Een abonnement op JoVE is vereist om deze inhoud te bekijken. Log in of start vandaag met uw gratis proefperiode.

Methodenartikel

In Vitro Gut Model to Assess Bacterial Adhesion and Internalization

295 weergaven

31 maart 2026

In dit artikel

Samenvatting

Source: Calatayud Arroyo, M., et al. Assessing the Viability of a Synthetic Bacterial Consortium on the In Vitro Gut Host-microbe Interface. J. Vis. Exp. (2018).

This video demonstrates an in vitro gut host–microbe model to study bacterial viability. A co-culture of Caco-2 and HT29-MTX cells is incubated with bacteria pre-treated under simulated digestive conditions. Epithelial barrier integrity is assessed using transepithelial electrical resistance, and fractions from the medium, solubilized mucus, cell lysate, and cell debris are collected for downstream analysis.

Protocol

1. Strains and Culture Conditions

NOTE: The synthetic oral community was composed of strains commonly present in the oral microbiome.

  1. Obtain the following strains from the American Type Culture Collection (ATCC): Aggregatibacter actinomycetemcomitans (ATCC 43718), Fusobacterium nucleatum (ATCC 10953), Porphyromonas gingivalis (ATCC 33277), Prevotella intermedia (ATCC 25611), Streptococcus mutans (ATCC 25175), Streptococcus sobrinus (ATCC 33478), Actinomyces naeslundii (ATCC 51655), Streptococcus gordonii (ATCC 49818), Actinomyces viscosus (ATCC 15987), and Streptococcus mitis (ATCC 49456).
  2. Acquire Veillonella parvula from the Leibniz Institute DSMZ-German Collection of Microorganisms and Cell Cultures (DSM 2007), Streptococcus sanguinis from the BCCM/LMG Bacteria Collection (LMG 14657), and use Streptococcus salivarius strain TOVE-R, and Streptococcus oralis.

2. Development of a Multispecies Community Representative of the Oral Microbiome

NOTE: Generate a synthetic community to simulate the potential adhesion capacity of oral bacteria to the in vitro gut epithelium. Grow bacteria on blood agar plates supplemented with 5 μg/mL hemin, 1 μg/mL menadione, and 5% sterile defibrinated horse blood. In brief:

  1. Dissolve 100 mg of hemin in 2 mL of 1 M sodium hydroxide (NaOH), and add 100 mL of distilled autoclaved water. Store in a dark container. Sterilize through a 0.22 µm filter before adding to the medium.
  2. Dissolve 100 mg of menadione in 20 mL of 96% ethanol. Sterilize through a 0.22 µm filter before adding to the medium.
  3. Prepare 1 L of blood agar medium (see Table of Materials) according to the manufacturer’s instructions and autoclave. Let it cool down before adding the horse blood and the supplements. Mix and pour the plates.
  4. Prepare modified Brain Heart Infusion (BHI) broth. Add 5 μg/mL of hemin and 1 μg/mL of menadione after autoclaving.
  5. Dispense 9 mL of the medium in Hungate tubes, and close with a rubber stopper and an aluminium cap. Flush the tubes with nitrogen/carbon dioxide or N2/CO2 (90%/10%).
  6. Retrieve 1 mL of anaerobic medium with a syringe and place it in a 1.5 mL microcentrifuge tube. Pick single colonies of each bacterial species, resuspend in the medium, and transfer back into the anaerobic modified BHI. Incubate for 48 h at 37 °C, except for S. salivarius, which must be incubated for 24 h.
  7. If needed, confirm the purity of the cultures prior to assembling the synthetic community. In brief:
    1. Extract DNA from the liquid cultures and amplify the 16S rRNA gene using the primers 27F (AGAGTTTGATYMTGGCTCAG) and 1492R (TACGGYTACCTTGTTACGACT), and the following program: 5 minutes at 95 °C, 30 cycles of 95 °C for 1 min, 55 °C for 1 min, and 72 °C for 1.5 min, followed by a final extension step of 5 min at 72 °C.
    2. Purify the polymerase chain reaction (PCR) product with a commercial kit (see Table of Materials), following the manufacturer’s instructions.
    3. Perform the sequencing reaction of the purified products in a 10 μL total volume containing 0.5 μL of dye (see Table of Materials), 3.2 pmol of M13f primer (CGCCAGGGTTTTCCCAGTCACGAC), 2.0 μL of 5x sequencing buffer, and 20 ng of template, using a commercial sequencing system with kit (see Table of Materials).
      NOTE: We had this procedure performed commercially.
    4. Perform a BLAST search on all the sequences (http://blast.ncbi.nlm.nih.gov/Blast.cgi) to determine the closest known taxon and compare with the sequence of the original strain using the RDP Classifier online tool (http://rdp.cme.msu.edu/) and the SINA Alignment service (https://www.arb-silva.de/aligner/).
  8. Measure the cell number at the end of the incubation, using flow cytometry and SYBR Green/Propidium Iodide stain. Dilute the cultures to 105 cells mL-1, using modified BHI.
  9. Add 1 mL of S. mitis into 75 mL of anaerobic BHI and incubate until the stationary phase (6 h). Following, collect 0.75 mL of each diluted strain and mix under anaerobic conditions.
  10. Once all the cultures have been mixed, take 1 mL of the microcosm, and add to the 75 mL of BHI. Incubate the synthetic community under 10% CO2, 10% hydrogen (H2), 80% N, for 48 h at 37 °C and 200 rpm (see Table of Materials).
  11. Measure cell density as in 2.8. before presenting the community to the cell model. The composition of the community can be assessed with quantitative Real-Time PCR. In addition, use 16S rRNA gene amplicon sequencing to provide information on the initial members present. For either identity-confirming protocol, use cDNA as a template to indicate the bacteria actively transcribing proteins, and use DNA as a template to reveal the presence/absence of the strains.

