ai_agent_IP

ai_agent

maintenance

instantTrialDurationMinutes

isBiopharma

enableNewMyJoveSectionDesign

educationFeatures

seoMetaApi

ai_copilot_institution_blacklist

ai_chat_institution_blacklist

freeAccessWindow

ssoRoleCapture

scheduledMaintenanceBanner

joveLabsFeatures

disable_autoplay_for_bots

extended_trial_duration

5 minutes

<ol><li>Global, regional, and national burden of rheumatoid arthritis, 1990-2020, and projections to 2050: A systematic analysis of the global burden of disease study. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=%22Lancet+Rheumatol%22">Lancet Rheumatol</a>. 5 (10), e594-e610 (2021).</li>
<li>Radu, A. F., Bungau, S. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Management+of+rheumatoid+arthritis%3A+An+overview%5BTitle%5D)+AND+%22Cells%22%5BJournal%5D)">Management of rheumatoid arthritis: An overview.</a> Cells. 10 (11), 2857(2021).</li>
<li>Di Matteo, A., Bathon, J. M., Emery, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Rheumatoid+arthritis%5BTitle%5D)+AND+%22Lancet%22%5BJournal%5D)">Rheumatoid arthritis.</a> Lancet. 402 (10416), 2019-2033 (2023).</li>
<li>Bernard, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Management+of+patients+with+rheumatoid+arthritis+by+telemedicine%3A+Connected+monitoring.+A+randomized+controlled+trial%5BTitle%5D)+AND+%22Joint+Bone+Spine%22%5BJournal%5D)">Management of patients with rheumatoid arthritis by telemedicine: Connected monitoring. A randomized controlled trial.</a> Joint Bone Spine. 89 (5), 105368(2022).</li>
<li>Jang, S., Kwon, E. J., Lee, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Rheumatoid+arthritis%3A+Pathogenic+roles+of+diverse+immune+cells%5BTitle%5D)+AND+%22Int+J+Mol+Sci%22%5BJournal%5D)">Rheumatoid arthritis: Pathogenic roles of diverse immune cells.</a> Int J Mol Sci. 23 (2), 905(2022).</li>
<li>Daikh, D. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Rheumatoid+arthritis%3A+Evolving+recognition+of+a+common+disease%5BTitle%5D)+AND+%22Best+Pract+Res+Clin+Rheumatol%22%5BJournal%5D)">Rheumatoid arthritis: Evolving recognition of a common disease.</a> Best Pract Res Clin Rheumatol. 36 (1), 101740(2022).</li>
<li>Bhamidipati, K., Wei, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Precision+medicine+in+rheumatoid+arthritis%5BTitle%5D)+AND+%22Best+Pract+Res+Clin+Rheumatol%22%5BJournal%5D)">Precision medicine in rheumatoid arthritis.</a> Best Pract Res Clin Rheumatol. 36 (1), 101742(2022).</li>
<li>Meyer, A., Parmar, P. J., Shahrara, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Significance+of+IL-7+and+IL-7R+in+RA+and+autoimmunity%5BTitle%5D)+AND+%22Autoimmun+Rev%22%5BJournal%5D)">Significance of IL-7 and IL-7R in RA and autoimmunity.</a> Autoimmun Rev. 21 (7), 103120(2022).</li>
<li>Yu, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Synergistic+induction+of+CCL5%2C+CXCL9+and+CXCL10+by+IFN-%CE%B3+and+NLRS+ligands+on+human+fibroblast-like+synoviocytes-a+potential+immunopathological+mechanism+for+joint+inflammation+in+rheumatoid+arthritis%5BTitle%5D)+AND+%22Int+Immunopharmacol%22%5BJournal%5D)">Synergistic induction of CCL5, CXCL9 and CXCL10 by IFN-γ and NLRS ligands on human fibroblast-like synoviocytes-a potential immunopathological mechanism for joint inflammation in rheumatoid arthritis.</a> Int Immunopharmacol. 82, 106356(2020).</li>
<li>Wu, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Single-cell+sequencing+of+immune+cells+from+anticitrullinated+peptide+antibody+positive+and+negative+rheumatoid+arthritis%5BTitle%5D)+AND+%22Nat+Commun%22%5BJournal%5D)">Single-cell sequencing of immune cells from anticitrullinated peptide antibody positive and negative rheumatoid arthritis.</a> Nat Commun. 12 (1), 4977(2021).</li>
<li>Wei, X., Niu, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((T+follicular+helper+cells+in+autoimmune+diseases%5BTitle%5D)+AND+%22J+Autoimmun%22%5BJournal%5D)">T follicular helper cells in autoimmune diseases.</a> J Autoimmun. 134, 102976(2023).</li>
<li>Mcelwee, M. K., Dileepan, T., Mahmud, S. A., Jenkins, M. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+CD4%2B+T+cell+repertoire+specific+for+citrullinated+peptides+shows+evidence+of+immune+tolerance%5BTitle%5D)+AND+%22J+Exp+Med%22%5BJournal%5D)">The CD4+ T cell repertoire specific for citrullinated peptides shows evidence of immune tolerance.</a> J Exp Med. 220 (12), e20230209(2023).</li>
<li>Ahmed, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Dual+inhibition+of+glycolysis+and+glutaminolysis+for+synergistic+therapy+of+rheumatoid+arthritis%5BTitle%5D)+AND+%22Arthritis+Res+Ther%22%5BJournal%5D)">Dual inhibition of glycolysis and glutaminolysis for synergistic therapy of rheumatoid arthritis.</a> Arthritis Res Ther. 25 (1), 176(2023).</li>
