Methodenartikel

Using DNA-Based Tension Probes to Assess Receptor Forces Applied by Immune Cells

8 juli 2025

In dit artikel

Samenvatting

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Source: Ma, R. et al., DNA Tension Probes to Map the Transient Piconewton Receptor Forces by Immune Cells. J. Vis. Exp. (2021)

The video demonstrates a method for assessing receptor forces applied by immune cells using polyethylene glycol-anchored gold nanoparticles and DNA hairpin tension probes. CD8-positive T cell interactions trigger probe unfolding, emitting fluorescence while locking strands sustain the signal for quantifying the forces applied by immune cells.

Protocol

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

1. Oligonucleotide preparation

  1. Dissolve the ligand strand deoxyribonucleic acid (DNA) in water (18.2 MΩ resistivity, used throughout the whole protocol). Vortex and spin down the solution with a tabletop centrifuge. Tune the volume of water such that the final concentration is 1 mM. Validate the concentration by using a nanodrop spectrophotometer to measure the absorbance at 260 nm and determine the final concentration based on the extinction coefficient of the oligonucleotide.
    NOTE: The ligand strand has a modification at each terminus, 5' amine, and 3' biotin, to conjugate with the fluorophore and to present the biotinylated ligand. The amine group in the ligand strand needs to be conjugated with a fluorophore. Cy3B dye is used for this conjugation due to its high brightness and photostability, but it is not generally offered commercially and requires in-house conjugation. Accordingly, the following section describes the conjugation between amines and N-hydroxysuccinimide (NHS) ester dyes. For end users who do not have access to facilities or resources for nucleic acid modification, modified nucleic acids can instead be purchased from custom DNA synthesis vendors that offer bright and photostable dyes, such as the Alexa and Atto family of dyes.
  2. Prepare 10x phosphate-buffered saline (PBS) and 1 M sodium bicarbonate (NaHCO3) solutions. Mix 10 µL of the 1 mM amine ligand strand solution (10 nmol) with 10 µL of 10x PBS, 10 µL of 1 M NaHCO3, and 60 µL of H2O. Dissolve 50 µg of Cy3B N-hydroxysuccinimide (NHS ester) in 10 µL of dimethyl sulfoxide (DMSO) immediately before use and add to the mixture for a total reaction volume of 100 µL. Add Cy3B NHS ester last. Allow to react at room temperature for 1 h or 4 °C overnight.
  3. Prepare the Atto647N locking strand by conjugating the amine locking strand with the Atto647N NHS ester. Prepare 10x PBS and 1 M NaHCO3 solution. Mix 10 µL of the 1 mM amine locking strand solution (10 nmol) with 10 µL of 10x PBS, 10 µL of 1 M NaHCO3, and 60 µL of H2O. Dissolve 50 µg of Atto647N NHS ester in 10 µL of DMSO immediately before use and add to the mixture for a total reaction volume of 100 µL. Add Atto647N NHS ester last. Allow to react at room temperature for 1 h or 4 °C overnight.
  4. After the reactions, remove by-products, excess dye, and salts by P2 desalting gel filtration. Dilute the reaction mixture with H2O to a total volume of 300 µL, which is appropriate for the subsequent High-Performance Liquid Chromatography (HPLC) purification step. Add 650 µL of hydrated P2 gel to a centrifugal device and spin down at 18,000 x g for 1 min. Remove the liquid at the bottom of the device, add the reaction mixture to the column containing P2 gel, spin down at 18,000 x g for 1 min, and collect the reaction mixture at the bottom of the device.
    NOTE: P2 gel should be hydrated at least 4 h before use with H2O.
  5. Purify the desalted reaction mixture with HPLC using a C18 column designated for oligonucleotide purification, with solvent A: 0.1 M triethylammonium acetate (TEAA) in H2O and B: acetonitrile (ACN) as the mobile phase for a linear gradient elution 10-100% B over 50 min at a flow rate of 0.5 mL/min. Inject the desalted reaction mixture in reverse-phase HPLC with a 500 µL injection loop for purification. Collect the product that has an absorbance peak for the deoxyribonucleic acid, DNA (260 nm), and an absorbance peak for the fluorophore (560 nm for Cy3B and 647 nm for Atto647N) and dry them in a vacuum centrifugal concentrator overnight (see Figure 1A).
  6. Reconstitute the dried oligo-dye product in 100 µL water. Determine the concentration of the Cy3B ligand strand and Atto647N locking strand with the nanodrop spectrophotometer. Ensure that the dye labeling ratio is close to 1:1. Correct for the 260 nm absorbance of the dye if needed when determining the oligonucleotide concentration.
  7. Validate the purified product with matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF-MS) using 3-Hydroxypropionaldehyde (3-HPA) as the substrate in 50% ACN/H2O with 0.1% trifluoracetic acid (TFA) and 5 mg/mL ammonium citrate using 0.5 µL of the product at 1-5 µM for MALDI-TOF-MS sample preparation. An example mass spectrum can be found in Figure 1B.
  8. Dissolve the hairpin strand and the quencher anchor strand in water and make sure the concentration of the stock solutions is between 50 and 100 µM.
    NOTE: The hairpin strand is unmodified and can be directly custom-synthesized from a vendor. The anchor strand has a thiol anchoring group and a quencher BHQ2 and can be directly custom synthesized from a vendor.
  9. Aliquot all of the oligonucleotides. For short-term use and storage, store these oligonucleotides at 4 °C. For long-term storage, freeze and keep them at -20 °C. At this point, all of the oligonucleotides are ready for the DNA tension probe assembly.
    NOTE: Repeated freeze-thaw cycles are not problematic for oligonucleotides.

