cdc.gov/nutrition/infantandtoddlernutrition/breastfeeding/pumping-breast-milk.html</a> (2023).</li>
<li>Expressing and storing breast milk. , NHS UK. 
 <a target="_blank" href="https://www.nhs.uk/conditions/baby/breastfeeding-and-bottle-feeding/breastfeeding/expressing-breast-milk/">https://www.nhs.uk/conditions/baby/breastfeeding-and-bottle-feeding/breastfeeding/expressing-breast-milk/</a> (2020).</li>
<li>Arslanoglu, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Recommendations+for+the+establishment+and+operation+of+a+donor+human+milk+bank%5BTitle%5D)+AND+%22Nutr+Rev%22%5BJournal%5D)">Recommendations for the establishment and operation of a donor human milk bank.</a> Nutr Rev. 81 (Supplement_1), 1-28 (2023).</li>
<li>Moro, G. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Processing+of+donor+human+milk%3A+Update+and+recommendations+from+the+European+Milk+Bank+Association+%28EMBA%29%5BTitle%5D)+AND+%22Front+Pediatr%22%5BJournal%5D)">Processing of donor human milk: Update and recommendations from the European Milk Bank Association (EMBA).</a> Front Pediatr. 7, 49(2019).</li>
<li>Landers, S., Hartmann, B. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Donor+human+milk+banking+and+the+emergence+of+milk+sharing%5BTitle%5D)+AND+%22Pediatr+Clin+North+Am%22%5BJournal%5D)">Donor human milk banking and the emergence of milk sharing.</a> Pediatr Clin North Am. 60 (1), 247-260 (2013).</li>
<li>Stachelska, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Identification+of+Lactobacillus+delbrueckii+and+Streptococcus+thermophilus+strains+present+in+artisanal+raw+cow+milk+cheese+using+real-time+PCR+and+classic+plate+count+methods%5BTitle%5D)+AND+%22Pol+J+Microbiol%22%5BJournal%5D)">Identification of Lactobacillus delbrueckii and Streptococcus thermophilus strains present in artisanal raw cow milk cheese using real-time PCR and classic plate count methods.</a> Pol J Microbiol. 66 (4), 491-499 (2017).</li>
<li>Ruiz, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Comparison+of+two+approaches+for+the+metataxonomic+analysis+of+the+human+milk+microbiome%5BTitle%5D)+AND+%22Front+Cell+Infect+Microbiol%22%5BJournal%5D)">Comparison of two approaches for the metataxonomic analysis of the human milk microbiome.</a> Front Cell Infect Microbiol. 11, 622550(2021).</li>
<li>Lopez Leyva, L., Brereton, N. J. B., Koski, K. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Emerging+frontiers+in+human+milk+microbiome+research+and+suggested+primers+for+16S+rRNA+gene+analysis%5BTitle%5D)+AND+%22Comp+Struct+Biotechnol+J%22%5BJournal%5D)">Emerging frontiers in human milk microbiome research and suggested primers for 16S rRNA gene analysis.</a> Comp Struct Biotechnol J. 19, 121-133 (2021).</li>
<li>Bolger, A. M., Lohse, M., Usadel, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Trimmomatic%3A+A+flexible+trimmer+for+Illumina+sequence+data%5BTitle%5D)+AND+%22Bioinformatics%22%5BJournal%5D)">Trimmomatic: A flexible trimmer for Illumina sequence data.</a> Bioinformatics. 30 (15), 2114-2120 (2014).</li>
<li>Bolyen, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((interactive%2C+scalable+and+extensible+microbiome+data+science+using+QIIME+2%5BTitle%5D)+AND+%22Nat+Biotechnol%22%5BJournal%5D)">interactive, scalable and extensible microbiome data science using QIIME 2.</a> Nat Biotechnol. 37 (8), 852-857 (2019).</li>
<li>McMurdie, P. J., Holmes, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((phyloseq%3A+An+R+package+for+reproducible+iInteractive+analysis+and+graphics+of+microbiome+census+data%5BTitle%5D)+AND+%22PLoS+ONE%22%5BJournal%5D)">phyloseq: An R package for reproducible iInteractive analysis and graphics of microbiome census data.</a> PLoS ONE. 8 (4), e61217(2013).</li>
<li>R Core Team. R: A language and environment for statistical computing. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=%22R+Foundation+for+Statistical+Computing%22">R Foundation for Statistical Computing</a>. , R Foundation for Statistical Computing. Vienna, Austria. https://www.R-project.org/ (2024).</li>
<li>Torrez Lamberti, M. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Metabolomic+profile+of+personalized+donor+human+milk%5BTitle%5D)+AND+%22Molecules%22%5BJournal%5D)">Metabolomic profile of personalized donor human milk.</a> Molecules. 25 (24), 5783(2020).</li>
<li>Mallardi, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Inoculation+of+mother%27s+own+milk+could+personalize+pasteurized+donor+human+milk+used+for+feeding+preterm+infants%5BTitle%5D)+AND+%22J+Transl+Med%22%5BJournal%5D)">Inoculation of mother's own milk could personalize pasteurized donor human milk used for feeding preterm infants.</a> J Transl Med. 19 (1), 420(2021).</li>
</ol>

