Een abonnement op JoVE is vereist om deze inhoud te bekijken. Log in of start vandaag met uw gratis proefperiode.

Methodenartikel

Chromatin Immunoprecipitation to Identify Target Protein Binding Sites on Genomic DNA

1.3K weergaven

8 juli 2025

In dit artikel

Samenvatting

Source: Dong, X., et.al., Identifying Transcription Factor Olig2 Genomic Binding Sites in Acutely Purified PDGFRα+ Cells by Low-cell Chromatin Immunoprecipitation Sequencing Analysis. J. Vis. Exp. (2018)

In this video, we demonstrate the chromatin immunoprecipitation technique to identify protein binding sites on specific regions of the genomic DNA of oligodendrocyte precursor cells via the selective immunoprecipitation of protein-bound chromatin fragments. This method helps to study the interaction of several regulatory proteins, including transcription factors involved in gene regulation.

Protocol

All procedures involving animal models have been reviewed by the local institutional animal care committee and the JoVE veterinary review board.

1. Purification of PDGFRα Positive Oligodendrocyte Lineage Cells from Mouse Brain (modified from previously described immunopanning protocols)

  1. Preparation of an immunopanning plate for PDGFRα positive cell selection and 2 plates for the depletion of endothelial cells and microglia.
    NOTE: Please note that Petri dishes but not cell culture dishes work for immunopanning experiment; if the purified cells will be used for culturing, immunopanning steps must be carried out in the biosafety cabinet
    1. Coat a 10 cm Petri plate with 30 µL goat anti-rat IgG in 10 mL of pH 9.5, 50 mM Tris-HCl overnight at 4 °C. Agitate the plate to make sure the surfaces of the plates are evenly and entirely covered by the coating solution.
    2. Prepare PDGFRα antibody solution by diluting 40 µL of rat anti-PDGFRα antibody with 12 mL of Dulbecco's phosphate-buffered saline (DPBS) containing 0.2% BSA.
    3. After 3 washes of IgG-coated plate with 10 mL 1x DPBS each, incubate IgG-coated plate with PDGFRα antibody solution at room temperature for 4 h.
    4. Wash the rat anti-PDGFRα antibody-coated plate 3 times with 10 mL 1x DPBS each. Gently add DPBS solution along the side wall of the plate and do not disturb the coated surfaces.
    5. Coat 2 new 15 cm Petri plates for the depletion of endothelial cells and microglia with 20 mL of DPBS containing 2.3 µg/mL of Banderiaea simplicifolia lectin 1 (BSL-1) for 2 h.
    6. Wash the BSL-1 coated plates 3 times with 20 mL 1x DPBS. Gently add DPBS solution along the side wall of the plates and do not disturb the coated surfaces.
  2. Purification of PDGFRα positive oligodendrocyte lineage cells is modified from previously published methods.
    1. Dissect the cortical tissues from 2 postnatal day 7 (P7) mouse brains according to previously published protocols.
    2. Dissociate the tissues to generate a single-cell suspension with a neural tissue dissociation Kit (P) according to detailed manufacturer's instructions.
    3. Briefly, cut the dissected cortical tissues into pieces with a scalpel and subject them to enzymatic digestion at 37 °C. After digestion, manually dissociate the pieces with Fire-polished glass Pasteur pipettes into a single-cell suspension.
    4. Centrifuge the single-cell suspension at 300 x g for 10 min at room temperature and suspend the cell pellet using 15 mL of immunopanning buffer (immunopanning buffer is DPBS with 0.02% BSA and 5 µg/mL insulin).
    5. Incubate the single-cell suspension from 2 mouse brains sequentially on 2 BSL-1 coated plates for 15 min at room temperature with gentle agitation of the plate every 5 min to ensure a better depletion of microglia and endothelial cells.
    6. Gently swirl the plate to collect the non-adherent cells in the cell suspension and incubate them on the rat-PDGFRα antibody-coated plate for 45 min at room temperature.
    7. After the incubation of the cell suspension on the rat-PDGFRα antibody-coated plate, gently swirl the plate to collect the cell suspension, and rinse the plate 8 times with DPBS to get rid of non-adherent cells. Gently add wash solution along the side wall of the plate and agitate the plate several times to get rid of non-adherent cells.
    8. Detach the cells from the rat-PDGFRα antibody coated plate using a 4 mL of cell detachment solution treatment for 10 min at 37 °C. Shake the plate to dislodge adherent cells.
    9. Collect the purified OPCs by centrifugation at 300 x g at room temperature, suspend the cell pellet with 2 mL OPC cell culture medium, and count the cells by using trypan blue and a hemocytometer (500 mL cell culture medium in DMEM/F12 medium containing 5 mL penicillin-streptomycin solution (P/S), 5 mL N2, 10 mL B27, 5 µg/mL insulin, 0.1% BSA, 20 ng/mL bFGF and 10 ng/mL PDGFRα).
  3. Validation of the purity of OPCs after immunopanning.
    1. In order to evaluate the enrichment of OPCs after immunopanning, use some of the purified OPCs for RNA extraction with a guanidium thiocyanate-based extraction according to the manufacturer's instructions.
    2. Perform qRT-PCR by using fluorescent green dye master mix to check for the enrichment of PDGFRα expression in purified OPCs as compared with dissociated brain cells according to the previously published materials.
    3. Additionally, seed some purified OPCs into the Poly-D-Lysine coated 24 well plates for immunostaining with anti-NG2 chondroitin sulfate proteoglycan (NG2) antibody as previously published materials.

