Chip-Based Digital PCR to Detect Rare Transcript Variants Using a Nanofluidic Chip

Abstract

Source: Molinari, C., et al. Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR. J. Vis. Exp. (2018).

This video demonstrates chip-based digital PCR — a variation of the digital PCR technique that is useful in detecting rare transcript variants. The PCR reaction is partitioned into the chambers of a nanofluidic chip, each of which acts as an independent reaction. The detection of fluorescence signals from the chambers with amplified targets confirms the presence of rare transcript variants in the sample.

Protocol

All procedures involving human participants have been performed in compliance with the institutional, national, and international guidelines for human welfare and have been reviewed by the local institutional review board.

NOTE: This procedure is specifically designed for the detection of a low number of cDNA molecules in human fresh-frozen tissues. The tissue sections have been cut on dry ice, while still frozen, from previously validated patient-derived gastric tumor or normal tissue samples.

1. RNA Isolation and Purification

1. RNA extraction
   Note:

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
TRIazol Reagent	Thermo Fisher Scientific	15596018
Glycogen 20 mg/ml	ROCHE	10901393001
RNeasy MinElute Cleanup kit	QIAGEN	74204
iScript cDNA Synthesis kit	BioRad	1708891
QuantStudio 3D Digital PCR Master Mix v2	Thermo Fisher Scientific	A26358
CDH1a IDT custom designed assay	Integrated DNA Technologies (IDT)	NA	F) GCTGCAGTTTCACTTTTAGTG (R) ACTTTGAATCGGGTGTCGAG (P)/FAM/CGGTCGACAAAGGACAGCCTATT/TAMRA/ [dPCR optimized assay concentrations: 900 nM (F), 900 nM (R), 250 nM (P)]
QuantStudio 3D Digital PCR 20K Chip Kit v2	Thermo Fisher Scientific	A26316
Heraeus Biofuge Fresco	Thermo Scientific	75002402
Thermocycler (Labcycler)	Sensoquest	011-103
GeneAmp PCR System 9700	Thermo Fisher Scientific	N805-0200
Dual Flat Block Sample Module	Thermo Fisher Scientific	4425757
QuantStudio 3D Tilt Base for Dual Flat Block GeneAmp PCR System 9700	Thermo Fisher Scientific	4486414
QuantStudio 3D Digital PCR Chip Adapter Kit for Flat Block Thermal Cycler	Thermo Fisher Scientific	4485513
QuantStudio 3D Digital PCR Chip Loader	Thermo Fisher Scientific	4482592
QuantStudio 3D Digital PCR Instrument with power cord	Thermo Fisher Scientific	4489084