Amplification of a Suicide Plasmid in a Bacterial Host

Samenvatting

Source: Tomás, J. M., et al. Generation of Null Mutants to Elucidate the Role of Bacterial Glycosyltransferases in Bacterial Motility. J. Vis. Exp. (2022).

This video demonstrates the initiator-dependent amplification of a suicide plasmid in E. coli. The plasmid, which carries an antibiotic resistance gene, replicates only in the presence of an initiator protein encoded by the host. After electroporation and incubation in recovery medium, the mixture is plated on antibiotic-containing agar. Bacteria with a plasmid survive, as its initiator protein allows expression of the plasmid's antibiotic-resistant gene.

Protocol

1. Generation of null mutants in the flagella glycosylation island genes

NOTE: This method of mutagenesis is based on the allelic exchange of polymerase chain reaction (PCR) in-frame deletion products using the suicide vector pDM428 (GenBank: KC795686.1). Replication of pDM4 vector is lambda pir dependent, and the complete allelic exchange is coerced by utilizing the sacB gene located on the vector.

1. Construction of PCR in-frame deletion products.
   1. Design two pairs of primers that amplify DNA regions upstream (A and B primers) and downstream (C and D primers) of the selected gene or region to be deleted (Figure 1B).
   2. Ensure that Primers A and D have more than 600 bp upstream from the start and downstream from the stop, respectively, of the gene or genes to be deleted. These two primers need to include a restriction site at the 5' end for an endonuclease that allows cloning in pDM4.
      NOTE: The restriction site included at the 5' end of A and D primers should not be the same as sites within AB or CD amplicons.
   3. Ensure that Primers B and C are within the gene to be deleted or inside the first and last gene, respectively, of the region to be deleted. Ensure that both primers (B and C) are in-frame and located between 5-6 codons inside the gene. Furthermore, ensure that both primers include at the 5' end a 21 bp complementary sequence (Table 1) that allows joining the DNA amplicons AB and CD.
   4. Grow the selected Aeromonas strain in 5 mL of tryptic soy broth (TSB) overnight (O/N) at 30 °C. Use a commercially available kit for genomic DNA purification and follow the manufacturer's instructions (Table of Materials). Quantify 2 µL of the purified DNA using a spectrophotometer.
      NOTE: Use double-distilled water as a blank, with the instrument set to record absorbance at 260 nm. Record absorbance with 2 µL of purified DNA 3-5 times and calculate an average absorbance reading. Use the Beer-Lambert law to calculate the DNA concentration, where A = Ɛ.c.l. Wherein "A" is absorbance, "Ɛ" is the molar average extinction coefficient for DNA, "c" is DNA concentration, and "l" is the path length (refer to the manufacturer's instructions for the path length of each instrument).
   5. Use 100 ng of purified chromosomal DNA as the template in two sets of asymmetric PCRs with A-B and C-D primers (Table of Materials). Use a 10:1 molar ratio of A:B and D:C primer pairs.
      NOTE: Asymmetric PCRs allow the preferential amplification of one strand of the template over the other.
   6. Analyze the PCR products by electrophoresis in a 1% agarose gel. Use TAE (40 mM Tris-acetate, 1 mM ethylenediaminetetraacetic acid (EDTA)) as gel running buffer and a power setting of 8 V/cm. To visualize DNA, add ethidium bromide (0.5 µg/mL) to the gel and visualize the PCR products using a bio-imaging station (Table of Materials).
   7. Excise the amplicons from the gel using a scalpel, purify them following the manufacturer's protocol (Table of Materials), and quantify them.
   8. Join AB and CD amplicons by their 21 bp overlapping sequences in the 3' end of PCR products (Figure 2). Mix 100 ng of each amplicon (AB and CD) in a PCR tube with PCR reagents (pre-AD PCR), but without primers, and extend using the thermocycler program. Then, add 100 µM of A and D primers to the reaction (AD PCR) and amplify as a single fragment.
   9. Analyze the PCR product (AD amplicon) by electrophoresis in a 1% agarose gel using the conditions described in step 1.1.6, excise the amplicon from the gel, purify it following the manufacturer's protocol, and quantify the amplicon (Table of Materials).
2. Construction of pDM4 recombinant plasmid with the in-frame deletion.
   1. Grow an O/N culture of Escherichia coli cc18λ pir containing pDM4 in Luria-Bertani (LB) Miller broth (10 mL) with chloramphenicol (25 µg/mL) at 30 °C.
   2. Spin down the culture at 5,000 x g at 4 °C and suspend the pellet in 600 µL of sterile distilled water. Perform extraction and purification of plasmid pDM4 using a commercially available plasmid purification kit, following the provider's instructions (Table of Materials).
   3. Digest 1 µg of pDM4 and 400 ng of AD amplicon for 2 h with an endonuclease able to digest both ends of the AD amplicon and the cloning site of pDM4 (Figure 2). Follow the enzyme manufacturer's protocol for reaction conditions (Table of Materials).
   4. Clean up the digested plasmid and amplicon using a DNA purification kit and quantify them following the manufacturer's instructions (Table of Materials).
   5. To prevent religation of the linearized pDM4, remove the phosphate group from both 5' ends using the alkaline phosphatase enzyme following the manufacturer's instructions (Table of Materials). Then, clean up the treated plasmid and quantify it using a spectrophotometer as described in step 1.1.4 (Table of Materials).
   6. Combine 150 ng of the digested and phosphatase alkaline treated pDM4 with 95-100 ng of digested AD amplicon at a molar vector:insert ratio of 1:4. Prepare the ligation reaction in a volume of 15 µL, following the manufacturer's instructions (Table of Materials).
   7. Incubate O/N at 20 °C or over the weekend at 4 °C. After incubation, inactivate the T4 ligase at 70 °C for 20 min.
   8. Use ligation to introduce the plasmid into Escherichia coli MC1061λpir strain by electroporation. Use electrocompetent bacteria and 2 mm-gap electroporation cuvettes.
3. Preparation of electrocompetent E. coli and electroporation of pDM4 recombinant plasmid
   1. Inoculate a single colony of E. coli MC1061λpir strain into Luria-Bertani (LB) Miller broth and grow O/N at 30 °C with 200 rpm shaking.
   2. Dilute 2 mL of the bacterial culture in 18 mL of LB broth and incubate at 30 °C with shaking (200 rpm) until an optical density (OD600) between 0.4-0.6 is attained.
   3. Pellet the bacterial culture by centrifugation at 5,000 x g and 4 °C for 15 min. Discard the supernatant and suspend the pellet in 40 mL of chilled distilled H₂O.
   4. Repeat this cleaning step two more times to remove all culture salts. Finally, suspend the pellet in 4 mL of chilled distilled H₂O and transfer 1 mL of the suspension to each of four conical 1.5 mL microfuge tubes.
   5. Pellet the bacterial culture by centrifugation at 14,000 x g and 4 °C for 5 min. Remove the supernatant without disturbing the pellet and suspend each pellet in 100 µL of chilled distilled H₂O.
   6. Add 3-3.5 µL of the ligation mixture to each tube and incubate on ice for 5 min. Then, transfer the contents of each tube to a chilled 2 mm-gap electroporation cuvette and apply 2 kV, 129 Ω, and a time constant of around 5 ms.
      NOTE: Pre-cool the electroporation cuvettes on ice. Maintain the bacteria on ice during the entire procedure.
   7. After electroporation, add 250 µL of SOC (Super Optimal broth with Catabolite repression) medium to each of the four cuvettes to recover their contents, transfer them to a culture tube (about 1 mL), and incubate for 1 h at 30 °C with shaking (200 rpm).
   8. Plate the transformed cells on Luria-Bertani (LB) agar plates supplemented with chloramphenicol (25 µg/mL) to ensure all colonies growing on the plate have the plasmid backbone.