<li>Wu, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Tnf+antagonist+sensitizes+synovial+fibroblasts+to+ferroptotic+cell+death+in+collagen-induced+arthritis+mouse+models%5BTitle%5D)+AND+%22Nat+Commun%22%5BJournal%5D)">Tnf antagonist sensitizes synovial fibroblasts to ferroptotic cell death in collagen-induced arthritis mouse models.</a> Nat Commun. 13 (1), 676(2022).</li>
<li>Huo, F., Hou, J., Zhu, Y., Feng, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((ferroptosis+inducer+ike+ameliorate+pulmonary+fibrosis+in+collagen-induced+arthritis+%28CIA%29+mice+via+decreasing+the+expression+of+IL-6%2C+CCL5+and+CXCL9%5BTitle%5D)+AND+%22Xi+Bao+Yu+Fen+Zi+Mian+Yi+Xue+Za+Zhi%22%5BJournal%5D)">ferroptosis inducer ike ameliorate pulmonary fibrosis in collagen-induced arthritis (CIA) mice via decreasing the expression of IL-6, CCL5 and CXCL9.</a> Xi Bao Yu Fen Zi Mian Yi Xue Za Zhi. 40 (2), 114-120 (2024).</li>
<li>Sun, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((ID2+exacerbates+the+development+of+rheumatoid+arthritis+by+increasing+IFN-%CE%B3+production+in+CD4%2B+T+cells%5BTitle%5D)+AND+%22Clin+Transl+Med%22%5BJournal%5D)">ID2 exacerbates the development of rheumatoid arthritis by increasing IFN-γ production in CD4+ T cells.</a> Clin Transl Med. 15 (3), e70242(2025).</li>
<li>Murayama, M. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CTRP6+is+an+endogenous+complement+regulator+that+can+effectively+treat+induced+arthritis%5BTitle%5D)+AND+%22Nat+Commun%22%5BJournal%5D)">CTRP6 is an endogenous complement regulator that can effectively treat induced arthritis.</a> Nat Commun. 6, 8483(2015).</li>
<li>Kadura, S., Raghu, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Rheumatoid+arthritis-interstitial+lung+disease%3A+Manifestations+and+current+concepts+in+pathogenesis+and+management%5BTitle%5D)+AND+%22Eur+Respir+Rev%22%5BJournal%5D)">Rheumatoid arthritis-interstitial lung disease: Manifestations and current concepts in pathogenesis and management.</a> Eur Respir Rev. 30 (160), 210011(2021).</li>
<li>Mueller, A. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Recent+advances+in+understanding+the+pathogenesis+of+rheumatoid+arthritis%3A+New+treatment+strategies%5BTitle%5D)+AND+%22Cells%22%5BJournal%5D)">Recent advances in understanding the pathogenesis of rheumatoid arthritis: New treatment strategies.</a> Cells. 10 (11), 3017(2021).</li>
<li>Sun, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Gut+commensal+parabacteroides+distasonis+alleviates+inflammatory+arthritis%5BTitle%5D)+AND+%22Gut%22%5BJournal%5D)">Gut commensal parabacteroides distasonis alleviates inflammatory arthritis.</a> Gut. 72 (9), 1664-1677 (2023).</li>
<li>Li, Z. Y., Zhou, J. J., Luo, C. L., Zhang, L. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Activation+of+tgr5+alleviates+inflammation+in+rheumatoid+arthritis+peripheral+blood+mononuclear+cells+and+in+mice+with+collagen+II-induced+arthritis%5BTitle%5D)+AND+%22Mol+Med+Rep%22%5BJournal%5D)">Activation of tgr5 alleviates inflammation in rheumatoid arthritis peripheral blood mononuclear cells and in mice with collagen II-induced arthritis.</a> Mol Med Rep. 20 (5), 4540-4550 (2019).</li>
<li>Mccarthy, E. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Endogenous+antigens+shape+the+transcriptome+and+TCR+repertoire+in+an+autoimmune+arthritis+model%5BTitle%5D)+AND+%22J+Clin+Invest%22%5BJournal%5D)">Endogenous antigens shape the transcriptome and TCR repertoire in an autoimmune arthritis model.</a> J Clin Invest. 135 (2), e174647(2024).</li>
<li>Chen, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Annexin+A1+attenuates+cardiac+diastolic+dysfunction+in+mice+with+inflammatory+arthritis%5BTitle%5D)+AND+%22Proc+Natl+Acad+Sci+U+S+A%22%5BJournal%5D)">Annexin A1 attenuates cardiac diastolic dysfunction in mice with inflammatory arthritis.</a> Proc Natl Acad Sci U S A. 118 (38), e2020385118(2021).</li>
<li>Owada, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((LAT1-specific+inhibitor+ameliorates+severe+autoimmune+arthritis+in+skg+mouse%5BTitle%5D)+AND+%22Int+Immunopharmacol%22%5BJournal%5D)">LAT1-specific inhibitor ameliorates severe autoimmune arthritis in skg mouse.</a> Int Immunopharmacol. 109, 108817(2022).</li>
<li>Zhang, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Nrf2+activation+improves+experimental+rheumatoid+arthritis%5BTitle%5D)+AND+%22Free+Radic+Biol+Med%22%5BJournal%5D)">Nrf2 activation improves experimental rheumatoid arthritis.</a> Free Radic Biol Med. 207, 279-295 (2023).</li>
<li>Sakaguchi, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Altered+thymic+T-cell+selection+due+to+a+mutation+of+the+ZAP-70+gene+causes+autoimmune+arthritis+in+mice%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">Altered thymic T-cell selection due to a mutation of the ZAP-70 gene causes autoimmune arthritis in mice.</a> Nature. 426 (6965), 454-460 (2003).</li>