3. General Cell Culture Practices

NOTE: Obtain cell lines used from the European Collection of Authenticated Cell Cultures (Caco-2 ECACC 86010202 and HT29-MTX-E12 ECACC 12040401, Public Health England, UK). Reagents for cell culture can be purchased (see Table of Materials), unless otherwise specified.

  1. Maintenance and passaging of Caco-2 and HT29-MTX cell linesNOTE: Caco-2 and HT29-MTX cells are routinely grown in 25 cm2 tissue culture flasks containing supplemented dulbecco's modified eagle medium (DMEM) (Table 1). Cells are trypsinized when 60–70% confluence is reached.
    1. Remove the cell culture medium from the flasks. Wash twice with 5 mL of PBS without calcium/magnesium (Ca++/Mg++).
    2. Add 2 mL of a 0.5 mg/L solution of trypsin and 0.22 g/L ethylene diamine tetraacetic acid (EDTA). Distribute the trypsin solution by gently moving the flask. Remove 1.5 mL of the trypsin solution and incubate the flask at 37 °C for 10 min.
    3. Check under the microscope if cells are detached from the flask surface. Incubate for additional 5 min, if needed.
    4. Add 5 mL of supplemented cell culture media to the flask to inactivate the trypsin. Pipette up and down to obtain a homogeneous single-cell suspension.
    5. Immediately, take a 50 µL aliquot of the cell suspension and mix with sterile 0.4% Trypan blue solution in a 1:1 (v/v) proportion for Caco-2 cells or 1:5 v/v for HT29-MTX. Mix by pipetting and load into a counting chamber (see Table of Materials).
    6. Count the viable cells (white bright cells) under the microscope (see manufacturer’s instructions).
    7. Seed in a new flask at a density of 4 x 105 cells/cm2 and 1 x 104 cells/cm2, for Caco-2 and HT29-MTX, respectively.
      NOTE: (1) Caco-2 cells differentiate and form tight junctions once reaching confluency. It is extremely important to avoid over-confluency before trypsinization. Overgrowth of cells in the flask can cause failure in cell detachment after trypsinization and/or cell clumping. (2) HT29-MTX cells are mucus-producing cells with high metabolic activity. These features may cause a fast acidification of the cell culture media, especially if cells are at high density. 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) buffer can be added to the cell culture medium (Table 1) to maintain the pH between 7 and 7.2. If the pH drops, the medium can be exchanged when confluency is less than 50%. However, if confluency >50%, the cell culture must be split.

4. Assembly of a Multicompartment Cell Model Simulating the Gut Host-microbe Interface

NOTE: Complete the co-culture in double chamber wells (diameter 24 mm, pore size 0.4 μm; see Table of Materials).

