Een abonnement op JoVE is vereist om deze inhoud te bekijken. Log in of start vandaag met uw gratis proefperiode.

Methodenartikel

Detection of a Target Analyte Using a Bacterial Biosensor

526 weergaven

26 september 2025

In dit artikel

Samenvatting

Source: Barber, A. E., et al. Preparation and Application of a New Bacterial Biosensor for the Presumptive Detection of Gunshot Residue. J. Vis. Exp. (2019).

This video demonstrates the detection of specific analytes using a bacterial biosensor. A bacterial culture carrying a plasmid with a red fluorescent protein (RFP) gene under an analyte-sensitive promoter is taken. After thoroughly wiping the test surface, a small section of the wipe is immersed in the culture and incubated. The analyte interaction with the promoter activates RFP expression, confirming the presence of the target analyte.

Protocol

NOTE: Synthesis of E. coli expressing red fluorescent protein (RFP) is presented.

1. Preparation of plasmid deoxyribonucleic acid (DNA) from E. coli

  1. Thaw E.coli containing a plasmid with an RFP gene and an ampicillin resistance gene, and grow the E.coli on Luria Broth (LB) agar plates containing 100 µg/mL ampicillin at 37 °C for 24 h. For example, use the J10060 plasmid from the registry of standard biological parts used for synthetic biology (see Table of Materials). The J10060 plasmid includes a gene for RFP under the control of a pBad promoter region and an ampicillin resistance gene. Alternatively, transform E.coli (refer to step 3.2) with the plasmid prior to growth on the LB agar plates.
  2. Follow a standard miniprep protocol (see Table of Materials) to isolate DNA from 1 mL of an E. coli culture that contains the J10060 plasmid. The purpose of the following protocol is to remove the pBad promoter and replace it with the desired promoter for the device.
  3. Following the plasmid miniprep, store the DNA in the freezer until ready for digestion.

2. Restriction enzyme digestion

  1. Set up the following reaction in a microcentrifuge tube for EcoRI and NheI digestion: 10 μL of J10060 plasmid DNA (isolated in step 1), 8 μL of water, and 1 μL each of EcoRI and NheI enzymes pre-mixed with 1 μL of buffer (see Table of Materials).
  2. For the promoter DNA, set up the following reaction in a microcentrifuge tube for EcoRI and NheI digestion: 10 μL of annealed promoter DNA sequences (8 μL of water, and 1 μL each of EcoRI and NheI enzymes pre-mixed with 1 μL of buffer.
    1. For Antimony (Sb-), Lead (Pb-), or Trinitrotoluene (TNT)-RFP (see Table of Materials), dissolve the oligonucleotides in buffer (30 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), pH 7.5; 100 mM potassium acetate), incubate in equal molar concentrations, heat to 94 °C for 2 min, and gradually cool at room temperature).
  3. Mix the samples by pipetting gently up and down with the pipette set to 10 μL.
  4. Incubate for 30 min at 37 °C.
  5. Heat-inactivate the enzymes at 80 °C for 5 min.
  6. Store the digested DNA in the freezer until ready for the next step.

3. Ligation and transformation

  1. Ligation
    1. Using the plasmid and promoter DNA that were double-digested with EcoRI and NheI in step 2, set up the reaction mixture shown in Table 1 in a microcentrifuge tube on ice; add the T4 DNA Ligase last.NOTE: Table 1 shows a ligation using a molar ratio of 1:3 vector to insert for the indicated DNA sizes.
    2. Gently mix the reaction by pipetting up and down and microcentrifuge briefly.
    3. Incubate at room temperature for 10 min.
    4. Heat-inactivate at 65 °C for 10 min.
  2. Transformation
    1. Thaw a tube with 20 µL of DH5-alpha Competent E. coli cells on ice until the last ice crystals disappear.
    2. Add 5 µL of plasmid DNA to the cell mixture. Carefully flick the tube 4-5 times to mix the cells and DNA.
    3. Place the mixture on ice for 2 min.
    4. Heat shock at exactly 42 °C for exactly 30 s. Do not mix.
    5. Place on ice for 2 min. Do not mix.
    6. Pipette 380 µL of room temperature super optimal broth with catabolite repression (SOC) into the mixture. Immediately spread onto an LB agar plate containing ampicillin (100 µg/mL) and incubate overnight at 37 °C.
    7. Check the plates within 24 h for growth.
    8. Seal the plates with sealing film and store them in the refrigerator until ready for the next step.