<li>Van Hees, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((New+approaches+to+moderate+CRISPR-Cas9+activity%3A+Addressing+issues+of+cellular+uptake+and+endosomal+escape%5BTitle%5D)+AND+%22Mol+Ther%22%5BJournal%5D)">New approaches to moderate CRISPR-Cas9 activity: Addressing issues of cellular uptake and endosomal escape.</a> Mol Ther. 30 (1), 32-46 (2022).</li>
<li>Tyumentseva, M., Tyumentsev, A., Akimkin, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CRISPR%2FCas9+landscape%3A+Current+state+and+future+perspectives%5BTitle%5D)+AND+%22Int+J+Mol+Sci%22%5BJournal%5D)">CRISPR/Cas9 landscape: Current state and future perspectives.</a> Int J Mol Sci. 24 (22), 16077(2023).</li>
<li>Wu, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((B+cells+in+rheumatoid+arthritis%3A+pathogenic+mechanisms+and+treatment+prospects%5BTitle%5D)+AND+%22Front+Immunol%22%5BJournal%5D)">B cells in rheumatoid arthritis: pathogenic mechanisms and treatment prospects.</a> Front Immunol. 12, 750753(2021).</li>
<li>Dunlap, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Clonal+associations+between+lymphocyte+subsets+and+functional+states+in+rheumatoid+arthritis+synovium%5BTitle%5D)+AND+%22Nat+Commun%22%5BJournal%5D)">Clonal associations between lymphocyte subsets and functional states in rheumatoid arthritis synovium.</a> Nat Commun. 15 (1), 4991(2024).</li>
<li>Okamoto, K., Takayanagi, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Effect+of+T+cells+on%5BTitle%5D)+AND+%22Bone%22%5BJournal%5D)">Effect of T cells on.</a> Bone. 168, 116675(2023).</li>
<li>Wang, X. Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Dopamine+D2+receptor+on+CD4%2B+T+cells+is+protective+against+inflammatory+responses+and+signs+in+a+mouse+model+of+rheumatoid+arthritis%5BTitle%5D)+AND+%22Arthritis+Res+Ther%22%5BJournal%5D)">Dopamine D2 receptor on CD4+ T cells is protective against inflammatory responses and signs in a mouse model of rheumatoid arthritis.</a> Arthritis Res Ther. 25 (1), 87(2023).</li>
<li>Wang, X. Q., Liu, Y., Cai, H. H., Peng, Y. P., Qiu, Y. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Expression+of+tyrosine+hydroxylase+inCD4%2B+T+cells+contributes+to+alleviation+of+Th17%2FTreg+imbalance+in+collagen-induced+arthritis%5BTitle%5D)+AND+%22Exp+Biol+Med+%28Maywood%29%22%5BJournal%5D)">Expression of tyrosine hydroxylase inCD4+ T cells contributes to alleviation of Th17/Treg imbalance in collagen-induced arthritis.</a> Exp Biol Med (Maywood). 241 (18), 2094-2103 (2016).</li>
<li>Anaparti, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Increased+frequency+of+TIGIT%2B+CD4+T+cell+subset+in+autoantibody-positive+first-degree+relatives+of+patients+with+rheumatoid+arthritis%5BTitle%5D)+AND+%22Front+Immunol%22%5BJournal%5D)">Increased frequency of TIGIT+ CD4 T cell subset in autoantibody-positive first-degree relatives of patients with rheumatoid arthritis.</a> Front Immunol. 13, 932627(2022).</li>
<li>Lei, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Synovial+microenvironment-influenced+mast+cells+promote+the+progression+of+rheumatoid+arthritis%5BTitle%5D)+AND+%22Nat+Commun%22%5BJournal%5D)">Synovial microenvironment-influenced mast cells promote the progression of rheumatoid arthritis.</a> Nat Commun. 15 (1), 113(2024).</li>
<li>Jinno, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Comparison+of+retention+of+biologics+in+Japanese+patients+with+elderly-onset+rheumatoid+arthritis-the+answer+cohort+study%5BTitle%5D)+AND+%22Rheumatology+%28Oxford%29%22%5BJournal%5D)">Comparison of retention of biologics in Japanese patients with elderly-onset rheumatoid arthritis-the answer cohort study.</a> Rheumatology (Oxford). 64 (2), 509-516 (2025).</li>
<li>Hagert, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Rapid+spread+of+mannan+to+the+immune+system%2C+skin+and+joints+within+6+hours+after+local+exposure%5BTitle%5D)+AND+%22Clin+Exp+Immunol%22%5BJournal%5D)">Rapid spread of mannan to the immune system, skin and joints within 6 hours after local exposure.</a> Clin Exp Immunol. 196 (3), 383-391 (2019).</li>
<li>Cheng, W. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Deer+velvet+antler+extracts+exert+anti-inflammatory+and+anti-arthritic+effects+on+human+rheumatoid+arthritis+fibroblast-like+synoviocytes+and+distinct+mouse+arthritis%5BTitle%5D)+AND+%22Am+J+Chin+Med%22%5BJournal%5D)">Deer velvet antler extracts exert anti-inflammatory and anti-arthritic effects on human rheumatoid arthritis fibroblast-like synoviocytes and distinct mouse arthritis.</a> Am J Chin Med. 50 (6), 1617-1643 (2022).</li>
</ol>