Table 1: Primers used for the construction of null mutants. Overlapping regions in primers B and C are underlined. The BamHI site is bolded in primers A and D.

Primer name	Sequence in 5’ to 3’ direction	Used for
A. piscicola AH-3
A-Flgi1	CGCGGATCCGACTGTACCCGTTTCAATCA	fgi mutant
B-Flgi1	CCCATCCACTAAACTTAAACAGATCACCTCGAACTCGAAA
C-Flgi12	TGTTTAAGTTTAGTGGATGGGGGAACCTTAAATGCCATGA
D-Flgi12	CGCGGATCCCAGTCTTCAGCTTCCATCC
E-Flgi1	ACCCGCTTCATTCGCTAT
F-Flgi12	TCCGATTTTCTGACTCAGGG
A-Fgi4	CGCGGATCCGATGCGTACGCTAATATGAA	fgi-4 mutant
B-Fgi4	CCCATCCACTAAACTTAAACACATATTATCTTGCCCCTGAT
C-Fgi4	TGTTTAAGTTTAGTGGATGGGATGGAGCTAATCACTCGTTT
D-Fgi4	CGCGGATCCACATATCAACCCCCAAC
E-Fgi4	ATTTCCCTGCCAAATACG
F-Fgi4	CCTGCCAACAGGATGTAAG
pDM4 vector
pDM4for	AGTGATCTTCCGTCACAGG	Insertions into the pDM4 vector
pDM4rev	AAGGTTTAACGG TTGTGGA

Resultaten

Figure 1: Bioinformatic detection of chromosomal regions and primer design. (A) Scheme o...

Materialen

Lijst van materialen gebruikt in dit artikel

Naam	Bedrijf	Catalogusnummer	Opmerkingen
ABI PRISM Big Dye Terminator v. 3.1 Cycle Sequencing Ready Reaction Kit	Applied Biosystems	4337455	Used for sequencing
AccuPrime Taq DNA Polymerase, high fidelity	Invitrogen	12346-086	Used for amplification of AB, CD and AD fragments
Agarose	Conda-Pronadise	8008	Used for DNA electrophoresis
Alkaline phosphatase, calf intestinal (CIAP)	Promega	M1821	Used to remove phosphate at the 5’ end
Bacto agar	Becton Dickinson	214010	Use for motility analysis
BamHI	Promega	R6021	Used for endonuclease restriction
BglII	Promega	R6081	Used for endonuclease restriction
BioDoc-It Imagin System	UVP		Bio-imaging station used for DNA visualization
Biotaq polymerase	Bioline	BIO-21040	Used for colony screening
Cytiva illustra GFX PCR DNA and Gel Band Purification Kit	Cytivia	28-9034-71	Used for purification of PCR amplicons and DNA fragments.
EDTA	Applichem	131026.1211	Used for DNA electrophoresis
Electroporation cuvettes 2 mm gap	VWR	732-1133	Used for transformation
Luria-Bertani (LB) Miller agar	Condalab	996	Used for Escherichia coli culture
Luria-Bertani (LB) Miller broth	Condalab	1551	Used for Escherichia coli culture
Nanodrop ND-1000	NanoDrop Techonologies Inc		Spectrophotometer used for DNA quantification
Rifampicin	Applichem	A2220,0005	Used for triparental mating
SOC Medium	Invitrogen	15544034	Used for electroporation recovery
T4 DNA ligase	Invitrogen	15224017	Used for ligation reaction
Veriti 96 well Thermal Cycler	Applied Biosystems		Used for PCR reactions