4. Colony polymerase chain reaction (PCR)

  1. Add to a PCR tube (set up 4 reaction tubes) the reaction mixtures shown in Table 2.
  2. Gently mix the reactions by pipetting up and down.
  3. Using a yellow pipette tip, scrape a colony (or very small region) of the transformed E. coli. Transfer a swipe of this E. coli onto a new LB/ampicillin/agar plate that has been sectioned off, and then insert the pipette tip into the PCR tube. Shake the pipette tip to mix the E. coli with the PCR mix. Repeat three more times for additional colonies. Transfer the PCR tubes to a PCR machine and begin thermocycling using the program shown in Table 3.
  4. Run gel electrophoresis using a 2% agarose gel in TAE 9Tris-Acetate-EDTA) to determine which colonies have the best ligation into the plasmid, and grow those colonies on a new plate.
  5. Store the plates in the refrigerator until ready for testing. Prepare a liquid culture in Luria broth with 100 µg/mL ampicillin added for chemical testing.

5. DNA Sequencing

  1. For each sample, add 5 µL of plasmid, 4 µL of the sequencing primer, and 3 µL of deionized water.
  2. Place this mixture into a tube and send it for DNA sequencing (see Table of Materials).
  3. Analyze DNA sequence data to compare the expected and observed DNA sequences using DNA sequence analysis software to ensure that there is no mutation and that the genes were correctly inserted.
    NOTE: Using E. coli as a chemical sensor is presented below.

6. Preparation of E. coli cultures

  1. Prepare LB with 100 µg/mL ampicillin for liquid cultures.
  2. Prepare liquid cultures of the sensor bacteria, the positive control* bacteria, and the negative control** bacteria.
    NOTE: *Positive control bacteria: E. coli containing a plasmid with the RFP gene under control of a constitutive promoter; plasmid E1010 from the registry of standard biological parts used for synthetic biology (see Table of Materials) was used in this work.**Negative control bacteria: E. coli containing a plasmid with the RFP gene under control of a different promoter, such as the pBad promoter (plasmid J10060 from the registry of standard biological parts used for synthetic biology (see Table of Materials) or a plasmid that does not have the RFP gene.
  3. Place the cultures into a shaking incubator at 37 °C and 220 rpm for a minimum of 8 h, maximum of 18 h. Cloudy broth indicates bacterial growth.

7. Titrating E. coli to check the function of the device

NOTE: Once the sensors have been titrated to check function, this step does not need to be repeated. A positive control in the form of the addition of lead, antimony, and 2,4-DNT or 1,3-dinitrobenzene (1,3-DNB) can check the function of the devices for each use without the need for the full titration.

  1. Prepare a stock solution of the analyte(s) of interest at a concentration of 10 ppm in water. If solubility is an issue, use a 50/50 water/methanol mixture.
  2. Using Table 4 as a guide, label the appropriate number of sterile culture tubes and place 2 mL of the cultured broth (from protocol step 6) into each tube.
    NOTE: In order to determine a general analytical range, do at least three different levels of an analyte with the sensor bacteria, one level with the negative control, and one level with the positive control. There should also be one tube of each of the bacteria that has no added metal (another type of negative control). To more accurately determine analytical range and limits of detection, use a larger range of analyte concentrations.
  3. Add analyte stock solution to the tubes containing 2 mL of broth as noted in Table 4, place the snap caps on the culture tube so that they are loose (to allow air flow into the tube), and vortex the culture tube.
  4. Leave the snap caps loosely on the culture tubes, and place them into a shaking incubator at 220 rpm and 37 °C for at least 24 h.
  5. Remove the tubes from the incubator, snap the caps onto the tubes tightly, and store the tubes in the refrigerator until ready for fluorescence analysis.

8. Using E. coli as a chemical sensor for gunshot residue (GSR)

  1. Using an ethanol-based wipe designed for removing lead (see Table of Materials), wipe all surfaces of the hands, including between the fingers. Use a separate wipe for each hand. Store the wipes in an appropriately labelled sealable bag until analysis.
  2. For surfaces to be tested, use an alcohol-based wipe for large surfaces or a cotton swab moistened with ethanol for small surfaces.
    NOTE: To demonstrate the sensors’ response to GSR, the inside of a spent .40 caliber cartridge casing was swabbed with an ethanol-moistened cotton swab.
  3. Wearing clean gloves and using scissors that have been cleaned with alcohol, cut an approximately 1 cm2 section out of the center of the wipe.
  4. Place the cut piece of the hand wipe or the cotton swab directly into a culture tube that contains 2 mL of the sensor bacteria, ensuring that it is submerged in the broth.
  5. Proceed as described above in steps 7.4 – 7.5.

Table 1. Reaction mixture for ligation, protocol step 3.1.1.

COMPONENT20 μL REACTION
10X T4 DNA Ligase Buffer2 μL
Plasmid DNA (3 kb)3 μL
Promoter DNA (0.7kb)10 μL
Nuclease-free water4 μL
T4 DNA Ligase1 μL


Table 2. Reaction mixtures for colony PCR, protocol step 4.1.

Component25 μL reaction
10 µM Forward Primer0.5 µL
10 µM Reverse Primer0.5 µL
OneTaq 2X Master Mix12.5 µL
Nuclease-free water11 µL


Table 3. PCR thermocycling parameters for protocol step 4.3.