<table><tbody><tr><td>Agarose</td><td>Yeasen</td><td>10208ES60</td><td>DNA 전기영동 실험에 사용하기 위한 아가로스 겔 준비</td></tr><tr><td>무수 에탄올</td><td>Shanghai HuShi Laboratory Instruments Co., Ltd.</td><td>100009218</td><td>탈수 및 고정제</td></tr><tr><td>ZAP 70 프라이머</td><td>Tsingke</td> 유<td>전자 발현을 검출하는 데 사용되는 Tsingke 프라이머, 마우스 유전형 분석을 위한 PCR 실험에 일반적으로 사용됩니다</td>. 0.5M EDTA 용액(pH = 7.4)Biosharp R00521 조직의 구조적 무결성을 유지하면서 칼슘 함유 조직의 조직 절편 및 염색의 품질을 보장하기 위해 석회질을 제거하는 데 사용됩니다.<td></td></tr><tr><td></td><td></td><td></td><td></td></tr><tr><td>1.5 mL 효소가 없는 ep 튜브</td><td>LABSELECT</td><td>MCT-001-150-S</td><td>시료 보관, 원심 분리 등과 같은 다양한 실험에 사용</td></tr><tr><td>2x Q3 SYBR qPCR 마스터 믹스 (범용)</td><td>ToloBio</td><td>22204</td><td>매우 특이적이고 고감도의 qPCR 반응을 수행하는 데 사용됩니다.</td></tr><tr><td>2x Magic Green Taq SuperMix</td><td>TOLOBIO</td><td>21502-04</td><td>전기 영동 전 완충액</td></tr><tr><td>4% 포름알데히드(파라포름알데히드) 용액</td><td>Biosharp</td><td>BL539A</td><td>조직 구조 및 세포 형태를 보존하기 위한 고정제로 사용되어 후속 염색 단계를 위해 안정적이고 잘 보존된 샘플을 제공합니다</td></tr><tr><td>. 동물 조직/세포 총 RNA 분리 키트</td><td>Servicebio</td><td>MPC2409122</td><td>동물 조직/세포에서 총 RNA 추출</td></tr><tr><td>BD 세포 측정 비드 어레이(CBA) 마우스 Th1/Th2/Th17 사이토카인 키트</td><td>BD Biosciences</td><td>560485</td><td>마우스 혈청에서 Th1/2/17 사이토카인의 발현을 측정합니다.</td></tr><tr><td>세포 배양 접시</td><td>LABSELECT</td><td>12211</td><td>비장 및 림프절의 세포액 용기</td></tr><tr><td>디메틸벤젠</td><td>China National Pharmaceutical Group Chemical Reagents Co., Ltd.</td><td>10023418</td><td>탈파핀화 및 투명제로 사용</td></tr><tr><td>Easyfive 6포트 세포 계수 챔버</td><td>CytoEasy</td><td>N3EF110</td> 연골용 세포 <td>계수에 사용됩니다</td></tr>.<tr><td></td><td>Solarbio</td><td>G1371</td><td>관절 부위의 병리학적 변화를 관찰하기 위해 연골 및 뼈 조직을 염색합니다.</td></tr><tr><td>유리 슬라이드</td><td>CITOTEST</td><td>188105</td><td>조직 슬라이싱 헤</td></tr><tr><td>마트실린 염색 용액</td>에 대한 기본 지원 <td>Servicebio</td><td>G1005-1</td><td>죽어가는</td></tr><tr><td>헤마톡실린 염색 용액</td><td>Servicebio</td><td>G1001</td><td>죽어가는</td></tr><tr><td>저속 냉동 원심분리기</td><td>Cence</td><td>F14300021010004</td><td>원심분리 및 침전에 사용됩니다</td></tr> 만<tr><td>난</td><td>시그마</td><td>모델용 m7504</td><td>액티베이터. 멸균 PBS에 2 mg/mL로 용해하고 완전히 혼합한 다음 0.22 & M 멤브레인을 사용하여 입자 또는 가능한 오염원을 제거합니다.</td></tr><tr><td>MojoSort Magnet</td><td>Biolengend</td><td>480019</td><td>쥐의 비장, 림프절에서 CD4+ T 세포를 분리 및 정제하는 데 사용됩니다.</td></tr><tr><td>MojoSort Mouse CD4 T 세포 분리 키트</td><td>Biolengend</td><td>480033</td><td>쥐의 비장, 림프절에서 CD4+ T 세포를 분리 및 정제하는 데 사용됩니다. CD4 분자에 직접 결합하여 CD4+ T 세포를 분리하는 음성 선택 방법을 사용하여 CD4 분자 기능에 영향을 주지 않고 표면 항원의 무결성을 보존하여 CD4+ T 세포 주입 실험에 적합합니다.</td></tr><tr><td>Nano-300</td><td>ALLSHENG</td><td>AS-11020-00</td><td>핵산, 단백질 및 세포 용액의 정확한 검출</td></tr><tr><td>중성 수지 마운팅제</td><td>Biosharp</td><td>BL704A</td><td>염색된 조직 절편 고정 및 보존</td></tr><tr><td>파라핀 미크로톰</td><td>KEDEE KEDEE</td><td>KD-3389</td><td>파라핀 절편에 사용</td></tr> 인<tr><td>산염 완충 식염수(PBS)Pricella</td><td></td> <td>WHB824P281</td><td>완충액으로 사용 용매 또는 세척제,</td></tr> <tr><td>멸균 셀 필터(70 & micro; m)</td><td>Biosharp</td><td>BS-70-CS</td><td>세포 현탁액에서 큰 불순물 또는 응집된 세포 클러스터를 제거하여 샘플 순도 및 세포 균일성 보장</td></tr><tr><td>멸균 주사기(1mL)</td><td>Lingyang Medical Apparatus</td><td>20241020</td><td>내안각 정맥에 주입</td></tr><tr><td>탁상용 고속 미세 냉장 원심분리기</td><td>SCILOGEX</td><td>S1010E</td><td>원심분리 및 침전에 사용</td></tr><tr><td>TEA 완충액(50x)</td><td>Yeasen</td><td>60116ES76</td><td>pH를 안정화하고 DNA 및 RNA와 같은 분자를 보호 및 보존하는 데 도움이 되며 전기영동 실험에 사용됩니다</td></tr>. <tr><td>ToloScript qPCR용 올인원 RT EasyMix</td><td>ToloBio</td><td>22107</td><td>RNA 주형을 cDNA로 변환하는 데 사용되어 후속 유전자 발현 분석, qPCR 및 기타 분자 생물학 실험을 용이하게 합니다.</td></tr><tr><td>트랜스퍼 피펫</td><td>BIOFIL</td><td>240515-133-A</td><td>용액 이송에 사용</td></tr> 트리<tr><td>판 블루 염료 용액</td><td>Biosharp</td><td>7009529</td><td>일반적으로 세포 생존율 분석에 사용되며 살아있는 세포와 죽은 세포를 구별하는 데 도움이 됩니다</td></tr></tbody></table>.

