Een abonnement op JoVE is vereist om deze inhoud te bekijken. Log in of start vandaag met uw gratis proefperiode.

Methodenartikel

Detection of Target Gene Expression in a Bacteria-Infected Mouse Brain

304 weergaven

2 februari 2026

In dit artikel

Samenvatting

Source: Zhang, S., et al. Intracranial Subarachnoidal Route of Infection for Investigating Roles of Streptococcus suis Biofilms in Meningitis in a Mouse Infection Model. J. Vis. Exp. (2018).

This video demonstrates the detection of target gene expression in a bacteria-infected mouse brain. RNA is extracted, treated with a DNA-degrading enzyme, and reverse-transcribed into cDNA. The cDNA is amplified through thermal cycling with gene-specific primers, while a DNA-binding dye binds to the amplified DNA, emitting fluorescence. The fluorescence signals are analyzed to confirm the presence of the target gene.

Protocol

1. Preparation of Bacteria

Note: Streptococcus suis (S. suis) serotype 2 virulent strain P1/7 was isolated from a diseased pig with meningitis. Strain P1/7 was grown in Todd-Hewitt broth (THB, formula per liter of THB: Heart Infusion, 3.1 g; neopeptone, 20.0 g; dextrose, 2.0 g; sodium chloride, 2.0 g; disodium phosphate, 0.4 g; sodium carbonate, 2.5 g) and plated on Todd-Hewitt agar (THA, formula per liter of THA: Heart Infusion, 3.1 g; neopeptone, 20.0 g; dextrose, 2.0 g; sodium chloride, 2.0 g; disodium phosphate, 0.4 g; sodium carbonate, 2.5 g; agar, 15.0 g) at 37 °C and 5% CO2.

  1. Collection of strain P1/7 planktonic cells
    1. Collect 5 mL of planktonic cells from mid-log phase culture (OD600=0.6), centrifuge for 3 min at 8000 × g, and then wash 3 times with phosphate-buffered saline (PBS).
    2. Resuspend the cells with 5 mL of 25% glycerol in THB, aliquot into 5 tubes, and then store at -80 °C.
  2. Collection of strain P1/7 biofilm state cells
    1. Take 20 mL of an overnight culture and add to 180 mL of fresh THB; divide the diluted culture equally into 10 round culture plates, and then put the plates in an incubator at 37 °C in 5% CO2 for 24 h.
    2. After incubation, shake the plate gently to resuspend the bacteria that have not adhered to the plate, and then discard the supernatant by aspiration.
      NOTE: Shake the plate gently and avoid resuspending the sediment.
    3. Add 5 mL of PBS to harvest biofilm state cells, resuspend the sediment completely, and then transfer the sample to a new tube.
    4. Sonicate the biofilm state cells from the last step with the following parameters: 60 W, 4 cycles, 5 s on and 10 s off.
    5. Centrifuge for 3 min at 8000 × g and store the supernatant at -80 °C.
      NOTE: The supernatant may contain biofilm components, and it can be used to resuspend the biofilm bacteria before infection as described in the animal experiments (Step 2).
    6. Resuspend the sediment with 10 mL 25% glycerol in THB and then store the biofilm state cells at -80 °C.

2. Animal Experiments

  1. Use SPF 6-week-old female BALB/c mice in this study. Infect all mice through the intracranial subarachnoidal route of infection, whose injection site is located 3.5 mm rostral from the bregma.
    1. For histopathological analysis, infect two groups of mice (5 mice per group) using planktonic cells or biofilm state cells at a dose of 3 × 107 colony-forming units (CFU), and another 5 mice were injected with PBS as a control.
    2. For the detection of mRNA expression of TLR2 and cytokines in the brain, infect two additional groups of mice (6 mice per group) using planktonic cells or biofilm state cells at a dose of 3 × 107 CFU.
    3. Determine the number of viable bacteria by plating serial dilutions onto THA.
    4. Euthanize all mice at 12 h post-infection for further research.
      NOTE: Glycerol in the stock medium must be removed before infection. Both planktonic cells and biofilm state cells recovered from -80 °C are washed 3 times with PBS. Then, planktonic cells are resuspended with PBS and diluted to the appropriate dose for infection; biofilm state cells are resuspended with the stored supernatant (from step 1.2.5) and diluted to the appropriate dose for infection. The volume for infection should not be more than 50 µL.
  2. Detecting the mRNA expression of TLR2 and cytokines in brain tissue
    1. Extract the total RNA from brain tissue using an RNA extraction kit.
      1. For each mouse, use the whole brain tissue for extracting RNA. Divide the whole brain tissue into 5 tubes. Take up to 100 mg of brain tissue and add 1 mL of lysis solution to each tube containing the lysing matrix provided by the kit.
      2. Process the tube in a homogenizer for 40 s at a setting of 6.0, and then centrifuge the tube at 12000 × g and 4 °C for 5 min.
      3. After centrifugation, transfer the upper phase to a new microcentrifuge tube.
      4. Incubate the transferred sample for 5 min at room temperature; add 300 µL of chloroform, vortex for 10 s, and then incubate for 5 min at room temperature.
      5. Centrifuge the tube at 12000 × g and 4 °C for 5 min. Transfer the upper phase to a new tube.
      6. Add 500 µL of cold absolute ethanol to the tube before inverting it 5 times, and then store the sample at -20 °C for at least 1 h.
      7. Centrifuge the tube at 12000 × g and 4 °C for 15 min and remove the supernatant. Wash the pellet with 500 µL of cold 75% ethanol in RNase-free water (H2O).
      8. Remove the ethanol, air-dry the pellet for 5 min at room temperature, and resuspend the RNA in 100 µL of RNase-free H2O.
      9. Incubate the RNA for 5 min at room temperature and determine the RNA concentration using an RNA bioanalyzer.
    2. Perform complementary DNA (cDNA) synthesis, including elimination of genomic DNA (gDNA), using a thermocycler with a reverse transcription (RT) reagent kit.
      1. Add 1 µg of RNA to a tube containing 2 µL of 5x gDNA elimination buffer, 1 µL of gDNA elimination enzyme, and RNase-free H2O until the volume reaches 10 µL. Incubate for 2 min at 42 °C.
      2. Add 10 µL of master mix (1 µL of RT enzyme Mix I, 1 µL of RT Primer Mix, 4 µL of 5x Buffer 2, and 4 µL of RNase-free H2O) to the reaction solution from the last step and then mix gently. Proceed immediately with the RT reaction: 37 °C for 15 min and then 85 °C for 5 s.
      3. Perform the quantitative real-time polymerase chain reaction (RT-qPCR) analysis using a Real-Time PCR machine with a SYBR RT-qPCR kit. Add 10 µL of 2x enzyme, 0.8 µL of forward primer, 0.8 µL of reverse primer, 0.4 µL of 50x ROX Reference Dye II, 2 µL of cDNA template, and RNase-free H2O until a total volume of 20 µL.
      4. Run each sample in triplicate using the following thermal parameters: 30 s at 94 °C, followed by 40 cycles of 5 s at 95 °C, and 34 s at 60 °C, with a final stage of 15 s at 95 °C, 1 min at 60 °C, and 15 s at 95 °C. Primers for RT-qPCR are listed in Table 1. Housekeeping genes B2m and 18s rRNA were used as the internal controls.
    3. Calculate the relative fold change based on the 2-ΔΔCt method.