  1. Add 1.5 mL of complete cell culture media to the apical compartment and 2 mL to the basal. Pre-incubate for 20–30 min to obtain an even distribution of the cell suspension when seeding.
  2. Trypsinize the cell culture of Caco-2 and HT29-MTX as described in section 3. The trypsinization procedure must be accurately followed to achieve homogenous distribution of both cell lines, in a single cell suspension, without clumps.
  3. Count the viable cells as described in 3.1.8.
  4. Adjust the cell density to 6.5 x 104 cells/cm2 in a 90/10 proportion of Caco-2/HT29-MTX cells.
  5. Homogenize the cell suspensions and add the corresponding volume of Caco-2 and HT29-MTX cells to a pre-filled sterile container with supplemented cell culture media. Remove the pre-incubated media from the apical side of the chamber by aspiration.
  6. Gently mix the cell suspension by pipetting, and transfer 1.5 mL to the apical compartment of the chamber inserts. The seeding procedure requires a constant homogenization of the cell suspension, as cells tend to sediment. Depending on the experience of the user and working speed, cell suspension must be mixed after dispensing 1–3 wells.
  7. Move plates gently backward and forward and then right to left to right (5–10 times) to obtain an even spread of cells in the well. Transfer to the incubator and repeat the movement of the plates.
  8. Maintain the co-culture of Caco-2/HT29-MTX cells for 15 days, refreshing apical and basal compartments every 2 days with supplemented DMEM. After this time, the cell culture media can be changed to supplemented DMEM without an antibiotic/antimycotic solution.
  9. Maintain the system until 20–21 days post-seeding by refreshing the medium every 2 days.
  10. Measure the epithelial barrier integrity before starting the assay, using an Electrical Resistance System (see Table of Materials), following the manufacturer's instructions.
    1. Ensure that the transepithelial electrical resistance (TEER) equipment is fully charged (>24 h) before starting the measurements.
    2. Disconnect the TEER equipment from the power supply and cover with a plastic autoclave bag. Make a hole in the bag to introduce the electrode and plug into the input port on the meter. Spray with 70% ethanol/water (v/v) before introducing the TEER equipment into the flow cabinet.
    3. To disinfect the electrode, immerse the electrode tips in a 70% ethanol/water (v/v) solution for 15 min. Allow to air dry for 15 s. Rinse the electrode in pre-warmed cell culture media.
    4. Take the cells out of the incubator and allow cells to come to room temperature inside the flow cabinet.
    5. Make sure that the meter is disconnected from the charger. Set the mode switch to Ohms and turn the power switch on.
    6. Measure the cell resistance by immersing the electrode with the shorter tip in the insert and the longer tip out of the well. Keep the electrode at a 90° angle to the plate insert.

5. Bacterial Survival Following In Vitro Gastrointestinal Transit Conditions

NOTE: Prepare all the dilutions with ultrapure water. Filter-sterilize all solutions through a 0.22 µm filter and perform the digestion procedure under sterile conditions.

  1. Oral digestion:
    1. Place 3 mL of the bacterial community in a 50 mL sterile tube, mix with 3 mL of simulated saliva fluid (SSF), containing (in mmol L-1): potassium chloride (KCl), 15.1; potassium dihydrogen phosphate (KH2PO4), 3.7; sodium bicarbonate (NaHCO3), 6.8; magnesium chloride hexahydrate [MgCl2(H2O)6], 0.5, ammonium carbonate [(NH4) CO3], 0.06; hydrochloric acid (HCl), 1.1; calcium chloride dihydrate [CaCl2(H2O)2], 0.75. Add 75 U/mL of α-amylase from human saliva Type IX-A and 2 g/L mucin from porcine stomach type II to the SSF.
    2. Incubate the mixture for 2 min at 37 °C and 100 rpm. Collect a 2 mL sample for DNA extraction and flow cytometry quantification (S1).
  2. Gastric digestion:
    1. Add 4 mL of simulated gastric fluid (SGF), containing (in mmol L-1): KCl, 6.9; KH2PO4, 0.9; NaHCO3, 25; sodium chloride (NaCl), 47.2; MgCl2(H2O)6, 0.1; (NH4)CO3, 0.5; HCl, 15.6; CaCl2(H2O)2, 0.075. In addition, the SGF contained 2 g/L of mucin from porcine stomach type II.
    2. Measure the pH and adjust to pH 3 with 1 M HCl, if needed. Incubate at 37 °C and 100 rpm. Collect a 2 mL sample (S2).
  3. Small intestine digestion:
    1. Add 4 mL of simulated intestinal fluid (SIF) containing (in mmol L-1): KCl, 6.8; KH2PO4, 0.8; NaHCO3, 85; NaCl, 38.4; MgCl2(H2O)6, 0.33; HCl, 8.4; CaCl2(H2O)2, 0.3, to the digestion tube.
    2. Adjust to pH 7 with 1 M NaOH, if needed. Incubate at 37 °C and 100 rpm. Collect a 2 mL sample (S3).