<table><tbody><tr><td>전기 모유 펌프</td><td>Horigen</td><td>XN-2219M2</td><td>소프트 펌프 듀얼 플러스</td></tr><tr><td>Pyrex&nbsp; 미디어 병</td><td>코닝&nbsp;</td><td>CLS1395100</td><td>플라스틱 뚜껑이 있는 유리 용기&nbsp;</td></tr><tr><td>1000 &마이크로; L 피펫 Labmate 프로</td><td>코닝 HTL SA&nbsp; &nbsp;</td><td>5666</td><td>가변 볼륨 피펫터&nbsp;</td></tr><tr><td>극저온 바이알&nbsp;</td><td>코닝&nbsp;</td><td>CLS431417</td><td>DNase/RNase-free 2 mL 바이알&nbsp;</td></tr><tr><td>15 mL 원심분리기 튜브</td><td>Corning&nbsp;</td><td>CLS431470</td><td>DNase/RNase-free 15 mL 튜브&nbsp;</td></tr><tr><td>수조</td><td>EcoSonics</td><td>Q3.0/40A</td><td></td></tr><tr><td>Man&ndash; 로고사&ndash; 샤프(MRS)&nbsp;</td><td>Difco</td><td>288210</td><td>유산균 성장 매체</td></tr><tr><td>Mannitol Salt Agar (MSA)</td><td>Himedia</td><td>MH118</td><td>Staphylococcus&nbsp; 성장 매체</td></tr><tr><td>Anaerobic Jar</td><td>Permution</td><td></td><td>은 유산 박테리아 성장을 위한 저산소 환경을 만듭니다</td></tr>. 추출물<tr><td>a&nbsp; 키트 &ndash; DNA e RNA</td><td>Loccus</td><td>MPTA-PV16-B Y</td><td>DNA 추출 키트</td></tr><tr><td>Nanodrop</td><td>Promega</td><td>E6150</td><td>Quantus DNA</td></tr><tr><td>GoTaqG2</td><td>Promega</td><td>M7841</td><td>PCR 증폭 시스템</td></tr><tr><td>Quantus 형광계</td><td>Promega</td><td>E5150</td><td>DNA/RNA 정량 키트</td></tr><tr><td>MiSeq 시스템</td><td>Illumina Inc.</td><td>M-GL-00006 v4.0</td><td>염기서열분석 장비</td></tr><tr><td>MiSeq 시약 키트 v2 (300-사이클)</td><td>Illumina Inc.</td><td>MS-102-2002</td><td>염기서열분석 키트 및 시약</td></tr><tr><td>소프트웨어 이름&nbsp; </td><td></td><td></td><td></td></tr><tr><td>Trimmomatic</td><td>http://www.usadellab.org/cms/index.php?page=trimmomatic</td><td></td><td>Illumina NGS 데이터 QIIME 2를 위한 읽기 트리밍 도구</td></tr><tr><td>&nbsp;</td><td>https://docs.qiime2.org/2024.10/</td><td></td> <td>마이크로바이옴 분석 패키지&nbsp;</td></tr><tr><td>Primer 이름</td><td>Primer sequence</td><td></td><td></td></tr><tr><td>16S_357F&nbsp;</td><td>TCGTCGGCAGCGTCAGA TGTGTATAAGAGACAGC CTACGGGNGGCWGCAG</td><td></td><td></td></tr><tr><td>16S_805R</td><td>GTCTCGTGGGCTCGGAG ATGTGTGTATAAGAGACAGG ACTACHVGGGTATCTAATC</td><td></td><td></td></tr></tbody></table>

인간 모유 미생물총(human milk microbiota)의 개별화된 재구성: 실제 환경에서 실현 가능한 접근 방식

Individualized Reconstitution of Human Milk Microbiota: A Feasible Approach in Real-World Settings

플레이트 배양에 의한 박테리아 성장 분석 Cacho et al.9이 제안한 바와 같이 MOM을 PDM에 접종하는 방법을 검증하기 위해 수행된 미생물 검사는 CFU/mL 수를 기반으로 4시간 배양 전과 후에 접종된 우유 샘플 간에 유의미한 차이가 없음을 입증했습니다. 그러나 이 두 시점에서 콜로니 수의 차이가 관찰되었으며, 이는 포도상구균 종(Staphylococcus spp.)에 대한 MSA(그림 1A) 및 젖산 박테리아(LAB)에 대한 MRS 배지(LAB)에서 배양 중 박테리아 성장을 나타냅니다(그림 1B). 예상대로 PDM 샘플에서는 박테리아 성장이 나타나지 않아 저온 살균 공정의 효과를 확인할 수 있었습니다.
<p class="jove_content biglegend" fo:keep-together.within-pag...