2. Surface preparation

NOTE: The preparation of DNA hairpin tension probe substrates takes two days. The DNA hairpin tension probe will be functionalized onto glass coverslips.

  1. Day 1
    1. Place the 25 mm coverslips on a polytetrafluoroethylene rack in a 50 mL beaker. Each rack can hold up to 8 coverslips. Rinse the coverslips by submerging them in water three times.
    2. Add 40 mL of a 1:1 ratio (v:v) solution of ethanol mixed with water to the beaker containing the rack and coverslips, and seal the beaker using a paraffin film.
    3. Sonicate the beaker for 15 min in an ultrasonic cleaner (operating frequency 35 KHz) to clean the coverslips. After sonication, discard the liquid and rinse the beaker with the rack and coverslips in it with water at least 6 times to remove any remaining organic solvent.
    4. Prepare fresh Piranha solution by mixing sulfuric acid and hydrogen peroxide in a ratio of 3:1. To make 40 mL of Piranha solution, add 30 mL of sulfuric acid to a clean 50 mL beaker first and then slowly add 10 mL of hydrogen peroxide, H2O2. The Piranha solution will rapidly heat and bubble upon the addition of the H2O2. Gently mix the piranha using the end of a glass pipette.
    5. Next, transfer the rack that holds the coverslips to the beaker containing gently mixed Piranha solution for etching (Figure 2A). Allow the Piranha solution to hydroxylate and clean the coverslips for 30 min at room temperature. After Piranha etching, transfer the rack using steel or polytetrafluoroethylene tweezers to a clean 50 mL beaker with water and rinse again with water at least 6 times.
      CAUTION: Large amounts of organic substances could react vigorously with Piranha solution and may cause an explosion. Be careful and always work with Piranha solution in a fume hood. Make sure to wear a lab coat, gloves, and safety goggles. Never store fresh Piranha solution in a sealed container.
      NOTE: The hydrogen peroxide to sulfuric acid ratio should be kept under 1:2 (v:v) and should never exceed 1:1. When submerging the rack with coverslips in Piranha solution, place them in the solution slowly and carefully. Do not discard the solution immediately after etching, as it is still active and hot. Leave it in the beaker overnight before pouring it into the acid waste container.
    6. Immerse the rack holding the coverslips in a 50 mL beaker with 40 mL ethanol to remove water. Discard the ethanol and repeat 3 times to ensure that the water has been removed.
    7. Then immerse the rack in 3% aminopropyl triethoxy silane (APTES) (v/v) in 40 mL of ethanol to react with the -OH on the coverslips for 1 h at room temperature (Figure 2B).
      NOTE: Ethanol can be replaced by acetone.
    8. Rinse surfaces 6 times by submerging them into 40 mL ethanol, then dry in the oven at 80 °C for 20 min. After cooling, store the dried amine-modified coverslips at -20 °C for future use (up to 6 months).
    9. Cover the bottom inner side of 10 cm diameter plastic Petri dishes with paraffin film. The paraffin film prevents the coverslips from sliding inside the Petri dish and helps keep the solution for the next steps of functionalization on the coverslips. Place the cooled-down amine-modified coverslips in the Petri dishes. The side to be functionalized should be facing up.