2. Low-cell ChIP Preparation and ChIP Library Construction for High-Throughput Sequencing

  1. Olig2 Low-cell ChIP preparation with a commercially available sonication system and a commercially available low-cell number ChIP kit (see Table of Materials) by following the detailed standard procedures from the manufacturer's instructions.
    1. After detaching from the rat anti-PDGFRα antibody-coated plate and the cell counting with trypan blue and a hemocytometer put 20,000 purified OPCs in 1 mL OPC cell culture medium for each ChIP reaction.
    2. Add 27 µL of 36.5% formaldehyde to fix cell suspension for 10 min at room temperature.
      Caution: Please note that formaldehyde must be used in the chemical fume hood for safety reasons.
    3. Stop DNA-protein cross-linking with 50 µL 2.5 M glycine for 5 min at room temperature.
      NOTE: All steps must be carried out on ice or in a 4 °C cold room from this point.
    4. Wash the cross-linked cell pellets with 1 mL of ice-cold Hanks' Balanced Salt Solution (HBSS) with protease inhibitor cocktail and get cells pelleted by a pre-cooled centrifuge at 300 x g at 4 °C.
    5. Lyse the cell pellet in 25 µL complete Lysis Buffer for 5 min on ice.
      NOTE: Agitate the tube to suspend the cells in Lysis Buffer.
    6. Supplement the cell lysate with 75 µL ice-cold HBSS containing protease inhibitor cocktail and shear the chromatin of cell lysate by pre-cooled sonication system with 5 cycles of 30 s ON and 30 s OFF program. Always sonicate 6 tubes together and make sure the balance tubes contain 100 µL water.
    7. After shearing, centrifuge at 14,000 x g for 10 min at 4 °C and collect supernatant in a new tube after centrifugation.
    8. Dilute 100 µL of sheared chromatin with an equal volume of ice-cold complete ChIP Buffer with the protease inhibitor.
    9. Save 20 µL of the diluted sheared chromatin as Input control sample.
      NOTE: Input control sample is also required as the comparison to Olig2 immunoprecipitated sample to identify Olig2 antibody immunoprecipitated DNA.
    10. Add 1 µL of rabbit anti-olig2 antibody to 180 µL of the diluted sheared chromatin and incubate the reaction tube on a rotating wheel at 40 rpm for 16 h at 4 °C.
      NOTE: Perform this step in a cold room.
    11. For each ChIP reaction, wash 11 µL magnetic protein A-coated beads with 55 µL Beads Wash Buffer and put the bead pellet in 11 µL of bead wash buffer after 2 washes.
      NOTE: Perform this step in a cold room.
    12. For each ChIP reaction, add 10 µL of pre-washed Protein A-coated beads to the ChIP reaction tube. Perform this step in a cold room.
    13. Incubate the ChIP reaction tube at 4 °C for another 2 h on a rotating wheel.
    14. Put the ChIP reaction tube on the magnetic rack for 1 min.
      NOTE: Perform this step in a cold room.
    15. Remove the supernatant and don't dislodge the bead pellet.
    16. Wash the bead pellet with 100 µL for each of the 4 wash buffers respectively for 4 min on a rotating wheel at 4 °C.
    17. After washes, add 200 µL of elution buffer to the bead pellet and incubate the ChIP reaction tube at 65 °C for 4 h to reverse cross-link protein-DNA.
    18. Additionally, add 180 µL of elution buffer to 20 µL Input control sample and incubate at 65 °C for 4 h to reverse cross-link protein-DNA as well.
    19. Add 200 µL 25:24:1 (v/v) mixture of phenol, chloroform, and isoamyl alcohol to each ChIP reaction tube.
    20. Vortex vigorously for 1 min and centrifuge at 13,000 x g for 15 min at room temperature. Transfer the upper phase to a new tube.
    21. Add 40 µL 3 M sodium acetate solution, 1,000 µL of 100% ethanol, and 2 µL of glycogen precipitant covalently linked to a blue dye to each ChIP reaction tube overnight at -20 °C.
    22. Centrifuge at 13,000 x g for 20 min at 4 °C.
    23. Discard the supernatant, wash with 500 µL cold 70% ethanol, and centrifuge at 13,000 x g for 20 min at 4 °C.
    24. Discard the supernatant, keep the pellet air dry for 10 min, and dissolve the pellet with 50 µL water.
  2. ChIP library construction for high-throughput sequencing
    1. Clean and concentrate the ChIP DNA with a clean-up kit according to the manufacturer's instructions.
    2. Quantify the ChIP sample with a pico-green according to the manufacturer's instructions.
    3. Use a ChIP-seq kit for T-tailing, replication, and tailing, template switching and extension, the addition of adapters and amplification, library size selection, and purification according to the manufacturer's instructions.
      1. After denaturation of dsDNA, dephosphorylate the 3' end of ssDNA by shrimp alkaline phosphatase and add a poly (T) tail to the ssDNA by terminal deoxynucleotidyl transferase.
      2. Anneal the DNA Poly (dA) Primer to the ssDNA template for the DNA replication and template switching.
      3. After template switching, amplify the ChIP-seq library by PCR with the forward and reverse primers for indexing.
      4. Select the PCR amplified ChIP-seq library with fragments ranging from 250 to 500 bp by paramagnetic beads by option 2 for double size selection.
      5. Examine the quality of the selected ChIP-seq library using a microfluidic chip-capillary electrophoresis device.