Table 1: Primers for RT-qPCR.

Primer NameSequence (5’-3’)Gene symbol
IL-6 forwardCTTCCATCCAGTTGCCTTCTIl6
IL-6 reverseCTCCGACTTGTGAAGTGGTATAGIl6
TLR2 forwardCACTATCCGGAGGTTGCATATCTlr2
TLR2 reverseGGAAGACCTTGCTGTTCTCTACTlr2
CCL2 forwardCTCACCTGCTGCTACTCATTCCcl2
CCL2 reverseACTACAGCTTCTTTGGGACACCcl2
TNF-α forwardTTGTCTACTCCCAGGTTCTCTTnf
TNF-α reverseGAGGTTGACTTTCTCCTGGTATGTnf
β2m forwardGGTCTTTCTGGTGCTTGTCTB2m
β2m reverseTATGTTCGGCTTCCCATTCTCB2m
18s forwardGTAACCCGTTGAACCCCATT18s rRNA
18s reverseCCATCCAATCGGTAGTAGCG18s rRNA

Toegang beperkt. Log in of start een proefperiode om deze inhoud te bekijken.

Materialen

Lijst van materialen gebruikt in dit artikel
NaamBedrijfCatalogusnummerOpmerkingen
Todd Hewitt Broth (THB)Becton, Dickinson and CompanyDF0492078Dissolve 30 g of the powder in 1 L of purified water. Autoclave at 121° for 15 min.
AgarDSBIO16C0050Dissolve 15 g of the powder in 1 L of THB. Autoclave at 121° for 15 min.
Milli-Q Reference Water Purification SystemMerck KGaAZ00QSVCUSWithout Dnase/ Rnase
NaClTianjin Kemiou Chemical Reagent Co., Ltd10019318 
Na₂HPO₄Xilong Scientific Co., Ltd9009012-01-09 
KClXilong Scientific Co., Ltd9009017-01-09 
KH₂PO₄Xilong Scientific Co., Ltd9009019-01-09 
KOHXilong Scientific Co., Ltd9009014-01-09 
GlycerolSionpharm Chemical Reagent Co., Ltd10010618Diluted with equal volume of purified water, autoclave at 121° for 15 min
4% paraformaldehydeSionpharm Chemical Reagent Co., Ltd80096675 
25% GlutaraldehydeSionpharm Chemical Reagent Co., Ltd3009243610-fold diluted with purified water for fixation.
EthanolSionpharm Chemical Reagent Co., Ltd10009218 
ChloroformSionpharm Chemical Reagent Co., Ltd10006818 
SpctrophotometreDeNovix Inc.DS-11+ 
Ultrasound cell crusherNingBo Scientz Biotechnology Co.,LtdJY96-IIN 
CentrifugeHitachi Koki Co., LtdCT15RE 
RefrigeratorAucma Co., LtdDW-86L500 
FastRNA Pro Green KitMP Biomedicals#6045-050 
FastPrep-24 InstrumentMP Biomedicals116005500 
Instrument for PCRSensoQuest GmbH1124310110 
QuantStudio 6 FlexThermo Fisher Scientific4485689 
SYBR Premix Ex Taq IITakara Biomedical Technology (Beijing) Co., LtdRR820A 
PrimeScript RT reagent kit with gDNA EraserTakara Biomedical Technology (Beijing) Co., LtdRR047A 

Tags

Infectie van muizenbreinRNA extractiecDNA synthesekwantitatieve real time PCRfluorescentiedetectiegenamplificatieDNA degradatiethermische cycliprimerbinding