6. Bacterial Colonization Ability Following In Vitro Gastrointestinal Transit Conditions

  1. Centrifuge 2 mL of the small intestine digestion for 10 min at 2,650 x g.
  2. Remove the supernatant and mix the bacterial pellet with 5 mL of supplemented DMEM without antibiotics and antimycotics.
  3. Stain and quantify intact/damaged cells using a flow cytometer (see Table of Materials).
  4. Adjust the cell density to 105 viable cells/mL by diluting in supplemented DMEM without antibiotics and antimycotics.
  5. Remove the apical medium of the transwell system and add 1.5 mL of the bacterial suspension. Co-culture the system for 2 h under general cell culture conditions (37 °C, 95% humidity, 5% CO2).
    NOTE: This time can be extended up to 48 h, depending on the experimental protocol required. The co-culture can be maintained in a different incubator than that used for routine cell maintenance, to avoid contaminations.
  6. Measure the TEER values after incubation to evaluate the integrity of the epithelial barrier as described in 4.11.
  7. Upon completing incubation time, remove apical media, and collect 0.5 mL for further analyses (S4). A subsample of media can be used for assessment of cell viability by Lactate Dehydrogenase (LDH) assay (see Table of Materials), following the manufacturer's instructions.
  8. Add 0.5 mL of 10 mM N-acetylcysteine in HBSS (NAC-buffer) to solubilize the mucus produced by the HT29-MTX and to recover adhered bacteria. Incubate the plates at 37 °C for 1 h, under agitation (135 rpm, see Table of Materials).
  9. Recover the NAC-HBSS in a microcentrifuge tube (S5) and wash the cells twice with 1 mL DPBS.
  10. Add 0.5 mL of 0.5% Triton X-100 (w/v) on top of the monolayers, disrupt the cells by pipetting, recover the liquid, and vortex for 1 min. Speed is crucial to avoid damaging the bacterial cells with the detergent.
  11. Centrifuge the cells for 5 min at 2,650 x g, and separate the supernatant (S6) and the pellet (S7).

7. Sample Analysis

NOTE: Analyse collected samples (S1-S7) to evaluate bacterial viability and adhesion potential to the intestinal cells, following a simulated gastrointestinal digestion.

  1. Bacterial viability: Pass samples S1-S5 twice through a 0.45 µm filter and quantify bacterial cells using live/dead cell staining and flow cytometry, as indicated in step 2.8.
  2. Adhesion potential: Prepare serial dilutions (-1 to -8) for S1-S6 and streak 10 µL in blood agar and modified BHI plates. Incubate at 37 °C under anaerobic conditions for 24–48 h. Plate the same volume of undiluted S7.
    1. Taxonomical identification of adhered bacteria:
      1. Pick individual colonies with a culture loop and resuspend each in 10 µL of nuclease-free water. Collect 4 µL of this suspension and use it as a template for PCR amplification of the 16S rRNA gene using the primers and conditions described in 2.7.1.
      2. Perform sequencing following the protocol in 2.7.3, and validation of the sequence using the procedure included in 2.7.4.
  3. Do further downstream analysis such as total DNA extraction, qPCR quantification, and/or 16S rRNA amplicon sequencing, RNA extraction, and transcriptomic profiling as desired.
    NOTE: Flow cytometry quantification was performed immediately after sampling. As a control for membrane-permeabilized cells, a sample exposed to 70 °C for 3 min was used. Background noise was assessed by measuring with flow cytometry the digestion fluids or samples obtained from the cell culture model without bacteria. Every sample was measured in triplicate.

 

Table 1: Description of the cell lines and media composition for cell culture maintenance.

Cell cultureAdherent/ SuspensionCulturing MediumGeneral supplementsSpecific supplementsDoubling timeIncubation conditions
Caco-2 (ECACC 86010202)AdherentDulbecco’s Modified Eagle Medium (DMEM) with 4.5 g/L glucoseInactivated fetal bovine serum (10% v/v) Penicillin (100 U/mL)* Streptomycin (0.1 mg/mL)* Amphotericin (0.0025 mg/mL)*Glutamax (4 mM) Non essential amino acids (1% v/v) Pyruvate (1 mM)65–72 h95% humidity and 10% CO2 CO2 incubator (see Table of Materials)
HT29-MTX (ECACC 12040401)AdherentHEPES (1 mM)20–24 h
* Antibiotics and antifungals were removed from the cell culture media 2 days before starting the assays.