Toegang beperkt. Log in of start een proefperiode om deze inhoud te bekijken.

Openbaarmakingen

No conflicts of interest declared.

Materialen

Lijst van materialen gebruikt in dit artikel
NaamBedrijfCatalogusnummerOpmerkingen
Reagent/ Equipment
Banderiaea simplicifolia lectin 1Vector Laboratories# L-1100
Rat anti-PDGFRa antibodyBD Bioscience# 558774
Neural tissue dissociation Kit (P)MACS Miltenyi Biotec# 130-092-628
AccutaseSTEMCELL technologies# 07920
TRIzolThermo Fisher# 15596026
Anti-NG2 Chondroitin Sulfate Proteoglycan AntibodyMillipore# AB5320
Bioruptor Pico sonication deviceDiagenode# B01060001
True MicroChIP kitDiagenode# C01010130
Phenol:Chloroform:Isoamyl Alcohol (25:24:1, v/v)Thermo Fisher# 15593031
NucleoSpin Gel and PCR Clean-Up kitMACHEREY-NAGEL# 740609
Quant-iT PicoGreen dsDNA Assay KitThermo Fisher# P11496
DNA SMART ChIP-Seq kitClontech Laboratories# 634865
Agencourt AMPure XPBeckman Voulter# A63880
GlycoBlueThermo Fisher# AM9516
Pico-greenThermo Fisher# P11496
D-PBSThermo Fisher# 14190-144
SYBR Green master mixBio-Rad Laboratories# 1725124
DMEM/F12Fisher Scientific# 11-320-033
Penicillin-Streptomycin (P/S)Fisher Scientific# 15140122
N-2 SupplementFisher Scientific# 17502048
B-27 SupplementFisher Scientific# 17504044
InsulinSigma# I6634Prepare 0.5 mg/ml insulin solution by dissolving 5 mg insulin in 10 ml water and 50 μl of 1 N HCl.
Bovine Serum Albumin, suitable for cell culture (BSA)Sigma# A4161Prepare 4% BSA solution by dissolving 4 g BSA in 100 ml D-PBS and adjust the pH to 7.4
Fibroblast Growth Factor basic Protein, Human recombinant (bFGF)EMD Millipore# GF003
HUMAN PDGF-AAVWR# 102061-188
Poly-D-lysineVWR# IC15017510Prepare 1 mg/ml poly-D-lysine solution by dissolving 10 mg poly-D-lysine in 10 ml water and dilute 100 times when using.
Falcon Disposable Petri Dishes, Sterile, Corning, 100x15mmVWR# 25373-100
Falcon Disposable Petri Dishes, Sterile, Corning, 150x15mmVWR# 25373-187
HBSS, 10X, no Calcium, no Magnesium, no Phenol RedFisher Scientific# 14185-052
Trypan BlueStemcell Technologies# 07050
Protease inhibitor cocktailSigma# 11697498001
Primer names used for qPCRPrimer sequences used for qPCR
Mbp-F:CTATAAATCGGCTCACAAGG
Mbp-R:AGGCGGTTATATTAAGAAGC
Iba1-F:ACTGCCAGCCTAAGACAACC
Iba1-R:GCTTTTCCTCCCTGCAAATCC
Mog-F:GGCTTCTTGGAGGAAGGGAC
Mog-R:TGAATTGTCCTGCATAGCTGC
GAPDH-FATGACATCAAGAAGGTGGTG
GAPDH-RCATACCAGGAAATGAGCTTG
Tuj1-FTTTTCGTCTCTAGCCGCGTG
Tuj1-RGATGACCTCCCAGAACTTGGC
PDGFRα-FAGAGTTACACGTTTGAGCTGTC
PDGFRα-RGTCCCTCCACGGTACTCCT

Trefwoorden

Oligodendrocyten precursorcellenprote ne DNA bindingtranscriptiefactor Olig2chromatin shearingantilichaam immunoprecipitatiemagnetische bolletjes separatieDNA fragmentamplificatiegenomische sequentieanalyselow cell ChIP