an adoptive transfer model of rheumatoid arthritis in mice

An Adoptive Transfer Model of Rheumatoid Arthritis in Mice

마우스의 관절 팽창 및 발생률에 대한 임상적 점수 매기기 
그림 1은 모델 마우스의 관절 부종과 발생률의 임상적 점수를 보여줍니다. 결과는 모델 그룹의 모든 마우스가 질병(n = 4)에 걸렸으며 발생률이 100%임을 나타냅니다. 모델 그룹의 점수는 크게 증가하여 두 번째 주에 잠시 완화된 모습을 보였으며 이후 6주 동안 상승했습니다.
마우스의 관절 부종 징후 모델 그룹 마우스의 관절은 현저한 두꺼움과 부종을 보이며, 앞다리와 뒷다리에서도 눈에 띄는 부기와 두꺼워짐이 관찰됩니다(그림 2).
마우스 발목 관절의 병리학적 결과 병리학적 결과는 대조군과 비교하여 모델 그룹 마우스가 발목 관절의 활막이 현저히 두꺼워지고 뼈가 불연속성이며 염증 세포의 현저한 응집을 보이는 것을 나타냅니다(그림 3, 그림 4 및 그림 5).
혈청 T세포 관련 염증 인자 대조군과 비교했을 때, 모델 그룹 마우스는 IL-10(7.51 vs 2.15 pg/mL), TNF(78.83 vs 13.11 pg/mL), IL-17(101.6 vs 12.64 pg/mL), IFN-γ(5.15 vs 1.90 pg/mL)의 혈청 수치가 유의하게 증가했다(p &lt; 0.05). IL-6도 대조군에 비해 유의하게 증가했다(15.59 대 6.27pg/mL)(p=0.05, 그림 6).
비장의 T 세포 부분 집합 Th1/2/17 및 Tregs의 변화 비장에서 T 세포 subset의 변화를 평가하기 위해 Tbx21(Th1), Gata3(Th2), Il-17(Th17) 및 Foxp3(Tregs)의 mRNA 발현 수준을 측정했습니다. 이러한 유전자는 각각의 T 세포 하위 집합의 분화와 기능을 정의하는 주요 전사 인자와 사이토카인을 암호화합니다. 대조군에 비해 모델군 마우스는 참조 유전자 Gapdh에 비해 비장(p &lt; 0.05)에서 Tbx21(1.68 대 0.61) 및 Il-17(26.30 대 0.75)의 mRNA 발현이 유의하게 증가한 것으로 나타났습니다.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/68196/68196fig01.jpg"> 
그림 1: 관절 부종의 임상적 점수. (A) 모델 그룹 마우스; (B) 모델 그룹 마우스의 누적 발생률. <a href="https://www.jove.com/files/ftp_upload/68196/68196fig01large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/68196/68196fig02.jpg"> 
그림 2: 대조군 및 모델 마우스의 관절 부종 징후(n = 4). (A-C) 마우스의 대조군 및 모델 그룹에서 발 및 관절 부종 점수(0,2,4)의 대표 이미지. <a href="https://www.jove.com/files/ftp_upload/68196/68196fig02large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/68196/68196fig03.jpg"> 
그림 3: 헤마톡실린-에오신 염색으로 관찰된 대조군 마우스와 모델 그룹 마우스의 발목 관절의 조직학적 변화. (A) 대조군 마우스 발목 관절; (B) 모델 그룹 마우스 발목 관절의 뼈 불연속성; (C) 모델 그룹 마우스 발목 관절의 활액 증식. 스케일 바 = 50μm(첫 번째 열), 100μm(두 번째 및 세 번째 열). 그림 3B와 3C의 이미지는 동일한 마우스에서 가져온 것으로, 서로 다른 병리학적 표현형을 보여줍니다. <a href="https://www.jove.com/files/ftp_upload/68196/68196fig03large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/68196/68196fig04.jpg"> 
그림 4: 대조군과 모델군 마우스 간 발목 관절의 활막 두께 차이(p &lt; 0.05). <a href="https://www.jove.com/files/ftp_upload/68196/68196fig04large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/68196/68196fig05.jpg"> 