Toegang beperkt. Log in of start een proefperiode om deze inhoud te bekijken.

Materialen

Lijst van materialen gebruikt in dit artikel
NaamBedrijfCatalogusnummerOpmerkingen
STRAINS   
Aggregatibacter actinomycetemcomitansAmerican Type Culture CollectionATCC 43718 
Fusobacterium nucleatumAmerican Type Culture CollectionATCC 10953 
Porphyromonas gingivalisAmerican Type Culture CollectionATCC 33277 
Prevotella intermediaAmerican Type Culture CollectionATCC 25611 
Streptococcus mutansAmerican Type Culture CollectionATCC 25175 
Streptococcus sobrinusAmerican Type Culture CollectionATCC 33478 
Actinomyces viscosusAmerican Type Culture CollectionATCC 15987 
Streptococcus salivarius TOVE-R   
Streptococcus mitisAmerican Type Culture CollectionATCC 49456 
Streptococcus sanguinisBCCM/LMG Bacteria CollectionLMG 14657 
Veillonella parvulaLeibniz Institute DSMZ-German Collection of Microorganisms and Cell CulturesDSM 2007 
Streptococcus gordoniiAmerican Type Culture CollectionATCC 49818 
CELL LINES   
Caco-2 cellsEuropean Collection of Authenticated Cell Cultures86010202 
HT29-MTX cellsEuropean Collection of Authenticated Cell Cultures12040401 
REAGENTS AND CONSUMABLES   
Brain Heart Infusion (BHI) brothOxoidCM1135 
Blood Agar 2OxoidCM0055Blood Agar medium
MenadioneSigmaM9429 
HeminSigmaH9039 
5% sterile defibrinated horse bloodE&O Laboratories Ltd,P030 
InnuPREP PCRpure KitAnalytik Jena845-KS-5010250PCR purification kit
Big DyeApplied Biosystems4337454Dye for sequencing
ABI Prism BigDye Terminator v3.1 cycle sequencing kitApplied Biosystems4337456 
SYBR Green IInvitrogenS7585 
Propidium IodideInvitrogenP1304MP 
T25 culture flasks uncoated, cell-culture treated, vented, sterileVWR734-2311 
Trypsin-EDTA solutionSigma-AldrichT3924-100ML 
Trypan Blue solution0.4%, liquid, sterile-filteredSigma-AldrichT8154 
Phosphate buffered-saline (PBS)Gibco14190250 
DMEM cell culture media, with GlutaMAX and PyruvateLife technologies31966-047 
Corning Transwell polyester membrane cell culture insertsSigma-AldrichCLS3450-24EA 
Mucin from porcine stomach Type IISigma-AldrichM2378 
Inactivated fetal bovine serumGreiner Bio One758093 
Antibiotic-Antimycotic (100X)Gibco15240062 
Triton X 100 for molecular biologySigma-AldrichT8787 
DPBS without calcium, magnesiumGibco14190-250 
Pierce LDH Cytotoxicity Assay KitThermo Fisher Scientific88953 
Corning HTS Transwell-24 well, pore size 0.4 µmCorning Costar Corp3450 
Nuclease-free waterServa Electrophoresis28539010 
EQUIPMENT   
Neubauer counting chamber improvedCarl RothT729.1 
BD Accuri C6 Flow cytometerBD Biosciences653118 
PowerLyzer 24 HomogenizerMoBio13155 
T100 Thermal CyclerBioRad186-1096 
Flush systemCustom made- 
InnOva 4080 Incubator ShakerNew Brunswick Scientific8261-30-1007Shaker for 2.10
Memmert CO₂ incubatorMemmert GmbH & Co.ICO150med 
Millicell ERS (Electrical Resistance System)EMD Millipore, Merck KGaAMERS00002 
Millipore Milli-Q academic, ultra pure water systemMillipore, Merck KGaA- 
Shaker (ROCKER 3D basic)IKA4000000Shaker for 6.10

Trefwoorden

Bacteri le internalisatieCaco 2 HT29 MTX co cultuurtransepitheliale elektrische weerstandsolubilisatie van mucuscellysisanalysegesimuleerd darmvloeistofassay voor bacteri le levensvatbaarheidTriton X 100 behandeling