    10. To modify the amine groups on the coverslips, add 300 µL of 0.5% w/v lipoic acid poly(ethylene glycol) (PEG) NHS (LA-PEG-SC) and 2.5% w/v mPEG NHS (mPEG-SC) in 0.1 M NaHCO3 onto each coverslip and incubate for 1 h at room temperature (Figure 2C). For each 25 mm coverslip, weigh 1.5 mg of LA-PEG-SC and 7.5 mg of mPEG-SC. Dissolve the NHS reagents immediately before adding them to the surfaces, as they have a short half-life (~10 min) in an aqueous solution at room temperature. After the reaction, rinse surfaces 3 times with water.
      NOTE: The NHS reaction can be performed at 4 °C overnight. NHS reagents have a longer half-life before hydrolysis at 4 °C, which is around 4-6 h. This will result in a three-day surface prep procedure.
    11. Add 100 µL of 0.1 M sodium bicarbonate, NaHCO3 containing 1 mg/mL of sulfo-NHS acetate to a set of "sandwich" coverslips (two coverslips facing towards each other with reaction buffer in between). Allow passivation to occur for at least 30 min. To save the reagent, this step could be done with 50 µL of 1 mg/mL sulfo-NHS acetate. Rinse with water three times after passivation.
    12. Add 0.5 mL of gold nanoparticles (AuNP, 8.8 nm, tannic acid, 0.05 mg/mL) to each coverslip and incubate for 30 min at room temperature (Figure 2D). To save the reagent, this step can be done by sandwiching two coverslips as well. Make sure no salts are present in the system from previous steps to avoid aggregation of gold nanoparticles. Do not leave the coverslips to dry after this step.
    13. Meanwhile, pre-hybridize 4.7 pN hairpin, Cy3B ligand strand, and BHQ2 anchor strand that form the DNA tension probes construct at a ratio of 1.1:1:1 in 1 M sodium chloride (NaCl) at 300 nM in a polymerase chain reaction (PCR) tube. Anneal the strands by heating the solution up to 95 °C for 5 min, then gradually cool down by decreasing the temperature to 20 °C over 30 min in a thermal cycler.
    14. Rinse the coverslips with water three times after 30 min of incubation with gold nanoparticles. Add an additional BHQ2 anchor strand (from 100 µM stock) to the annealed DNA solution to make the ratio between the BHQ2 anchor strand and Cy3B ligand strand 10:1. At this point, the DNA solution should contain 300 nM of tension probe construct and 2.7 µM BHQ2 strand. Add 100 µL per two coverslips to make the "sandwich" (Figure 2E).
    15. Carefully place a wet lab tissue ball in the Petri dish (away from coverslips) and seal the dish with paraffin film to prevent the solution from drying up. Cover the dish with foil and incubate at 4 °C overnight.
  2. Day 2
    1. Wash off the excess probes from the coverslips with 1x PBS. Check for DNA tension probe surface quality under an epifluorescent microscope.
    2. Prepare 40 µg/mL of streptavidin in 1x PBS and incubate on coverslips for 30 min at room temperature (Figure 2F). Usually, 100 µL is sufficient for a 25 mm coverslip. Rinse with PBS 3 times after incubation to wash away the excess amount of streptavidin.
    3. Prepare 40 µg/mL biotinylated antibody/ligand in 1x PBS. Add 50-100 µL per sandwich and incubate for 30 min at room temperature (Figure 2G). Rinse with PBS three times after incubation to wash away the excess amount of biotinylated antibody/ligand.
    4. Assemble the clean imaging chambers with surfaces carefully. Surfaces can be easily cracked when tightening the chambers. Add 0.5-1 mL of Hank's balanced salt solution (HBSS) to the imaging chambers and keep them ready for imaging with cells (Figure 2H).