그림 5: Safranin O-Fast Green 염색으로 관찰된 대조군 마우스와 모델 그룹 마우스의 발목 관절의 조직학적 변화. (A) 대조군 마우스의 발목 관절; (B) 모델 그룹 마우스의 발목 관절에서 활액 증식. 스케일 바 = 50μm(첫 번째 열), 100μm(두 번째 및 세 번째 열). <a href="https://www.jove.com/files/ftp_upload/68196/68196fig05large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/68196/68196fig06.jpg"> 
그림 6: 대조군 마우스와 모델 그룹 마우스에서 T 세포 관련 염증 인자 및 하위 집합의 변화. (A) 대조군 및 모델군 마우스의 혈청에서 T 세포 관련 염증 인자의 발현 및 (B) 비장에서 T 세포 부분 집합 Th1/2/17 및 Tregs의 변화. *p &lt; 0.05, **p &lt; 0.01. <a href="https://www.jove.com/files/ftp_upload/68196/68196fig06large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>점수</td>
			<td>부기 (범위 0-4)</td>
			<td>홍반(범위 0-2)</td>
		</tr>
		<tr>
			<td>0</td>
			<td>없음</td>
			<td>없음</td>
		</tr>
		<tr>
			<td>1</td>
			<td>임의의 숫자</td>
			<td>약간의</td>
		</tr>
		<tr>
			<td>2</td>
			<td>발</td>
			<td>극도</td>
		</tr>
		<tr>
			<td>3</td>
			<td>손목/발목</td>
			<td></td>
		</tr>
		<tr>
			<td>4</td>
			<td>사지 전체</td>
			<td></td>
		</tr>
	</tbody>
</table>
표 1: 관절염 채점 기준. 관절염에 점수를 매기려면 부기와 홍반에 따라 각 팔다리에 점수를 매기고 각 팔다리에 0-6의 점수를 할당합니다. 네 팔다리 모두에 대한 점수를 합산하여 각 마우스의 총 관절염 점수를 생성합니다.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td colspan="2">프라이머 염기서열</td>
		</tr>
		<tr>
			<td>올리고 이름</td>
			<td>시퀀스 5' - 3'</td>
		</tr>
		<tr>
			<td>TBX21-포워드</td>
			<td>아그카가그가트그트</td>
		</tr>
		<tr>
			<td>Tbx21-리버스</td>
			<td>GGGTGGACATATAAGCGGTTC</td>
		</tr>
		<tr>
			<td>Gata3-포워드</td>
			<td>CTCGGCCATTCGTA캣그가아</td>
		</tr>
		<tr>
			<td>가타3-리버스</td>
			<td>GGATACCTCTGCACCGTAGC</td>
		</tr>
		<tr>
			<td>IL-17A-포워드</td>
			<td>TTTAACTCCCTTGGCGCAAAA</td>
		</tr>
		<tr>
			<td>IL-17A-리버스</td>
			<td>CTTTCCCTCCGCATTGACAC</td>
		</tr>
		<tr>
			<td>Foxp3-포워드</td>
			<td>CCCTTGACCTCAAAACCAAG</td>
		</tr>
		<tr>
			<td>Foxp3-리버스</td>
			<td>GTGTGACTGCATGACTA액트가캣가트가캣가트가캣트가트가캣</td>
		</tr>
		<tr>
			<td>갭디-포워드</td>
			<td>GGTTGTCTCCTGCGACTTCA</td>
		</tr>
		<tr>
			<td>갭디-리버스</td>
			<td>TGGTCCAGGGTTTCTTACTCC</td>
		</tr>
	</tbody>
</table>
표 2: 프라이머 염기서열 목록.
보충 그림 S1: 유세포 분석에 의한 CD4+ T 세포 분류를 위한 게이팅 전략. <a href="https://www.jove.com/files/ftp_upload/68196/Supplemental%20Figure-Gating%20strategy.tif" target="_blank">이 파일을 다운로드하려면 여기를 클릭하십시오.</a>