인간 모유 미생물총(Human Milk Microbiota)의 개별화된 재구성: 실제 환경에서 실현 가능한 접근 방식

Mother&#39;s own milk (MOM) is the most complete nutritional resource for newborns. In cases where mothers are unable to produce sufficient milk or cannot ...

individualized-reconstitution-human-milk-microbiota-feasible-approach

Research

연구

JoVE Journal

Medicine

의학

새로운 박테리아 종균 배양의 도움으로 프로바이오틱 발효 유제품 음료의 소규모 생산을 위한 생산 프로토콜이 설명되어 있습니다.

생균제 발효 식품의 소규모 제조를위한 신규 생산 프로토콜

이 프로토콜에서는 쥐에서 우유를 수집 하는 효율적인 방법 뿐만 아니라 신생아 마우스 또는 조 인간의 창 자에서 enteroid 문화 시스템을 설정 하는 방법을 설명 합니다.

유 방 우유 Enteroids의 성장을 강화: 세포 증식의 Ex Vivo 모델

반자동된 워크플로 인간 우유와 다른 낮은 바이오 매스 샘플 종류에서 16S rRNA의 타겟된 시퀀싱에 대 한 제공 됩니다.

인간의 우유 샘플의 타겟된 16S 시퀀싱 하는 방법

여기, 선물이 위장 장 관의 생리 조건을 시뮬레이션 bioreactors의 시리즈를 사용 하 여 콜론 생체 외에서, 의 본질적인 microbiota 경작을 위한 프로토콜.

인간의 본질적인 Microbiota 공부 기술을 경작 하는 체 외에서 고급 적용

이 프로토콜은 인체 배설물 미생물의 체외 배치 배양 발효 시스템을 설명하며, 이눌린(잘 알려진 프리바이오틱 및 가장 널리 연구된 미생물 변조기 중 하나)을 사용하여 특정 한 효과의 효과를 추정하는 데 이 시스템의 사용을 입증합니다. 대변 미생물 구성 및 대사 활동에 대한 개입.

인체 배설물 미생물에 대한 중재 식이요법의 효과를 추정하는 시험관 내 배치 배양 모델

이 프로토콜은 고순도의 인간 모유에서 세포외 소포를 신속하게 분리하고 효과적으로 분리할 수 있도록 설계되었습니다.

인간 모유 유래 세포외 소포의 신속한 분리

이 프로토콜은 무균 마우스를 실험용 단일 케이지 아이솔레이터(isocage)로 옮기고 수용하는 동시에 멸균 상태를 유지하기 위한 모범 사례를 설명합니다. 무균 마우스에 대변 이식 방법과 추가 적용을 위해 이러한 장내 "인간화된" 마우스에서 생존 가능한 박테리아를 수집하는 방법에 대해 논의합니다.

무균 마우스에 인간 배설물 이식을 위한 Bioexclusion IsoPositive 케이지 실험의 준비 및 유지 관리

MBRA(Minibioreactor Array)는 복잡한 미생물 군집의 배양을 가능하게 하는 고처리량, 맞춤형 연속 흐름 배양 시스템으로, 마이크로바이옴 역학, 치료 상호 작용 및 환경 요인에 대한 미생물 반응을 연구하기 위한 병렬 실험을 지원합니다.

Minibioreactor Array(MBRA)의 조립 및 사용을 위한 업데이트된 프로토콜

이 프로토콜은 배양체학과 MALDI-TOF MS를 결합하여 유제품의 미생물 구성을 신속하고 비용 효율적으로 평가할 수 있습니다. 기존 배양 방법보다 짧은 처리 시간으로 16S rRNA 시퀀싱에 필적하는 분류 결과를 제공합니다.

MALDI 접근법 을 통한 박테리아 단백질체학 프로파일링을 이용한 낙농장의 미생물 안전성 평가

폐 재활 널리 호흡기 질환의 관리에 인식하고 있습니다. 성공적으로 폐 재활의 핵심 구성 요소는 권장되는 운동 훈련을 준수합니다. 본 프로토콜의 목적은 연속 데이터 추적 기술이 정확하게 소정 호기성 훈련 강도에 부착을 측정하는 데 사용될 수있는 방법을 설명하는 것이다.

폐 재활 운동 준수를 연구하는 지속적인 데이터 추적 기술을 사용하여

학습하세요 산모 자신의 모유 미생물총을 사용하여 저온 살균 기증 모유를 재구성하는 방법을. 이 프로토콜은 신생아의 영양 프로필을 개선하고 병원 환경에서 쉽게 적용할 수 있는 실용적인 전략을 제공합니다.

인간 모유 미생물총(Human Milk Microbiota)의 개별화된 재구성: 실제 환경에서 실현 가능한 접근 방식

더 많은 동영상 탐색