3. Imaging cell receptor forces

  1. Prepare immune cells of interest in HBSS at 1-2 x 106 cells/mL.
    NOTE: OT-1 CD8+ naïve cells are used as an example in this paper. Purify OT-1 CD8+ naïve T cells from the spleens of sacrificed mice using the MACS mouse CD8+ T cell isolation kit with a magnetic-activated cell sorting (MACS) separator following the manufacturer's instructions. Isolate and enrich the CD8+ T cells by removing any non-CD8+ T cells that magnetic-depleting antibody cocktail bound to. Resuspend purified OT-1 CD8+ naïve T cells in HBSS at 2 x 106 cells/mL and keep on ice prior to use.
  2. Check the quality of the DNA hairpin tension probe surface under a fluorescence microscope (100x objective) for quality control before adding ligands or plating cells. Image and quantify the average background intensity in the Cy3B channel of a DNA hairpin tension probe surface from at least 5 different positions and 3 replicates. Keep the imaging acquisition conditions consistent so that this value can be used as a reliable marker of surface quality and probe density (Figure 3C).
    NOTE: Quantify the number of DNA strands per gold nanoparticle and the number of gold nanoparticles per µm2 the first few times of surface preparation according to literature, which can be used as another reliable marker of surface quality.
  3. Plate ~4 x 104 - 10 x 104 cells onto each DNA tension probe functionalized coverslip and allow them to attach and spread for ~15 min at room temperature.
  4. As cells are plated onto the DNA hairpin tension probes and start to spread, image the fluorescence signals that are generated in the Cy3B channel with the 100x objective (Figure 2I).
  5. After cells start to produce real-time tension signal on the DNA hairpin tension probe surface in the Cy3B channel, acquire images in both Cy3B and Atto647N channels (Total internal reflection fluorescence (TIRF) microscopy gives better signal-to-noise ratio than epifluorescence). Subsequently, add the Atto647N strand to the imaging chambers at a final concentration of 200 nM for mechanically selective hybridization.
  6. After 10 min of incubation, quickly and gently remove the buffer containing the fluorescent Atto647N locking strand and replace it with fresh Hank's balanced salts. Image in both Cy3B and Atto647N channels again and determine the Pearson's correlation coefficient with Fiji software.
  7. At the time point of interest for the investigation, introduce a non-fluorescent locking strand to the cells in the imaging chamber to store the tension signal. Prepare locking strand stock (100 µM) and add to the cells at a final concentration of 1 µM. Gently pipette to mix. The duration of locking can vary but 10 min is the recommended time.
  8. Acquire time-lapse movies or end-point images in epifluorescence for both qualitative tension mapping and quantitative analysis as needed (Figure 2J and Figure 4).
    NOTE: If tension measurement at multiple time points is desired, initiate erasing of stored tension signals by the addition of an unlocking strand. To avoid excess rinsing, a higher final concentration of the unlocking strand at 2 µM is used to initiate a toehold-mediated strand displacement reaction with the locking strand for 3 min, which erases the stored signals (Figure 2J). Gently rinse the excess oligonucleotides off with HBSS. The DNA hairpin tension probe surface and the cells are ready for another round of tension storing and mapping. Unlocking tension signals is not necessary if only one time point is of interest in the study.

Toegang beperkt. Log in of start een proefperiode om deze inhoud te bekijken.

Resultaten

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Cy3B ligand strand analysis: absorbance graph (260 nm, 560 nm), mass spectrum, mass vs. error table.
Figure 1: Examples of oligonucleotide preparation. (A) HPLC chromatogram of Cy3B ligand strand purification; (B) MALDI-TOF-MS spectra of the product; (C) Table of the calculated mass and found m/z peaks...

Toegang beperkt. Log in of start een proefperiode om deze inhoud te bekijken.

Openbaarmakingen

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,
No conflicts of interest declared.