Rheumatoid arthritis (RA) is a chronic, systemic autoimmune inflammatory disorder that may result in joint damage, deformities, disability, and even ...

an-adoptive-transfer-model-of-rheumatoid-arthritis-in-mice

Research

연구

JoVE Journal

Medicine

의학

이 비디오는 쥐 모델에서 보조제 유발 관절염을 생성하는 방법을 보여줍니다. Complete Freund's adjuvant(CFA)는 마우스의 발목 관절과 관절 주위 부위에 주입됩니다. CFA는 면역 체계를 활성화하여 호중구 침투와 과장된 염증을 유발합니다.

보조 유도 관절염 마우스 모델을 생성하는 기술

이 비디오는 마우스의 자가면역 관절염에 대한 세포 기반 치료법을 보여줍니다. 오브알부민 특이적 수용체를 발현하는 iPSC 유래 T 조절 세포에 보조제에서 유화된 메틸화된 소 혈청 알부민(mBSA)을 주입합니다. 쥐 항원제시세포(APC)는 mBSA를 처리하여 T세포에 전달하여 T세포가 활성화되고 무릎 관절의 활액막으로 이동하도록 유도합니다. 후속 주사에는 왼쪽 무릎에 mBSA만 투여하고 오른쪽 무릎에 mBSA와 오브알부민을 조합하여 투여합니다. 왼쪽 무릎에서는 mBSA에 대한 면역 반응이 관절염을 유발하는 반면, 오른쪽 무릎에서는 오브알부민과 상호 작용하는 T 조절 세포가 염증을 완화하여 관절염 증상을 개선합니다.