STEPTEMPTIME
Initial Denaturation94 °C30 s
30 Cycles94 °C30 s
55 °C45 s
68 °C60 s
Final Extension68 °C5 min
Hold4 °C

Table 4. General experiment set up for titration of biosensors, protocol step 7.2.

Tube IDBacteriaConcentration of analyte solution added (ppm)Metal addedVolume of analyte solution added to 2,000 µL broth[analyte], ppb
1PbRFP10Pb2.512
2PbRFP10Pb75361
3PbRFP10Pb150698
4PbRFP0none00
5RFP neg10Pb1050
6RFP pos10Pb1050

Toegang beperkt. Log in of start een proefperiode om deze inhoud te bekijken.

Materialen

Lijst van materialen gebruikt in dit artikel
NaamBedrijfCatalogusnummerOpmerkingen
1,3-dinitrobenzene, 97%AldrichD194255-25G
2,4-dinitrotoluene, 97%Aldrich101397-5G
AgarFisher ScientificBP1423-500
AmpicillinFisher ScientificBP1760-5
Antimony, Reference Standard Solution (1000ppm ±1%/Certified)Fisher ScientificSA450-100Standard in dilute HNO₃
Cut Smart BufferNew England BioLabsB7204S
Duplex BufferIntegrated DNA Technologies11-01-03-00
EcoRI-HF Restriction EnzymeNew England BioLabsR3101S
Ethanol, HPLC grade, denaturedAcros OrganicsAC611050040Solvents do not need to be HPLC grade, ACS or reagent grade will work.
Eurofins Genomics SimpleSeq DNA Sequencing KitsEurofins GenomicsSimpleSeq Kit Standard
Forward primer for colony PCRIntegrated DNA Technologies 5’- GCCGCTTGAATTCGTCATATAT-3’
Forward primer for DNA sequencingIntegrated DNA Technologies 5’- GTAAAACGACGGCCAGTG-3’
IBI Science High Speed Plasmid Mini-kitIBI ScientificIB47101
LB Broth, MillerFisher ScientificBP1426-500
Lead, Reference Standard Solution (1000ppm ±1%/Certified)Fisher ScientificSL21-100Standard in dilute HNO3
LeadOff Disposable Cleaning and Decon WipesHygenall45NRCNSold in canisters or individually wrapped, any alcohol based wipe will work.
Methanol, HPLC gradeFisher ScientificA452-4Solvents do not need to be HPLC grade, ACS or reagent grade will work.
NEB 5-alpha Competent E. coli cellsNew England BioLabsC2987I
NheI-HF Restriction EnzymeNew England BioLabsR3131S
Nuclease free waterNew England BioLabsB1500S
OneTaq 2X Master Mix with Standard BufferNew England BioLabsM0482S
Plasmids from the registry of standard biological parts used for synthetic biologyRegistry of Standard Biological Parts http://parts.igem.org/Main_Page
Promoter SequencesIntegrated DNA Technologies Sb promoter: 5’-GCATGAATTCAGTCATATATGTTTTTGACTTATCCGCTTCGAAGAGAGAGACACTACCTGCAACAATCGCTAGCGCAT-3’ 3’-CGTACTTAAGCTCACTATATACAAAAACTGAATAGGCGAAGCTTCTCTCTCTGTGATGGACGTTGTTAGCGATCGCGTA-5’Pb promoter: 5’-GCATGAATTCGTCTTGACTCTATAGTAACTAAGGGTGTATAATCGGCAACGCGAGCTAGCGCAT-3’ 3’-CGTACTTAAGCAGAACTGAGATATCATTGATCTCCCACATCTTAGCCGTTGCGCTGCGATCGCGTA-5’TNT promoter: 5’GCATTCTAGATCAATTTATTTGAACAAGGCGGTCAATTCTCTTCGATTTTATCTCTCGTAAAAAAACGTGATACTCATCACATCGACGAAACAACGTCACTTATACAAAAATCACCTGCGAGAGATTAATTGAATTCGCAT3’ 3’CGTAAGATCTAGTTAAATAAACTTGTTCCGCCAGTTAAGAGAAGCTAAAATAGAGAGCATTTTTTTGCACTATGAGTAGTGTAGCTGCTTTGTTGCAGTGAATATGTTTTTAGTGGACGCTCTCTAATTAACTTAAGCGTA5’
Reverse primer for colony PCRIntegrated DNA Technologies 5’- GCCGCTTGAATTCGTCTAGACT- 3’
Reverse primer for DNA sequencingIntegrated DNA Technologies 5’- GGAAACAGCTATGACCATG-3’
T4 DNA LigaseNew England BioLabsM0202S

Tags

Detectie van analytrood fluorescent proteinpromoteractivatieethanol-wipefluorescentiemetingplasmidensysteemrepressorproteingenexpressieoppervlaktetesten