Materialen

Lijst van materialen gebruikt in dit artikel
NaamBedrijfCatalogusnummerOpmerkingen
3-hydroxypicolinic acid (3-HPA)Sigma56197Maldi-TOF-MS matrix
mPEG-SCBiochempegMF001023-2KSurface prep
(3-Aminopropyl)triethoxysilaneAcrosAC430941000Surface prep
10x Red blood cell lysis bufferBiolegend00-4333-57Buffer
8.8 nm gold nanoparticles, tannic acidNanocomposixcustomized orderSurface prep
Atto647N NHS esterSigma18373-1MG-FFluorophore, oligo prep
Attofluor Cell Chamber, for microscopyThermo Fisher ScientificA7816Imaging
BD Syringes only with Luer-LokBD bioscience309657Cells
Biotinylated anti-mouse CD3eebioscience13-0031-82Antibody/ligand
Biotinylated pMHC ovalbumin (SIINFEKL)NIH Tetramer Core Facility at Emory UniversityNAAntibody/ligand
Bovine serum albuminSigma735078001Block non-specific interactions
Cell strainersBiologix15-1100Cells
Coverslip Mini-Rack, teflonThermo Fisher ScientificC14784Surface prep
Cy3B NHS esterGE HealthcarePA63101Fluorophore, oligo prep
Dulbecco's phosphate-buffered saline (DPBS)Corning21-031-CMBuffer
EthanolSigma459836Surface prep
Hank's balanced salts (HBSS)SigmaH8264Buffer
Hydrogen peroxideSigmaH1009Surface prep
LA-PEG-SCBiochempegHE039023-3.4KSurface prep
Midi MACS (LS) startup kitMiltenyi Biotec130-042-301Cells
Mouse CD8+ T cell isolation kitMiltenyi Biotec130-104-075Cells
Nanosep MF centrifugal devicesPall laboratoryODM02C35Oligo prep
No. 2 round glass coverslipsVWR48382-085Surface prep
NTA-SAMDojindo Molecular TechnologiesN475-10Surface prep
P2 gelBio-rad1504118Oligo prep
Sulfuric acidEMD Millipore CorporationSX1244-6Surface prep
Sulfo-NHS acetateThermo Fisher Scientific26777Surface prep
Equipment
Agilent AdvanceBio Oligonucleotide C18 column, 4.6 x 150 mm, 2.7 μm653950-702Oligonucleotide preparation
Barnstead Nanopure water purifying systemThermo FisherWater
CFI Apo 100× NA 1.49 objectiveNikonMicroscopy
Cy5 cubeCHROMAMicroscopy
Evolve electron multiplying charge coupled device (EMCCD)PhotometricsMicroscopy
High-performance liquid chromatographyAgilent 1100Oligonucleotide preparation
Intensilight epifluorescence sourceNikonMicroscopy
Matrix-assisted laser desorption/ionization time-of-flight mass spectrometer (MALDI-TOF-MS)Voyager STROligonucleotide preparation
Nanodrop 2000 UV-Vis SpectrophotometerThermo FisherOligonucleotide preparation
Nikon Eclipse Ti inverted microscopeNikonMicroscopy
Nikon Perfect Focus SystemNikonMicroscopy
NIS Elements softwareNikonMicroscopy
Quad band TIRF 405/488/561/647 cubeCHROMAMicroscopy
RICM cubeCHROMAMicroscopy
TIRF launcher with 488 nm (50 mW), 561 nm (50 mW), and 640 nmCoherentMicroscopy
TRITC cubeCHROMAMicroscopy
Oligo name5' modification / 3' modificationSequence (5' to 3')Use
15mer amine locking strand5' modification: no modification
3' modification: /3AmMO/
AAA AAA CAT TTA TAC CCT ACC TALocking real-time tension signal
15mer Atto647N locking strand5' modification: Atto647N
3' modification: /3AmMO/
AAA AAA CAT TTA TAC CCT ACC TALocking real-time tension signal
15mer non-fluoresccent locking strand5' modification: no modification
3' modification: no modification
A AAA AAC ATT TAT ACLocking real-time tension signal for quantitative analysis
4.7 pN hairpin strand5' modification: no modification
3' modification: no modification
GTGAAATACCGCACAGATGCGT
TTGTATAAATGTTTTTTTCATTTAT
ACTTTAAGAGCGCCACGTAGCC
CAGC
Hairpin probe
Amine ligand strand5' modification: /5AmMC6/
3' modification: /3Bio/
CGCATCTGTGCG GTA TTT CAC TTTHairpin probe
BHQ2 anchor strand5' modification: /5ThiolMC6-D/
3' modification: /3BHQ_2/
TTTGCTGGGCTACGTGGCGCTCTT Hairpin probe
Cy3B ligand strand5' modification: Cy3B
3' modification: /3Bio/
CGCATCTGTGCG GTA TTT CAC TTTHairpin probe
Unlocking strand5' modification: no modification
3' modification: no modification
TAG GTA GGG TAT AAA TGT TTT TTT CUnlocking accumulated tension signal

Herprints en machtigingen

Toestemming aanvragen om de tekst of afbeeldingen van dit JoVE-artikel te hergebruiken

Toestemming aanvragen

Trefwoorden

DNA spanningsprobesimmuuncelkrachtenreceptor ligandinteractiefluorescentiekwantificeringgoudnanodeeltjesverankeringCD8 positieve T cellenhairpin ontvouwingsassaylocking strandstabilisatiepolyethyleenglycol functionaliseringstreptavidine biotinebinding

Gerelateerde artikelen