쥐 모델에서 자가면역 관절염에 대한 세포 기반 치료법

우리는 우리의 마우스 이식 arteriosclerois (GA) 같은 근친 교배 균주의받는 사람에 마우스 선박 세그먼트의 개재를 포함 모델에 대한 프로토콜을 설명합니다. 용기 기증자에 추가 유전자 변화를 교잡에 의해, 모델은 GA에 특정 유전자의 효과를 평가할 수 있습니다.

이식 동맥 경화에 대한 마우스 모델

여기에서는 syngeneic CD4+CD45RBhigh T cell을 T 및 B cell 결핍 수용자로 이식하여 마우스에서 결장 염증을 유도하는 프로토콜을 제시합니다. 임상적 및 조직병리학적 특징은 인간의 염증성 장 질환을 모방합니다. 이 방법을 사용하면 결장 염증의 시작과 질병의 진행에 대한 연구를 할 수 있습니다.

이펙터 CD4의 입양 전송하여 쥐과 장내 염증의 유도<sup&gt; +</sup&gt; CD45RB<sup&gt; 높은</sup&gt; 면역 결핍 마우스에게 T 세포

우리는 마우스의 대동맥 삽입 이식을 위한 프로토콜을 설명합니다. 이 프로토콜의 목표는 동맥의 동종면역 반응 및 그에 따른 장기 이식 실패에 기여하는 동맥 변화와 관련된 병리학적 과정 및 치료 전략을 연구할 수 있는 모델을 제공하는 것입니다.

동종 유도 혈관 거부 및 이식 동맥 경화 마우스 모델

bm12 림프구가 C57BL/6 수용자로 이식되는 것은 전신 홍반성 루푸스의 확립된 모델입니다. 여기에서는 이 모델을 사용하여 질병을 시작하는 방법과 유세포 분석을 통해 T 여포 보조 세포, 생식 중심 B 세포 및 형질 세포를 특성화하는 방법을 설명합니다.

C57BL / 6 마​​우스의 전신 홍 반성 루푸스의 BM12 유도 성 모델 (SLE)

여기서는 쥐 모델에서 자가면역 관절염의 면역 요법을 위해 유도 만능 줄기 세포(iPSC)에서 기능적 항원(Ag) 특이적 조절 T 세포(Tregs)를 개발하는 방법을 제시합니다.

자가 면역 대해 줄기 세포 유래의 항원 특이 적 조절 T 세포의 발달

설명 된 항 원 자주 나노 입자와 자극 B 세포 활성화에서 생체 외에서 그리고 vivo에서에서 그들의 사용의 준비가 이다. 일관 되 고 강력한 항 체 응답 새로운 땅콩 알레르기 모델의 개발을 주도. 항 원 리를 생성 하기 위한 프로토콜은 다른 항 원 및 예방 모델을 확장할 수 있습니다.

질병-특정 항 체의 생성에 대 한 항 원 리

이 프로토콜은 G6PI 혼합 펩티드를 사용하여 CD4+ T 세포 및 사이토카인에서 인간 류마티스 관절염에 가까운 류마티스 관절염 모델을 구성합니다. 고순도 불변 성 천연 킬러 T 세포 (주로 iNKT2) 특정 표현형 및 기능을 가진 채택 면역 요법에 대한 생체 내 유도 및 체외 정제에 의해 수득되었다.

포도당-6-인산염 이사머라제(G6PI)-유도 RA 마우스에서 iNKT 세포의 입양 면역 요법

액체 질소 냉동고 밀을 사용하여 뮤린 발을 처리하는 극저온 분쇄 방법은 조직에서 추출 된 RNA 또는 단백질의 수율과 품질을 개선하고 염증과 관련된 분자 프로파일의 분석을 가능하게하기 위해 개발되었습니다. 응답.

콜라겐 유도 관절염 모델에서 조직 염증의 분자 경로를 평가하기 위한 마우스 발 처리를 위한 저온 분쇄 프로토콜

관절의 생체 영상 촬영은 염증이 생긴 관절 내 백혈구의 이동 행동과 분자 역학을 밝히는 데 매우 유용한 기법입니다. 여기서는 제2형 콜라겐 유발 관절염(CIA) 마우스 모델을 사용한 관절의 생체 내 영상 검사에 대한 상세한 프로토콜을 제시합니다.

생체 내 영상 검사는 관절 내 백혈구의 이동 행동을 밝혀냅니다

배우세요 류마티스 관절염의 면역 기전 및 치료법 연구를 위한 빠르고 안정적인 마우스 모델을 수립하는 방법입니다. SKG 마우스에서 유래한 CD4+ T 세포를 C57BL/6 마우스에 전이하여 14일 내에 100% 발병률을 달성하는 이 기법은 비용 효율적이며 면역 메커니즘 분석과 신약 개발에 필수적인 도구를 제공합니다.

An Adoptive Transfer Model of Rheumatoid Arthritis in Mice

더 많은 동영상 탐색